Published patent and design registration information   march 2nd, 2012
Upcoming SlideShare
Loading in...5

Published patent and design registration information march 2nd, 2012






Total Views
Views on SlideShare
Embed Views



0 Embeds 0

No embeds



Upload Details

Uploaded via as Adobe PDF

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
Post Comment
Edit your comment

Published patent and design registration information   march 2nd, 2012 Published patent and design registration information march 2nd, 2012 Document Transcript

  • ¯Öê™ëü™ü úÖµÖÖÔ»ÖµÖ úÖ ¿ÖÖÃ֍úßµÖ •Ö−ÖÔ»Ö OFFICIAL JOURNAL OF THE PATENT OFFICE×−֐ÖÔ´Ö−Ö ÃÖÓ. 09/2012 ¿ÖãÎú¾ÖÖ¸ü פü−ÖÖӍú: 02/03/2012ISSUE NO. 09/2012 FRIDAY DATE: 02/03/2012 ¯Öê™ëü™ü úÖµÖÖÔ»ÖµÖ úÖ ‹ú ¯ÖύúÖ¿Ö−Ö PUBLICATION OF THE PATENT OFFICE PATENT OFFICE JOURNAL 02/03/2012 3422
  • INTRODUCTIONIn view of the recent amendment made in the Patents Act, 1970 by the Patents (Amendment) Act, 2005effective from 01st January 2005, the Official Journal of The Patent Office is required to be published underthe Statute. This Journal is being published on weekly basis on every Friday covering the various proceedingson Patents as required according to the provision of Section 145 of the Patents Act 1970. All the enquiries onthis Official Journal and other information as required by the public should be addressed to the ControllerGeneral of Patents, Designs & Trade Marks. Suggestions and comments are requested from all quarters so thatthe content can be enriched. (P H Kurian) CONTROLLER GENERAL OF PATENTS, DESIGNS & TRADE MARKS2nd March,2012 PATENT OFFICE JOURNAL 02/03/2012 3423
  • THE PATENT OFFICE KOLKATA, 02/03/2012 Address of the Patent Offices/Jurisdictions The following are addresses of all the Patent Offices located at different places having their Territorial Jurisdiction on a Zonal basis as shown below:-1 Office of the Controller General of Patents, 4 The Patent Office, Designs & Trade Marks, Government of India, Boudhik Sampada Bhavan, Intellectual Property Rights Building, Near Antop Hill Post Office,S.M.Road,Antop Hill, G.S.T. Road, Guindy, Mumbai – 400 037 Chennai – 600 032. Phone: (91)(22) 24123311, Phone: (91)(44) 2250 2081-84 Fax : (91)(22) 24123322 Fax : (91)(44) 2250 2066 E-mail: E-mail: The States of Andhra Pradesh, Karnataka, Kerala, Tamil Nadu and the Union Territories of Puducherry and Lakshadweep.2 The Patent Office, Government of India, 5 The Patent Office (Head Office), Boudhik Sampada Bhavan, Government of India, Near Antop Hill Post Office,S.M.Road,Antop Hill, Boudhik Sampada Bhavan, Mumbai – 400 037 CP-2, Sector –V, Salt Lake City, Phone: (91)(22) 24137701 Kolkata- 700 091 Fax: (91)(22) 24130387 E-mail: Phone: (91)(33) 2367 1943/44/45/46/87 The States of Gujarat, Maharashtra, Madhya Fax: (91)(33) 2367 1988 Pradesh, Goa and Chhattisgarh and the Union E-Mail: Territories of Daman and Diu & Dadra and Nagar Haveli Rest of India3 The Patent Office, Government of India, Boudhik Sampada Bhavan, Plot No. 32., Sector-14, Dwarka, New Delhi – 110075 Phone: (91)(11) 2808 1921 – 25 Fax: (91)(11) 2808 1920 & 2808 1940 E.mail: The States of Haryana, Himachal Pradesh, Jammu and Kashmir, Punjab, Rajasthan, Uttar Pradesh, Uttaranchal, Delhi and the Union Territory of Chandigarh. Website: All applications, notices, statements or other documents or any fees required by the Patents Act, 1970 and The Patents (Amendment) Act, 2005 or by the Patents (Amendment) Rules, 2006 will be received only at the appropriate offices of the Patent Office. Fees: The Fees may either be paid in cash or may be sent by Bank Draft or Cheques payable to the Controller of Patents drawn on a scheduled Bank at the place where the appropriate office is situated. PATENT OFFICE JOURNAL 02/03/2012 3425
  • ¯Öê™ëü™ü úÖµÖÖÔ»ÖµÖ úÖê»ÖúÖŸÖÖ, פü−ÖÖӍ 02/03/2012 úÖµÖÖÔ»ÖµÖÖë êú Öê¡ÖÖ׬֍úÖ¸ü êú ¯ÖŸÖê ×¾Ö×³Ö®Ö •ÖÖÆüÖë ¯Ö¸ü ÛÃ£ÖŸÖ ¯Öê™êü−™ü úÖµÖÖÔ»ÖµÖ êú ¯ÖŸÖê †ÖÓ“Ö׻֍ú †Ö¬ÖÖ¸ü ¯Ö¸ü ¤üÙ¿ÖŸÖ ˆ−֍úê ¯ÖÏÖ¤êü׿֍ú †×¬ÖúÖ¸ü Öê¡Ö êú ÃÖÖ£Ö −Öß“Öê פü‹ Ö‹ Æïü :-1 úÖµÖÖÔ»ÖµÖ: ´ÖÆüÖ×−ÖµÖӡ֍ú, ‹úþÖ, †×³Öú»¯Ö 4 ¯Öê™ëü™ü úÖµÖÖÔ»ÖµÖ “Öê®Ö‡Ô, ŸÖ£ÖÖ ¾µÖÖ¯ÖÖ¸ü דÖÅ−Ö, ‡Ó™êü»ÖꌓÖã†»Ö ¯ÖÏÖê¯Ö™üá ¸üÖ‡™ËüÃÖ ×²ÖÜ»›üÖ ‹−Ö™üÖò¯Ö ×Æü»Ö ›üü֍ú‘Ö¸ êú ÃÖ´Ö߯Öü, ‡Ó›üÛÙÒüµÖ»Ö ‡Ã™êü™ü ‹ÃÖ. ‹´Ö. ¸üÖê›ü, ‹ÃÖ†Ö‡Ô›üßÃÖ߆Öê †Ö¸ü‹´Ö›üß ÖÖê›üÖˆ−Ö ‹×¸üµÖÖ ‹−Ö™üÖò¯Ö ×Æü»Ö, ´Öã´²Ö‡Ô -400 037, ³ÖÖ¸üŸÖ. ‹›ü•ÖÃÖê−™ü ™ãü ‡ÔÖ»Ö °»ÖÖÍú ±úÖê−Ö: (91)(22) 24123311 •Öß.‹ÃÖ.™üß. ¸üÖê›ü, ÖÖµÖ−›üß, ±îúŒÃÖ: (91)(22) 24123322 “Öê®Ö‡Ô - 600 032. ‡Ô.´Öê»Ö: ±úÖê−Ö: (91)(44) 2250 2081-84 ±îúŒÃÖ: (91)(44) 2250-2066 ‡Ô.´Öê»Ö: †Ö−¬ÖÐ ¯ÖϤêü¿Ö, ú−ÖÖÔ™üú, êú¸ü»Ö, ŸÖ×´Ö»Ö−ÖÖ›ãü ŸÖ£ÖÖ ¯Öã›ãü“Öê¸üß ¸üÖ•µÖ Öê¡Ö ‹¾ÖÓ ÃÖÓ‘Ö ¿ÖÖ×ÃÖŸÖ Öê¡Ö, »ÖÖ«ü߯Ö2 ¯Öê™ëü™ü úÖµÖÖÔ»ÖµÖ, ³ÖÖ¸üŸÖ ÃÖ¸üúÖ¸ ²ÖÖîרüú ÃÖÓ¯Ö¤üÖ ³Ö¾Ö−Ö, 5 ¯Öê™ëü™ü úÖµÖÖÔ»ÖµÖ úÖê»ÖúÖŸÖÖ (¯ÖϬÖÖ−Ö úÖµÖÖÔ»ÖµÖ), ‹−Ö™üÖò¯Ö ×Æü»Ö ›üü֍ú‘Ö¸ êú ÃÖ´Ö߯Öü, ²ÖÖîרüú ÃÖÓ¯Ö¤üÖ ³Ö¾Ö−Ö, ‹ÃÖ. ‹´Ö. ¸üÖê›ü, ÃÖ߯Öß-2, ÃÖꌙü¸ü-V, ÃÖÖ»™ü »Öêú ×ÃÖ™üß, ‹−Ö™üÖò¯Ö ×Æü»Ö, ´Öã´²Ö‡Ô - 400 037, úÖê»ÖúÖŸÖÖ- 700 091, ³ÖÖ¸üŸÖ. ±úÖê−Ö: (91)(22) 2413 7701, ±úÖê−Ö: (91)(33) 2367 1943/44/45/46/87 ±îúŒÃÖ: (91)(22) 2413 0387 ±îúŒÃÖ/Fax: (91)(33) 2367 1988 ‡Ô.´Öê»Ö: ‡Ô.´Öê»Ö: Öã•Ö¸üÖŸÖ, ´ÖÆüÖ¸üÖ™Òü, ´Ö¬µÖ ¯ÖϤêü¿Ö, ÖÖê†Ö ŸÖ£ÖÖ ”û¢ÖßÃ֐֜Íü ¸üÖ•µÖ Öê¡Ö ‹¾ÖÓ ÃÖÓ‘Ö ¿ÖÖ×ÃÖŸÖ Öê¡Ö, ¤ü´Ö−Ö ŸÖ£ÖÖ ¤üß¾Ö, ¤üÖ¤ü¸ü ³ÖÖ¸üŸÖ úÖ †¾Ö¿ÖêÂÖ Öê¡Ö †Öî¸ü −֐ָü Æü¾Öê»Öß.3 ¯Öê™ëü™ü úÖµÖÖÔ»ÖµÖ ×¤ü»»Öß, ²ÖÖîרüú ÃÖÓ¯Ö¤üÖ ³Ö¾Ö−Ö, ¯»ÖÖò™ü ÃÖÓ. 32, ÃÖꌙü¸ü - 14, «üÖ¸üúÖ, −Ö‡Ô ×¤ü»»Öß - 110 075. ±úÖê−Ö: (91)(11) 2808 1921-25 ±îúŒÃÖ: (91)(11) 2808 1920, 2808 1940 ‡Ô.´Öê»Ö: Æü׸üµÖ֝ÖÖ, ×Æü´ÖÖ“Ö»Ö ¯ÖϤêü¿Ö, •Ö´´Öæ ŸÖ£ÖÖ ú¿´Ö߸ü, ¯ÖÓ•ÖÖ²Ö, ¸üÖ•ÖãÖÖ−Ö, ˆ¢Ö¸ü ¯ÖϤêü¿Ö, פü»»Öß ŸÖ£ÖÖ ˆ¢Ö¸üÖÓ“Ö»Ö ¸üÖ•µÖ Öê¡ÖÖë, ‹¾ÖÓ ÃÖÓ‘Ö ¿ÖÖ×ÃÖŸÖ Öê¡Ö “ÖÓ›üߐ֜Íü ¾Öê²ÖÃÖÖ‡™ü:¯Öê™ëü™ü †×¬Ö×−ÖµÖ´Ö, 1970 ŸÖ£ÖÖ ¯Öê™ëü™ü (ÃÖÓ¿ÖÖê¬Ö−Ö) †×¬Ö×−ÖµÖ´Ö, 2005 †£Ö¾ÖÖ ¯Öê™ëü™ü (ÃÖÓ¿ÖÖê¬Ö−Ö) ×−ÖµÖ´Ö, 2006 «üÖ¸üÖ ¾ÖÖÓ×”ûŸÖ ÃÖ³Öß †Ö¾Öê¤ü−Ö,ÃÖæ“Ö−ÖÖ‹Ñ, ×¾Ö¾Ö¸üÖ µÖÖ †−µÖ ¤üßÖÖ¾Öê•Ö µÖÖ úÖê‡Ô ¿Ö㻍ú ¯Öê™ëü™ü úÖµÖÖÔ»ÖµÖ êú êú¾Ö»Ö ˆ¯ÖµÖãŒŸÖ úÖµÖÖÔ»ÖµÖ ´Öë þÖߍéúŸÖ ÆüÖëÖê …¿Ö㻍ú: ¿Ö㻍ú µÖÖ ŸÖÖê −֍ú¤ü ºþ¯Ö ´Öë µÖÖ "Controller of Patents" êú −ÖÖ´Ö ´Öë ¤êüµÖ ²Öïú ›ÒüÖ°™ü µÖÖ “Öêú êú «üÖ¸üÖ ³Öê•Öß •ÖÖ Ã֍úŸÖß Æîü •ÖÖê ˆÃÖß Ã£ÖÖ−Ö êú ׍úÃÖ߆−ÖãÃÖæ×“ÖŸÖ ²Öïú ´Öë ¯ÖϤü¢Ö ÆüÖê •ÖÆüÖÑ ˆ¯ÖµÖãŒŸÖ úÖµÖÖÔ»ÖµÖ ÛÃ£ÖŸÖ Æïü… PATENT OFFICE JOURNAL 02/03/2012 3426
  • SPECIAL NOTICE 18 Months publication as required under Section 11A of the Patents Act, 1970 as amended by the Patents (Amendment) Act, 2005.Notice is hereby given that any person at any time before the grant of Patent may give representation by way ofopposition to the Controller of Patents at appropriate office on the ground and in a manner specified undersection 25(1) of the Patents (Amendment) Act, 2005 read with Rule 55 of the Patents (Amendment) Rules,2006.Notice is also given that if any interested person requests for copies of the complete specification, drawing andabstract of any application already published, the photocopy of the same can be supplied by the Patent Office asper the jurisdiction on payment of prescribed fees of Rs.4/- per page. If any further details are required to beobtained, the same can be provided by the respective Patent Offices on request. (P H Kurian) CONTROLLER GENERAL OF PATENTS, DESIGNS & TRADE MARKS PATENT OFFICE JOURNAL 02/03/2012 3427
  • SPECIAL NOTICE Under the new provision of the Patents Act, 1970 as amended by the Patents (Amendment) Act, 2005and Rules there under, Publication of the matter relating to Patents in the Official Gazette of India Part III,Section 2 has been discontinued and instead The Official Journal of the Patent Office is being publishedcontaining all the activities of The Patent Office such as publication of all the patent applications after 18thmonths , grant of patents & all other information in respect of the proceedings as required under the provisionsof the Patents (Amendment) Act, 2005 and Rules thereunder on weekly basis on every Friday.The Journal is uploaded in the website every Friday. So Paper form and CD-ROM form of the Journal arediscontinued from 01/01/2009. SPECIAL NOTICEEvery effort is being taken to publish all the patent applications under section 11(A) of the Patents Act.However, if duplication of publication of any application is found, then earlier date of publication will be takenfor the purpose of provisional protection for applicant and Patent Office will grant Patent not before six monthsfrom the date of second publication, provided that there is there is no third party representation. PATENT OFFICE JOURNAL 02/03/2012 3428
  • Early Publication:The following patent applications have been published under section 11A (2) of The Patents (Amendment) Act 2005 and rule24A of The Patents (Amendment) Rules, 2006. Any person may file representation by way of opposition to the Controller ofPatents at the appropriate office against the grant of the patent in the prescribed manner under section 25(1) of the Patents(Amendment) Act 2005 read with the rule 55 of The Patents (Amendment) Rules, 2006:(12) PATENT APPLICATION PUBLICATION (21) Application No.1135/MUM/2011 A(19) INDIA(22) Date of filing of Application :05/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : MONEY SAVER INDICATOR(51) International classification :G01R21/133 (71)Name of Applicant :(31) Priority Document No :NA 1)MIRC ELECTRONICS LIMITED(32) Priority Date :NA Address of Applicant :G-1, ONIDA HOUSE, MIDC,(33) Name of priority country :NA MAHAKALI CAVES ROAD, ANDHERI(EAST), MUMBAI -(86) International Application No :NA 400093, MAHARASHTRA, INDIA. Filing Date :NA (72)Name of Inventor :(87) International Publication No :N/A 1)KADAM, ASHOK(61) Patent of Addition to Application Number :NA 2)NIMMA, NARENDER Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The present invention concerns a real time money saving indicator which makes a user aware of the energy consumption by a starrated appliance in comparison with the non-star rated appliance. It comprises a calculating and executing means enabled to acceptenergy consumption data as input, further, compare with stored standard data and calculate energy savings and a display meansenabled to display said calculated energy savings in a currency format.No. of Pages : 8 No. of Claims : 6 PATENT OFFICE JOURNAL 02/03/2012 3429
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1384/MUM/2011 A(19) INDIA(22) Date of filing of Application :04/05/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : A DOSE COUNTER(51) International classification :A61M15/00 (71)Name of Applicant :(31) Priority Document No :NA 1)CIPLA LIMITED(32) Priority Date :NA Address of Applicant :289, BELLASIS ROAD, MUMBAI(33) Name of priority country :NA CENTRAL, MUMBAI - 400 008, MAHARASHTRA.(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)MALHOTRA, GEENA(87) International Publication No :N/A 2)RAO, XERXES(61) Patent of Addition to Application Number :NA 3)PURANDARE, SHRINIVAS MADHUKAR Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The present invention relates to a dose counter. Particularly, but not exclusively, the invention relates to a dose counter for use with aMetered Dose Inhaler (MD1). The dose counter comprises a rotary counting element (26) and an actuator (2). The actuator (2) ismovable relative to the rotary counting element (26) and comprises a shaped part (17) which can move into and out of engagementwith a complementary feature (33) of the rotary counting element (26) when the actuator (2) moves between first and secondpositions. When the shaped part (17) of the actuator (2) is engaged with the complementary feature (33) of the rotary counter element(26), rotation of the rotary counter element (26) is resisted. (Figure 4)No. of Pages : 32 No. of Claims : 22 PATENT OFFICE JOURNAL 02/03/2012 3430
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1493/MUM/2011 A(19) INDIA(22) Date of filing of Application :16/05/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : FIELD REPLACEABLE MULTIFUNCTIONAL CARTRIDGE FOR WASTE CONVERSION INTOFUEL(51) International classification :B01D53/00,B01J8/00,C07C7/00 (71)Name of Applicant :(31) Priority Document No :NA 1)TURLAPATI, RAGHAVENDRA RAO(32) Priority Date :NA Address of Applicant :602-B, SWEET HOME, S. V. PATEL(33) Name of priority country :NA NAGAR, ANDHERI WEST, MUMBAI 400053,(86) International Application MAHARASHTRA, INDIA :NANo 2)N/A :NA Filing Date (72)Name of Inventor :(87) International Publication No :N/A 1)TURLAPATI, RAGHAVENDRA RAO(61) Patent of Addition to 2)N/A :NAApplication Number :NA Filing Date(62) Divisional to Application :NANumber :NA Filing Date(57) Abstract :Disclosed herein is a field replaceable multifunctional cartridge for the conversion of composite high molecular weight hydrocarbonvapours, extracted from homogenous or heterogeneous, segregated or comingled, moist and unclean miscellaneous multi-feed wasteinput, to produce low molecular weight fractions of industriously combustible fuel products through catalytic cracking. Themultifunctional cartridge system is constructed in a modular fashion is capable of performing the catalytic, cleaning and scrubbingfunctions through the temperature range ranging from ambient to 500°C, owing to the high mechanical strength, low coefficient ofexpansion, resistance to thermal fatigue etc.No. of Pages : 18 No. of Claims : 11 PATENT OFFICE JOURNAL 02/03/2012 3431
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1042/MUM/2011 A(19) INDIA(22) Date of filing of Application :31/03/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : SHAFT LOCKING ARRANGEMENT FOR SLIP RING HT MOTORS(51) International classification :H01R39/08,H01R39/14 (71)Name of Applicant :(31) Priority Document No :NA 1)CROMPTON GREAVES LIMITED(32) Priority Date :NA Address of Applicant :CG HOUSE, 6TH FLOOR, DR.(33) Name of priority country :NA ANNIE BESANT ROAD, WORLI, MUMBAI 400 030,(86) International Application No :NA MAHARASHTRA, INDIA. Filing Date :NA (72)Name of Inventor :(87) International Publication No :N/A 1)DAS MUKUL(61) Patent of Addition to Application :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A shaft locking mechanism for fan covers of motors, said fan cover including a co-planar mounted fan at its one end and an elongateconduit adapted to guide air from said fan, said fan being mounted on a shaft, characterised in that, said mechanism comprises anelongate channel adapted to be co-axially mounted with respect to said shaft at the external distal end of said shaft, thereby preventingaxial movement of said shaft.No. of Pages : 15 No. of Claims : 7 PATENT OFFICE JOURNAL 02/03/2012 3432
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1487/MUM/2011 A(19) INDIA(22) Date of filing of Application :16/05/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : A WATER SOLUBLE COMPOSITION HAVING ENHANCED BIOAVAILABILILTY ANDPROCESS THEREOF(51) International classification :A61K31/12,A61K9/00 (71)Name of Applicant :(31) Priority Document No :NA 1)OMNIACTIVE HEALTH TECHNOLOGIES LTD(32) Priority Date :NA Address of Applicant :RAJAN HOUSE, APPASAHEB(33) Name of priority country :NA MARATHE MARG, PRABHADEVI, MAHARASHTRA, INDIA(86) International Application No :NA 400025 Maharashtra India Filing Date :NA (72)Name of Inventor :(87) International Publication No :N/A 1)JAYANT VENKATESH DESHPANE(61) Patent of Addition to Application 2)SHRINIVAS KRISHNARAO KULKARNI :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The invention disclosed relates to a water-soluble composition having enhanced bioavailability useful for the treatment of depressionwhich comprises a synergistic combination of curcumin, at least an antioxidant, a hydrophilic carrier and a fat. The invention alsodiscloses a process for the preparation of the curcumin composition which comprises the steps of dissolving curcumin. at least oneantioxidant, a hydrophilic carrier and a fat in a solvent to form a homogenous mass; warming the resultant mass at a temperatureranging from 25°C to 60°C for a period of 4 to 8 hours to obtain a dry wet mass; removing the solvent by evaporation to form drymass and pulverizing the dry mass to form a fine powder.No. of Pages : 37 No. of Claims : 15 PATENT OFFICE JOURNAL 02/03/2012 3433
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1543/MUM/2011 A(19) INDIA(22) Date of filing of Application :20/05/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : CATALYSTS FOR PRODUCTION OF COMBUSTIBLE FUEL AND FIXED CARBONS FROMHOMOGENEOUS AND HETEROGENEOUS WASTE(51) International classification :C07C7/00 (71)Name of Applicant :(31) Priority Document No :NA 1)TURLAPATI, RAGHAVENDRA RAO(32) Priority Date :NA Address of Applicant :602-B, SWEET HOME, S. V. PATEL(33) Name of priority country :NA NAGAR, ANDHERI(WEST), MUMBAI - 400053,(86) International Application No :NA MAHARASHTRA, INDIA Filing Date :NA (72)Name of Inventor :(87) International Publication No :N/A 1)TURLAPATI, RAGHAVENDRA RAO(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :Disclosed herein is an external, fixed bed, agglomerated nano catalyst of the general formula; AxByOz/Qn. (OH)m where, Arepresents transition element B represents rare earth elements including the lanthanide series, and actinide series either alone ormixture thereof in metallic or oxide or as hydroxides;Q represents montmorillonate clay or its derivatives; and optionally along withan organic binder; for conversion of various homogeneous and heterogeneous waste material into useful hydrocarbon fuel as oil, gasand as solid carbon.No. of Pages : 33 No. of Claims : 21 PATENT OFFICE JOURNAL 02/03/2012 3434
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1717/MUM/2011 A(19) INDIA(22) Date of filing of Application :13/06/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : INTERNET BASED INTEGRATION OF CONTENT FILE FOR BROADCAST(51) International classification :H04L12/18 (71)Name of Applicant :(31) Priority Document No :NA 1)AJAY VERMA(32) Priority Date :NA Address of Applicant :701, THAKAR APRATMENTS, JUHU(33) Name of priority country :NA GALLY, ANDHERI WEST, MUMBAI - 400058 Maharashtra(86) International Application No :NA India Filing Date :NA (72)Name of Inventor :(87) International Publication No :N/A 1)AJAY VERMA(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The present invention provides a method for internet based integration of a content file for broadcast. The method includes steps of,registering and logging by a user on a website, uploading by the user a media file, paying scrutiny fees through the website andacceptance of policy, generating a first unique code by the website for the media file, checking format of the media file by a serverconnected to the website. Thereafter, selecting the media file having format matching to a predefined format, else rejecting. Further,informing the user rejection and reasons thereof or selection with second unique code thereof. Thereafter, transcoding the selectedmedia file in the server for visual check, and transcoding the media file in the server for broadcasting, thereafter informing the userand making available to other to see and vote. At last selecting a media file depending upon votes and is broadcast as per predefinedtime depending upon the genre.No. of Pages : 16 No. of Claims : 8 PATENT OFFICE JOURNAL 02/03/2012 3435
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1777/MUM/2011 A(19) INDIA(22) Date of filing of Application :17/06/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : ZERO DISCHARGE SYSTEM FOR REVERSE OSMOSIS REJECTED TREATED EFFLUENT(51) International classification :C02F1/44 (71)Name of Applicant :(31) Priority Document No :NA 1)Patel Abhishek Ranchhodbhai(32) Priority Date :NA Address of Applicant :8 Shubada Colony Nr. Jodhpur(33) Name of priority country :NA Village Road Satellite Ahmedabad 380015 Gujarat India(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)Patel Abhishek Ranchhodbhai(87) International Publication No : NA(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The present invention discloses intrinsically and techno economically viable for sustained and long term compliance of noveltechnique of Zero Discharge System for suitable pre treated RO (Reverse Osmosis) rejected effluent without using heat input andburning fuel which is less expensive, less maintenance and less resultant degradation of its efficiency compared to other equivalentconventional plants. Suitable pre treated reverse osmosis rejected effluent converts itself into water vapours almost instantly atambient conditions, after it has been atomized to sub micron size through large quantity of compressed air and a suitable mechanismto ensure large interfacial area between air and water under the influence of intense turbulence.No. of Pages : 12 No. of Claims : 7 PATENT OFFICE JOURNAL 02/03/2012 3436
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2011/MUM/2011 A(19) INDIA(22) Date of filing of Application :13/07/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : AN INTELLIGENT TRANSFORMER MONITORING SYSTEM(51) International classification :G01R31/02 (71)Name of Applicant :(31) Priority Document No :NA 1)CROMPTON GREAVES LIMITED(32) Priority Date :NA Address of Applicant :CG HOUSE, DR. ANNIE BESANT(33) Name of priority country :NA ROAD, WORLI, MUMBAI 400 030, MAHARASHTRA, INDIA.(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)SANDERS DAVID G.(87) International Publication No :N/A(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :An intelligent transformer monitoring system comprising: plurality of monitoring components adapted to monitor transformerconditions in relation to each of a predefined element or parameter of said transformer; data merging unit adapted to collate readingsfrom each of said monitoring components, said data merging unit further comprising computational means adapted to compute andoutput a first operational data stream in relation to operational data and a second maintenance data stream in relation to maintenancedata and data logging means adapted for logging data of said transformers parameters to permit root-cause analysis of alarms forcondition based maintenance purposes; supervisory control and data acquisition system adapted to receive said first data stream;network means adapted to receive said second data for further relaying to further means for purposes of maintenance scheduling; andserver means adapted to receive said second data stream, said server being equipped with artificial intelligence in order to process andinterpret said second stream data in relation to pre-defined parameters and models in order to obtain predictions of transformerperformance parameters and servicing calls in relation to said predicted performance, thereby obtaining a condition based servicingmodel.No. of Pages : 16 No. of Claims : 11 PATENT OFFICE JOURNAL 02/03/2012 3437
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1995/MUM/2011 A(19) INDIA(22) Date of filing of Application :12/07/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : A GEYSER RELIABILITY TESTING SYSTEM(51) International classification :G01R31/00 (71)Name of Applicant :(31) Priority Document No :NA 1)CROMPTON GREAVES LIMITED(32) Priority Date :NA Address of Applicant :CG HOUSE, 6TH FLOOR, DR.(33) Name of priority country :NA ANNIE BESANT ROAD, WORLI, MUMBAI 400 030,(86) International Application No :NA MAHARASHTRA, INDIA Filing Date :NA (72)Name of Inventor :(87) International Publication No :N/A 1)SARMA BUDHAVARAPU PAVAN SRINIVAS(61) Patent of Addition to Application Number :NA 2)GARG DAMODAR Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A geyser reliability testing system adapted to test reliability of said geyser and its elements, said system comprises: input meansadapted to allow a tester to input at parameters in relation to working of said geyser and its elements; mode selection means adapted toselect modes of operation for said system in order to test each of said elements; coupling means adapted to selectively couple selectiveelements of said geyser in relation to said selected mode of operation; actuation means adapted to actuate cyclic operating modes fortesting said geyser; monitoring means adapted to monitor various working parameters through the deployment of cyclic modes ofoperation, look-up table from a stored database used to identify the problematic elements in accordance with pre-defined patterns ofproblems; and identification means adapted to identify problematic elements using inputs from said current monitoring means, saidpressure monitoring means, said water temperature monitoring means and said input parameters from said input means, and said look-up table from said stored database.No. of Pages : 35 No. of Claims : 33 PATENT OFFICE JOURNAL 02/03/2012 3438
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1996/MUM/2011 A(19) INDIA(22) Date of filing of Application :12/07/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : AN ELECTRIC IRON RELIABILITY TESTING SYSTEM(51) International classification :G01R31/00 (71)Name of Applicant :(31) Priority Document No :NA 1)CROMPTON GREAVES LIMITED(32) Priority Date :NA Address of Applicant :CG HOUSE, 6TH FLOOR, DR.(33) Name of priority country :NA ANNIE BESANT ROAD, WORLI, MUMBAI 400 030,(86) International Application No :NA MAHARASHTRA, INDIA. Filing Date :NA (72)Name of Inventor :(87) International Publication No :N/A 1)SARMA BUDHAVARAPU PAVAN SRINIVAS(61) Patent of Addition to Application Number :NA 2)GARG DAMODAR Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :An electric iron reliability testing system adapted to test reliability of said electric iron and its elements, said system comprises: testingtable adapted to test a plurality of electric irons simultaneously, said testing table comprising: flat surface over which fabric that is tobe ironed is laid out such that it covers said flat surface; parallel elongate guides along its length which serve as rails for linear motionof the plurality of irons over aid fabric wherein the irons are held over said fabric, in communication with said fabric, by means ofindependent fixtures, each fixture corresponding to each iron and to each guide rail, which fixture glides over the elongate guides inorder to maintain linear and parallel motion of each of said electric irons over said fabric; drive screw guide in order to drive thefixtures over the fabric from one end of the table to another end along the length of said elongate guides; motor equipped to drive saiddrive screw guide, and hence each of said fixtures and said irons over said fabric; proximity sensors are provided at each end of thetable to sense iron position and to provide signals to a drive unit (DU) to reverse linear motion so that the fixture (and hence, the irons)move to and fro in a linear manner up to defined time or movement cycles.No. of Pages : 22 No. of Claims : 10 PATENT OFFICE JOURNAL 02/03/2012 3439
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2012/MUM/2011 A(19) INDIA(22) Date of filing of Application :13/07/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : AN IMPROVED NOZZLE(51) International classification :B05B1/00 (71)Name of Applicant :(31) Priority Document No :NA 1)CROMPTON GREAVES LIMITED(32) Priority Date :NA Address of Applicant :CG HOUSE, 6TH FLOOR, DR.(33) Name of priority country :NA ANNIE BESANT ROAD, WORLI, MUMBAI 400 030,(86) International Application No :NA MAHARASHTRA, INDIA. Filing Date :NA (72)Name of Inventor :(87) International Publication No :N/A 1)DESALE RAJGOPAL SHIVDAS(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :An improved nozzle having an input region, a throat region, and an output region, said nozzle comprises: replaceable annular ringwith inward teethed projections being projected towards the centre, said inward teethed projections adapted to be angularly displacedand said ring adapted to fit before said throat region of said nozzle in order to impart ablation characteristics to said nozzle, in that,said teeth projections being made of ablation imparting material, and said nozzle being lined interiorly with smooth flow impartingmaterial.No. of Pages : 16 No. of Claims : 10 PATENT OFFICE JOURNAL 02/03/2012 3440
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2082/MUM/2011 A(19) INDIA(22) Date of filing of Application :21/07/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : A COLLAPSIBLE HIGH VOLTAGE CORONA SHIELD FOR CURRENT TRANSFORMER(51) International classification :H01F38/30 (71)Name of Applicant :(31) Priority Document No :NA 1)CROMPTON GREAVES LIMITED(32) Priority Date :NA Address of Applicant :CG HOUSE, 6TH FLOOR, DR.(33) Name of priority country :NA ANNIE BESANT ROAD, WORLI, MUMBAI 400 030,(86) International Application No :NA MAHARASHTRA, INDIA. Filing Date :NA (72)Name of Inventor :(87) International Publication No :N/A 1)AWKALE RAMESH RAMAKRISHNA(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A collapsible high voltage corona shield for current transformer, said shield comprises: dual hemi-barrel shaped elements adapted toform a barrel shaped complete structure with a relatively narrower top, a relatively broad middle segment and a relatively narrow base,said barrel shaped structure being a substantially hollow structure; bellow guide chamber adapted to provide dead weight in line withthe centre of gravity of said barrel shaped complete structure, said bellow guide chamber being a cylinder with a protruding shaft onits operative top side which co-operates with a guide rod extending in an operative downward manner in the interior of and from thetop of said barrel shaped complete structure, in that, said co-operation of the protruding shaft with the guide rod being the aiding of upand down movement of said bellow guide chamber in a vertical plane in respect of a piston arrangement at said guide rod, said bellowchamber being further adapted to rest on current transformer; hinge adapted to suspend said guide rod, said hinge spanning across saidoperative top opening of said barrel shaped complete structure; and at least two levers, one for each hemi-barrel shaped element, eachof said levers adapted to facilitate opening of each of said hemi-barrel shaped elements in an outwardly angular manner when saidbellow guide chamber moves in an operative downward direction due to piston operation, to facilitate an open or closed positiondepending upon piston movement and subsequent lever action.No. of Pages : 27 No. of Claims : 7 PATENT OFFICE JOURNAL 02/03/2012 3441
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2132/MUM/2011 A(19) INDIA(22) Date of filing of Application :27/07/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : HERBAL COMPOSITION ON BREAST ENHANCEMENT(51) International classification :A61K36/00 (71)Name of Applicant :(31) Priority Document No :NA 1)NEHA NIRAD KHALANE(32) Priority Date :NA Address of Applicant :SINHAGAD ROAD, OMKAR(33) Name of priority country :NA GARDEN G/5/14, MANIK BAUG, PUNE - 51(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)N/A(87) International Publication No :N/A(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A herbal synergistic composition for enhancement of breast, and method of use, comprising the following herbs, a sesame oil is anedible oil extracted by cold processing from pure white sesame seeds which acts as preservatives, the said oil taken in the range of 5-10ml, further a Patchauli ( Pogostemon Patchoali) oil extracted by cold process from shoots, stem plant or any part in the range of 0.5to 2ml, taken 0.5 to 2 ml oil of ylang ylang ( conango odorate) extracted from a parts flower, (kangada) oil taken in the range of 0.5 to2ml and a lavender oil taken in the range of 0.5 to 2ml.No. of Pages : 4 No. of Claims : 2 PATENT OFFICE JOURNAL 02/03/2012 3442
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2189/MUM/2011 A(19) INDIA(22) Date of filing of Application :02/08/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : A SYSTEM FOR CONTROLLING A CIRCUIT BREAKER WITH DOUBLE TRIP COILS (71)Name of Applicant : 1)CROMPTON GREAVES LIMITED(51) International classification :H01H71/00,H01H73/02 Address of Applicant :CG HOUSE, 6TH FLOOR, DR.(31) Priority Document No :NA ANNIE BESANT ROAD, WORLI, MUMBAI 400 030,(32) Priority Date :NA MAHARASHTRA, INDIA.(33) Name of priority country :NA (72)Name of Inventor :(86) International Application No :NA 1)PANDHARKAR ANJANI Filing Date :NA 2)RAJPAL PRASHANT(87) International Publication No :N/A 3)KALE SUBODH(61) Patent of Addition to Application 4)POTNIS SHRIKANT :NANumber 5)RAO NAYANA :NA Filing Date 6)SHINDE HEMANT(62) Divisional to Application Number :NA 7)EKRAM SAMSUL Filing Date :NA 8)NAMJOSHI YOGENDRA 9)KAMBLI UPENDRA 10)PATANGE RAJIV(57) Abstract :A system for a circuit breaker with double trip coil and controller for double trip coil, thereof, for a power system, said systemcomprises: main tripping coil adapted to trip said circuit breaker in cases of tripping command as sensed by a controller, said maintripping coil being powered by a supply line; auxiliary tripping coil adapted to trip said circuit breaker in cases of pre-determinedtripping command as sensed by a controller, said auxiliary tripping coil functioning as a backup tripping coil to said main trippingcoil, said auxiliary tripping coil being powered by a supply line; close coil adapted to close said circuit breaker in cases of closingcommand as sensed by a controller; and controller means adapted to provide actuation control signals to each of said main trippingcoil, said auxiliary tripping coil along with main tripping coil and further adapted to provide actuation control signals to said close coilbased, each of said control signals to said main tripping coil, said auxiliary tripping coil, and said close coil being based on sensedload line parameters, a plurality of input parameters, user-defined parameters and computational models, thereby providing a singlecontroller means for actuation of at least one tripping coil within a defined actuation time, said tripping coil being selected from amain tripping coil and an auxiliary tripping coil, thereby providing improved reliability and stability of said power system.No. of Pages : 19 No. of Claims : 10 PATENT OFFICE JOURNAL 02/03/2012 3443
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2237/MUM/2011 A(19) INDIA(22) Date of filing of Application :09/08/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : AN ELECTROMECHANICAL STAGE LOCKING SYSTEM FOR TELESCOPIC MAST(51) International classification :E04H12/18,B66F11/00 (71)Name of Applicant :(31) Priority Document No :NA 1)GAURAV R. SHARMA(32) Priority Date :NA Address of Applicant :F3, HDFC COLONY, CHINCHWAD,(33) Name of priority country :NA PUNE - 19 Maharashtra India(86) International Application No :NA 2)RAJKUMAR J. SHARMA Filing Date :NA (72)Name of Inventor :(87) International Publication No :N/A 1)GAURAV R. SHARMA(61) Patent of Addition to Application 2)RAJKUMAR J. SHARMA :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :An electromechanical stage locking system for telescopic Mast with an adjustable height, characterized in that an Interference Plate -No. 1 as shown in fig.l, is being provided for integrating the platform to the base frame assembly, by fixing means, the said base frameassembly further gets bolted with the interface plate which in turn is bolted to the platform, a steel fabricated base Frame, ( 2) asshown in figure 2, provided on which a motor and drive assembly and mast are to be mounted, a sprit level is provided in the x and ydirection is being mounted for sensing the level of the base frame, L frame ( 3) as shown in figure no.3 provided gives surroundingsupport to the mast on which control panel can be mounted by this L frame the entire assembly is fixed to the hang on frame, furtherthe L - frame is integrated with the base frame, for supporting the mast at the bottom and top, and also it is used to fix the mastAssembly to hang on frame.No. of Pages : 22 No. of Claims : 13 PATENT OFFICE JOURNAL 02/03/2012 3444
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2353/MUM/2011 A(19) INDIA(22) Date of filing of Application :19/08/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : A RATCHET WHEEL AND CIRCUIT BREAKER THEREOF(51) International classification :H01H3/30,H01H71/10 (71)Name of Applicant :(31) Priority Document No :NA 1)CROMPTON GREAVES LIMITED(32) Priority Date :NA Address of Applicant :CG HOUSE, 6TH FLOOR, DR.(33) Name of priority country :NA ANNIE BESANT ROAD, WORLI, MUMBAI 400 030,(86) International Application No :NA MAHARASHTRA, INDIA Filing Date :NA (72)Name of Inventor :(87) International Publication No :N/A 1)DESALE RAJGOPAL SHIVDAS(61) Patent of Addition to Application :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A ratchet wheel with improved load bearing capability and improved shock absorbing capability, said ratchet wheel comprising: awheel element with predefined slots equi-angularly defined about wheel centre and within the circumference of said wheel element; asubstantially circular bracket adapted to be fitted co-axially with respect to an operative back plane of said wheel element, said bracketincluding integral raised machined projections with a pre-defined degree of curvature defined by its lateral sides, said raised machinedprojections being adapted to be fitted into a portion of said slot such that one of its lateral sides abuts one edge of said slot; and abumper element adapted to be fit in remainder of said slot such that it fills the remainder of the slot completely, thereby providing atight fit of said bumper element and said stopper element within said slot. The invention also includes a circuit breaker assemblyinvolving such a ratchet wheel as described above.No. of Pages : 19 No. of Claims : 14 PATENT OFFICE JOURNAL 02/03/2012 3445
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2420/MUM/2011 A(19) INDIA(22) Date of filing of Application :29/08/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : AN IMPROVED HEATING ELEMENT(51) International classification :H05B3/10,C23C26/00 (71)Name of Applicant :(31) Priority Document No :NA 1)CROMPTON GREAVES LIMITED(32) Priority Date :NA Address of Applicant :CG HOUSE, 6TH FLOOR, DR.(33) Name of priority country :NA ANNIE BESANT ROAD, WORLI, MUMBAI 400 030,(86) International Application No :NA MAHARASHTRA, INDIA. Filing Date :NA (72)Name of Inventor :(87) International Publication No :N/A 1)DMELO DAWID(61) Patent of Addition to Application 2)SINGAL VIVEK :NANumber 3)SARMA BUDHAVARAPU PAVAN SRINIVAS :NA Filing Date 4)GARG DAMODAR(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :There is provided a scale-inhibiting heating element which prevents the scale deposition and scale build-up on the heating element of awater heater. The scale -inhibiting heating element has a coating of Teflon containing nano-particles on the external surface of theheating element to prevent scaling. At the same time, the coating on the heating element does not affect the heating efficiency of theheating element.No. of Pages : 11 No. of Claims : 4 PATENT OFFICE JOURNAL 02/03/2012 3446
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2692/MUM/2010 A(19) INDIA(22) Date of filing of Application :28/09/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : A PROCESS FOR THE PREPARATION AND PURIFICATION OF FILGRASTIM(51) International classification :C12N15/27 (71)Name of Applicant :(31) Priority Document No :NA 1)GENNOVA BIOPHARMACEUTICALS LIMITED(32) Priority Date :NA Address of Applicant :P-1, IT - BT PARK MIDC PHASE - 2,(33) Name of priority country :NA HINJWADI, PUNE - 411 057, INDIA.(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)SANTOSH UDHAVRAO POKALWAR(87) International Publication No :N/A 2)NANDANKUMAR GOVIND BHAGAT(61) Patent of Addition to Application Number :NA 3)KRISHNA NAND TIWARI Filing Date :NA 4)DILEEP TIWARI(62) Divisional to Application Number :NA 5)MAHESHWARI KUMAR MISHRA Filing Date :NA 6)SANJAY SINGH(57) Abstract :The present invention related to a process for the preparation of filgrastim of higher purity and yield using a novel multi steps liquidchromatographic method after the over-expression of the protein in prokaryotic cells. This invention makes use of a combination ofion exchange chromatographic resins in series having superior separation characters over presently known processes. High purityfilgrastim prepared in the first part is used as such or subjected to pegylation to prepare pegfilgrastim of higher purity for thepharmaceutical applications.No. of Pages : 32 No. of Claims : 15 PATENT OFFICE JOURNAL 02/03/2012 3447
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.3219/MUM/2011 A(19) INDIA(22) Date of filing of Application :14/11/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : OIL SAVING BOTTLE(51) International classification :B65D1/02 (71)Name of Applicant :(31) Priority Document No :NA 1)MR. DESAI PRABHAKAR YESHWANT.(32) Priority Date :NA Address of Applicant :B/G/3 NEW BALKRISHNA COOP(33) Name of priority country :NA HSG SOC, JIVDANI ROAD, NEAR GANESH HOSPITAL,(86) International Application No :NA VIRAR (EAST), PIN 401303. TAL- VASAI, DIST- THANE Filing Date :NA STATE-MAHARASHTRA, INDIA(87) International Publication No :N/A (72)Name of Inventor :(61) Patent of Addition to Application Number :NA 1)MR. DESAI PRABHAKAR YESHWANT. Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :PROVIDED HEREIN A NOVEL METHOD OF MAKING A OIL SAVING BOTTLE TO SAVE WASTAGE OF OIL ROLLEDOVER ON THE OUTER SURFACE OF THE BOTTLE, WHEN THE OIL IS CONSUMED FROM THE BOTTLE. ROLLEDOVER OIL ON THE OUTER SURFACE OF THE BOTTLE ,GOES AGAIN IN THE SAME BOTTLE BY ARRANGEMENTMADE IN THE BOTTLE. HENCE OILINESS, STICKIINESS AND DIRTINESS,MADE BY ROLLED OVER OIL, ON THEOUTER SURFACE OF THE BOTTLE IS ELIMINATED. SUITABLE ARRANGEMENT OF HANDLE ON THE BODY OFBOTTLE IS MADE TO MAKE THE BOTTLE MORE USEFUL.No. of Pages : 17 No. of Claims : 10 PATENT OFFICE JOURNAL 02/03/2012 3448
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2421/MUM/2011 A(19) INDIA(22) Date of filing of Application :29/08/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : DOUBLE ACTING TWO-WAY MOUNTING SHOCK ABSORBER OF A CIRCUIT BREAKERASSEMBLY(51) International classification :H01H3/60 (71)Name of Applicant :(31) Priority Document No :NA 1)CROMPTON GREAVES LIMITED(32) Priority Date :NA Address of Applicant :CG HOUSE, 6TH FLOOR, DR.(33) Name of priority country :NA ANNIE BESANT ROAD, WORLI, MUMBAI 400 030,(86) International Application No :NA MAHARASHTRA, INDIA Filing Date :NA (72)Name of Inventor :(87) International Publication No :N/A 1)DESALE RAJGOPAL SHIVDAS(61) Patent of Addition to Application Number :NA 2)SONAR PANKAJ Filing Date :NA 3)KODTE SANDEEP(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A double acting two-way mounting shock absorber of a circuit breaker assembly, said assembly comprises: bell crank lever coupledwith a reciprocating first operating rod driven by a crankshaft and further mechanically coupled with a second operating rodtransversely disposed in relation to said first operating rod,, with an angular displacement, of said lever, occurring in an operative anti-clockwise direction about its pivoting point; two-way piston being co-axially located within an inner cylinder; disengageable discadapted to receive the distal end of said piston, in that, as said piston moves inwards towards said circuit breaker assembly, said discmoves to rest against said distal end of said inner cylinder, and as said piston moves outwards away from said circuit breakerassembly, and resilient means (spring), in that, the operation of said first operating rod in an operative downward direction causingsaid lever to move said second operating rod and said piston in an operative outward direction, thereby causing said disc to moveaway from the operative distal end of said inner cylinder and thus causing release of said spring to achieve open condition of saidcircuit breaker and further the operation of said first operating rod in an operative upward direction causing said lever to move saidsecond operating rod and said piston in an operative inward direction, thereby causing said disc to move towards the operative distalend of said inner cylinder and thus causing tensioning of said spring to achieve closed condition of said circuit breaker.No. of Pages : 26 No. of Claims : 6 PATENT OFFICE JOURNAL 02/03/2012 3449
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2440/MUM/2011 A(19) INDIA(22) Date of filing of Application :02/09/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : TESTING APPARATUS FOR DETERMINING AIR FLOW DELIVERY(51) International classification :F24F7/10 (71)Name of Applicant :(31) Priority Document No :NA 1)CROMPTON GREAVES LIMITED(32) Priority Date :NA Address of Applicant :CG HOUSE, 6TH FLOOR, DR.(33) Name of priority country :NA ANNIE BESANT ROAD, WORLI, MUMBAI 400 030,(86) International Application No :NA MAHARASHTRA, INDIA. Filing Date :NA (72)Name of Inventor :(87) International Publication No :N/A 1)BHAT AMIT(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A testing apparatus for determining air flow delivery comprising an adjustable table for supporting an air delivery device such as afan. Further, the apparatus comprises an air flow measuring device placed opposite the air delivery device i.e. fan for determining theair flow. Further, the apparatus provides at least two measuring instruments to facilitate simultaneous reading of the air deliverydevice i.e. fan and the air flow measurement device.No. of Pages : 18 No. of Claims : 9 PATENT OFFICE JOURNAL 02/03/2012 3450
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.496/MUM/2011 A(19) INDIA(22) Date of filing of Application :23/02/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : TYRE PUNCTURE WARNING AND AUTOMATIC TYRE-LIGHT DEVICE(51) International classification :B60C23/02 (71)Name of Applicant :(31) Priority Document No :NA 1)DOLE MANOJ MADHUKAR(32) Priority Date :NA Address of Applicant :AT/P-GOUDGAON, TAL-BARSHI,(33) Name of priority country :NA DIST-SOLAPUR, PIN- 413406 MAHARASHTRA, INDIA(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)DOLE MANOJ MADHUKAR(87) International Publication No :N/A(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The present invention provides a tyre air pressure warning and automatic tyre illuminating device for a vehicle. The device includes aplate attached perpendicularly to a wheel rim of the vehicle. The device further includes a rod swivelably attached to the plate. A firstend of the rod and a second portion of the plate are connected by a spring. The device further includes a roller configured at the secondend of the rod, near a tyre wall of the vehicle and a switch. When an air pressure in the tyre is reduced, the tyre wall bulge out side andtouches to the roller thereby swiveling the rod about the predefined degree and releasing pressure on the switch to complete a circuit,so that power supply goes to dashboard unit to provide an alarm and an illuminating device at tyre.No. of Pages : 13 No. of Claims : 3 PATENT OFFICE JOURNAL 02/03/2012 3451
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.593/MUM/2011 A(19) INDIA(22) Date of filing of Application :03/03/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : CLUTCH/DECLUTCH & GEARSHIFT WORK, UNDER WALK/NON WALK SYSTEM ALONGWITH LOCK PAD.(51) International classification :F16H61/00,B60W30/00 (71)Name of Applicant :(31) Priority Document No :NA 1)AMOL S. KAKADE(32) Priority Date :NA Address of Applicant :GAJANAN NAGAR W. NO 16,(33) Name of priority country :NA CHIKHLI, DIST BULDHANA. Maharashtra India(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)AMOL S. KAKADE(87) International Publication No :N/A(61) Patent of Addition to Application :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :This invention is related to clutch and gear shift. In this system the clutch and gear shift have been perfectly synchronized in acommon system. In the system there is up/down chamber through the gear shift is moved up/down due to which the clutching/De-clutching process is completed. Due to this invention vehicle cannot get any kind of jerks during De-clutching. The clutch inner wireis fixed on up/down chamber. Due to this invention the driver will not have to pay extra more attention while De-clutching. Theunwanted operations of gear shift are restricted by lock pad in this system. This system has been designed in such a way that the gearcannot be changed with half clutching or without clutching. In order to change the gear, the driver will have to press clutch fully. TheDe-clutching process is done automatically or manually which may reduce the maximum damage to the gearbox. This inventionprevents extreme noise during gear transmission. Hence it will increase the life time of gearbox and clutch plate. And because of thisinvention, the driving becomes comfortable.No. of Pages : 18 No. of Claims : 11 PATENT OFFICE JOURNAL 02/03/2012 3452
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.869/MUM/2011 A(19) INDIA(22) Date of filing of Application :24/03/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : AN ULTRAVIOLET RADIATION CURABLE INK COMPOSITION FOR INKJET APPLICATION ONTHE PAINTED AUTOMOTIVE PARTS OR PAINTED POLYMER AUTOMOTIVE SUBSTRATES FOR DECORATION ANDTEXT PRINTING PURPOSE WITH CLEAR TOPCOAT(51) International classification :C09D11/02 (71)Name of Applicant :(31) Priority Document No :NA 1)KANSAI NEROLAC PAINTS LTD(32) Priority Date :NA Address of Applicant :NEROLAC HOUSE, GANPATRAO(33) Name of priority country :NA KADAM MARG, LOWER PAREL, MUMBAI - 400 013,(86) International Application No :NA INDIA. Maharashtra India Filing Date :NA (72)Name of Inventor :(87) International Publication No :N/A 1)MEHROTRA MAHESH GOVIND(61) Patent of Addition to Application Number :NA 2)KHISMATRAO PRADEEP KRISHNAJI Filing Date :NA 3)VAIDYA MRUNAL MILIND(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :An UV curable composition which exhibits a relative low viscosity and is curable at a high sensitivity, forming a coating of superioradhesion and hardness, and its use on the base coat painted automotive parts which are lacquered by conventional taping lacquer. Theinvention concerns coatings curable by ultraviolet radiation, which may be printed on to polymer substrates to provide a thermal drop-on-demand ink-jet receptive layer. The novelty of the invention lies in the ultraviolet radiation curable ink composition comprisingUV curable ink blend, colourant, flow or leveling additives, substrate wetting additives, defoamers, slip additives, organic solvents, forinkjet application on the painted automotive parts or painted polymer automotive substrates for decoration and text printing purposewith clear topcoat over it.No. of Pages : 36 No. of Claims : 20 PATENT OFFICE JOURNAL 02/03/2012 3453
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1540/CHE/2011 A(19) INDIA(22) Date of filing of Application :04/05/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : A MULTI-PURPOSE ARTICLE FASTENER FOR MOTORCYCLE(51) International classification :B62K (71)Name of Applicant :(31) Priority Document No :NA 1)MR. ZAHIR SALIM SIYO(32) Priority Date :NA Address of Applicant :CHELANKARA HOUSE,(33) Name of priority country :NA VAVAD.P.O, 673 572-PIN, KOZHIKODE DISTRICTT Kerala(86) International Application No :NA India Filing Date :NA (72)Name of Inventor :(87) International Publication No : NA 1)MR. ZAHIR SALIM SIYO(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A multi-purpose article fastener for motorcycles (Fig-1) is provided which acts as a holder for articles while the motorcycle is inmotion and acts as a locking means for articles while the motorcycle is locked. The locking action is achieved passively by thefastener when the motorcycle is locked with the steering lock and doesnt need any other locking arrangements or keys. The fastener isprovided with hooking means that enable to securely hold articles such as helmets and carry-bags while riding.No. of Pages : 32 No. of Claims : 9 PATENT OFFICE JOURNAL 02/03/2012 3454
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.476/CHE/2012 A(19) INDIA(22) Date of filing of Application :08/02/2012 (43) Publication Date : 02/03/2012(54) Title of the invention : A METHOD TO LAUNCH AN APPLICATION ON A MOBILE DEVICE USING SHORT CODE(51) International classification :H04M (71)Name of Applicant :(31) Priority Document No :NA 1)SANDEEP MITTAL(32) Priority Date :NA Address of Applicant :21594 GRAND AVENUE,(33) Name of priority country :NA CUPERTINO, CA 95014 U.S.A.(86) International Application No :NA 2)RAJESH SAO Filing Date :NA (72)Name of Inventor :(87) International Publication No : NA 1)SANDEEP MITTAL(61) Patent of Addition to Application Number :NA 2)RAJESH SAO Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The Invention pertains to the field of enabling a quick application launch in various types of Portable Computing Devices (PCD). Useof specific/special or even mundane application is increasing among the current technology savvy populace. To cater to the ever-increasing demand, network providers and application makers are flooding the market with many more applications. Users need tosearch and find the application for launch in their PCD. This becomes time consuming and sometimes difficult when there are manyapplications involved. The Unique embodiment, namely the Quick Launch Module (QLM) solves this problem by intercepting andinterpreting launch commands emanating from the novel Mobile Server Platform (MSP) to quickly launch the application. The MobileServer Platform is the other Novel embodiment that makes note of PCD information from network message and prepares the launchmessage that is to be sent to the PCD. The whole process is very simple for the user, who may send either a Short Character Code(SCC) or a Short Numerical Code (SNC) to the network gateways. The SSC reaches the MSP through the USSD gateway, while theSNC reaches the MSP via the Interactive Voice Response (IVR) gateway to bring about the quick launch. The unique embodiments ofthe invention are programmed by a special proprietary software that allows the above mentioned operation and makes the systemoperable in a variety of PCD platforms and network providers. The advantage of the system over prior art is that it is able to bringabout quick launch even in mobile stations that do not have call intercept facilities.No. of Pages : 17 No. of Claims : 14 PATENT OFFICE JOURNAL 02/03/2012 3455
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.552/CHE/2012 A(19) INDIA(22) Date of filing of Application :15/02/2012 (43) Publication Date : 02/03/2012(54) Title of the invention : A METHOD OF ENHANCING THE SPEED OF DATA ACCESSING IN A HARD DISK DRIVE(51) International classification :G06F (71)Name of Applicant :(31) Priority Document No :NA 1)SHIHABUDHEEN PARIVEETTIL MUHAMMED(32) Priority Date :NA Address of Applicant :PARIVEETTIL HOUSE, P.O.(33) Name of priority country :NA PALAPPILLY, THRISSUR DISTRICT 680 304 Kerala India(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)SHIHABUDHEEN PARIVEETTIL MUHAMMED(87) International Publication No : NA(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A method of enhancing the speed of data accessing from a hard disk comprises of parallel data fetching, secondary buffering, internalblock split and or bit level distribution. Here we distribute one file in to the different platters available in the hard disk. The first partof the file is stored on the first storage surface. Then, the second part of the file is stored on the same cylindrical location of the secondstorage surface and so on. During the reading process, place the head, dedicated to the storage surface to the correct location. Thenperform the reading simultaneously. The access time can be reduced drastically along with the significant reductions of energyconsumption by spindle motor. The inner block split method or bit level distribution method can be used to effectively to distribute thefile into different platters. Secondary buffering helps to avoid the bare of logical operations during physical read or write.No. of Pages : 23 No. of Claims : 17 PATENT OFFICE JOURNAL 02/03/2012 3456
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.3479/CHE/2011 A(19) INDIA(22) Date of filing of Application :10/10/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : SYSTEM AND METHOD FOR DYNAMICALLY CREATING A DOCUMENT USING A TEMPLATETREE(51) International classification :G06F (71)Name of Applicant :(31) Priority Document No :NA 1)GURURAJ POTNIS(32) Priority Date :NA Address of Applicant :FLAT 1, GURUPRASAD(33) Name of priority country :NA APARTMENTS, 38, 2ND CROSS ROAD, GAVIPURAM(86) International Application No :NA EXTENSION, BANGALORE 560 019 Karnataka India Filing Date :NA 2)MOHIT KATARIA(87) International Publication No : NA (72)Name of Inventor :(61) Patent of Addition to Application Number :NA 1)GURURAJ POTNIS Filing Date :NA 2)MOHIT KATARIA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A document creation tool (106) for dynamically generating a document that is specific to a context using a template tree of thatdocument type. The document creation tool (106) includes a database (202) that stores templates of various document types, a set ofalternative clauses and alternative sub-clauses, a processing module (204) processes a mere selection a template having a template treethat includes a set of the alternative clauses and alternative sub-clauses, and a mere selection of a sub-set of a plurality of alternativeclauses and alternative sub-clauses from the set of the alternative clauses and alternative sub-clauses based on a corresponding textand metadata associated with the sub-set of the alternative clauses and the alternative sub-clauses. A document creation module (208)generates the document that is specific to the context based on the corresponding text and metadata of the sub-set of the alternativeclauses and alternative sub-clauses.No. of Pages : 43 No. of Claims : 10 PATENT OFFICE JOURNAL 02/03/2012 3457
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.569/CHE/2012 A(19) INDIA(22) Date of filing of Application :16/02/2012 (43) Publication Date : 02/03/2012(54) Title of the invention : ENTERTAINMENT CONTENT APPLICATION CONFIGURABLE IN A PORTABLE COMPUTINGDEVICE ELIMINATING SHARING OR SENDING THE DOWNLOADED CONTENT(51) International classification :G06F (71)Name of Applicant :(31) Priority Document No :NA 1)SYNECTIKS IT & CONSULTING PRIVATE LIMITED(32) Priority Date :NA Address of Applicant :PLOT NO. 407, SRI SWAMI(33) Name of priority country :NA AYYAPPA SOCIETY, MADHAPUR, HYDERABAD - 500 081(86) International Application No :NA Andhra Pradesh India Filing Date :NA (72)Name of Inventor :(87) International Publication No : NA 1)NARESH BALINA(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :Exemplary embodiments of the present invention are directed towards an entertainment content application configurable in a portablecomputing device enabling an authorized downloading and eliminating a distribution of a downloaded content. The applicationincludes a first functional tab for displaying a featured information corresponding to a predetermined entertainment content, a secondfunctional tab configured to display a cast and crew information corresponding to the predetermined entertainment content, a thirdfunctional tab for enabling a user to play at least one audio file corresponding to the predetermined entertainment content, a fourthfunctional tab for providing a media content corresponding to the predetermined entertainment content, a fifth functional tabconfigured to play a movie corresponding to the predetermined entertainment content and a sixth functional tab for enabling the userto view the information corresponding to the predetermined entertainment content over at least one social networking domain and overa entertainment content development server.No. of Pages : 17 No. of Claims : 13 PATENT OFFICE JOURNAL 02/03/2012 3458
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.577/CHE/2012 A(19) INDIA(22) Date of filing of Application :16/02/2012 (43) Publication Date : 02/03/2012(54) Title of the invention : A DIRECT DRIVE CLOTHES DRIER USING EDDY CURRENT MOTOR(51) International classification :D06F (71)Name of Applicant :(31) Priority Document No :NA 1)C. VARADARAJAN(32) Priority Date :NA Address of Applicant :42/7 TNHB-BLOCK 6(33) Name of priority country :NA VALAYAPATHY STREET, MOGAPPAIR EAST CHENNAI -(86) International Application No :NA 600 037 Tamil Nadu India Filing Date :NA (72)Name of Inventor :(87) International Publication No : NA 1)C. VARADARAJAN(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The direct drive clothes drier utilizes the eddy current induction motor comprising a nichrome coil as the electrical winding of theeddy current motor augmented by copper coil. The inefficiency of such a motor is effectively converted into heat energy required toproduce hot air for drying the clothes loaded in the drum (2) of the machine. The drum (2) is mounted between a ball bearing (5) atone end and a magnetic ring levitation bearing (6) at the opposite end of the cabinet (1). The aluminium flange (3) of the eddy currentmotor disc hub forms as the drum of the device. The blower (7) sucks in the fresh atmospheric air at room temperature through thegrille (14) and blows it on the eddy current stator coil (11), core (8) and the disc which cools the heating coils to below Curietemperature for maintaining magnetic property of the core (8) at the elevated temperature. The fresh atmospheric air thus gets heatedup by the impact and the said hot dry air is conveyed through the grille (17, 21) on the door aligned with the drum (2) and the port (20)for heating and evaporating the moisture in the clothes loaded in the said drum (2). The moisture laden hot air from the drum isexhausted through the port (19) at the opposite end of the port (20). A partition (4) isolates the hot dry air entering the port (20) andthe moist air exhausting out of the drum through the port (19) at the opposite end. The moist and partially hot air exhausted throughthe port (19) is utilized for recirculation into the drum through the grille (13) for the effective utilization of the device. The core (8) iscovered with a thermal ceramic insulation sheath for preventing the heat transfer from the core to the heater coil and the spool made ofbakelite.hylem and mica provides electrical insulation between the coil (11) and the core (8) of the eddy current induction motor. Thespool comprises guiding grooves for preventing contact and consequent short circuit among adjacent nichrome coils. Themotorcomprising the copper coil and a separate heater coil induces the necessary temperature for processing the clothes in the device.No. of Pages : 14 No. of Claims : 10 PATENT OFFICE JOURNAL 02/03/2012 3459
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.330/CHE/2012 A(19) INDIA(22) Date of filing of Application :30/01/2012 (43) Publication Date : 02/03/2012(54) Title of the invention : TWO STAGE PROCESS OF PRODUCING FATTY ACID ESTERS FROM PALM FATTY ACIDDISTILLATE (PFAD) USING ACID CHLORIDE ROUTE FOR BIODIESEL(51) International classification :C07C67/00 (71)Name of Applicant :(31) Priority Document No :NA 1)MR. VENKATA SUDHAKAR EDUPUGANTI(32) Priority Date :NA Address of Applicant :SUDHA AGRO OIL AND(33) Name of priority country :NA CHEMICAL INDUSTRIES LIMITED, POST BOX # 9,(86) International Application No :NA PEDDAPURAM ROAD, SAMALKOT 533 440 Andhra Pradesh Filing Date :NA India(87) International Publication No : NA (72)Name of Inventor :(61) Patent of Addition to Application Number :NA 1)MR. VENKATA SUDHAKAR EDUPUGANTI Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A two stage process of producing fatty acid esters from Palm Fatty Acid Distillate (PFAD) which is a byproduct of palm oil refining,using acid chloride route for Biodiesel is discussed. Palm fatty acid distillate is subjected to hydrophilization to separate it intosaturated and unsaturated fatty acids. The saturated fraction is heated to 120 degree centigrade for one hour in a constant temperatureoven to remove traces of water present in it. Upon, cooling to room temperature a suitable chlorinating agent is mixed and heated tothe appropriate temperature to convert the saturated fatty acids into corresponding acid chlorides to which a stoichiometric amount ofalcohol is added and stirred to give saturated fatty alkyl esters and hydrogen chloride gas. The evolving hydrogen chloride gas iscaptured in sufficient amount of alcohol to give alcoholic HCL, which in turn is mixed with the unsaturated fatty acids in astoichiometric amount to yield unsaturated fatty acids alkyl esters. The unsaturated fatty acids alkyl esters are neutralized and filteredto obtain unsaturated alkyl esters which can be used as cold tolerant biodiesel.No. of Pages : 21 No. of Claims : 11 PATENT OFFICE JOURNAL 02/03/2012 3460
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.585/CHE/2012 A(19) INDIA(22) Date of filing of Application :17/02/2012 (43) Publication Date : 02/03/2012(54) Title of the invention : NOVEL PIPERAZINIUM POLYELECTROLYTES FOR INDUSTRIAL WASTEWATERTREATMENT(51) International classification :C08F (71)Name of Applicant :(31) Priority Document No :NA 1)THE REGISTRAR(32) Priority Date :NA Address of Applicant :UNIVERSITY OF MADRAS,(33) Name of priority country :NA CHEPAUK CAMPUS, CHENNAI - 600 005 Tamil Nadu India(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)DR. S. BALASUBRAMANIAN(87) International Publication No : NA 2)M. DHARANI(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A process in which six N- acryloyl N-methyl piperazinium polyelectrolytes are synthesized and polymerized to produce cationicpolyelectrolytes is described. The polyelectrolytes are characterized by spectral studies. The polyelectrolytes are highly soluble inwater and their flocculating behavior with industrial effluent has been disclosedNo. of Pages : 18 No. of Claims : 10 PATENT OFFICE JOURNAL 02/03/2012 3461
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.4626/CHE/2011 A(19) INDIA(22) Date of filing of Application :28/12/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : A PROCESS FOR THE PREPARATION OF 4-IODO-3-NITROBENZAMIDE(51) International classification :C07C233/00 (71)Name of Applicant :(31) Priority Document No :NA 1)DIVIS LABORATORIES LTD.,(32) Priority Date :NA Address of Applicant :7-1-77/E/1/303, DIVI TOWERS,(33) Name of priority country :NA DHARAM KARAN ROAD, AMEERPET, HYDERABAD - 500(86) International Application No :NA 016 Andhra Pradesh India Filing Date :NA (72)Name of Inventor :(87) International Publication No : NA 1)MURALI KRISHNA PRASAD DIVI(61) Patent of Addition to Application Number :NA 2)MYSORE ASWATHA NARAYANA RAO Filing Date :NA 3)VENKATARAMAN RAJURI(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A process for the preparation of 4-iodo-3-nitrobenzamide free from the impurities formed due to nucleophilic substitution of the labileiodo group is disclosed.No. of Pages : 10 No. of Claims : 5 PATENT OFFICE JOURNAL 02/03/2012 3462
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.595/CHE/2012 A(19) INDIA(22) Date of filing of Application :17/02/2012 (43) Publication Date : 02/03/2012(54) Title of the invention : REAL TIME RAILWAY DISASTER VULNERABILITY ASSESSMENT AND RESCUE GUIDANCESYSTEM USING MULTI LAYERED VIDEO COMPUTATIONAL ANALYTICS(51) International classification :B61L (71)Name of Applicant :(31) Priority Document No :NA 1)VENKATRAMAN BALAJI(32) Priority Date :NA Address of Applicant :FLAT D 101, ITTINA ABBY(33) Name of priority country :NA APARTMENTS, L B SASTRY NAGAR, AIRPORT ROAD,(86) International Application No :NA BANGALORE - 560 017 Karnataka India Filing Date :NA (72)Name of Inventor :(87) International Publication No : NA 1)VENKATRAMAN BALAJI(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The system for real time train disaster vulnerability assessment and rescue guidance using multi layered video computational analyticscomprises digital video cameras mounted on train, video cameras mounted at fixed locations on rail route; unmanned aerialmonitoring vehicle; train on-broad computer system mounted on train and centralized system centrally located in railway network.The digital video cameras capture video images of railways track and adjacent structure from running train and automatically computedegree of disaster vulnerability from collective analysis of output from all video cameras. In case degree of disaster vulnerabilityexceeds predetermined threshold value a disaster alert is triggered to take immediate precautionary measures while simultaneouslyactivating On Board Rescue and Response System. In case degree of disaster vulnerability is below predetermined threshold value, theanalytics output is transmitted to higher level modules for in-depth advanced analytics by combining real-time train data or real-timegeographic and environmental data contributing to a potential disaster.No. of Pages : 52 No. of Claims : 40 PATENT OFFICE JOURNAL 02/03/2012 3463
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.593/CHE/2012 A(19) INDIA(22) Date of filing of Application :17/02/2012 (43) Publication Date : 02/03/2012(54) Title of the invention : INDIAN ABACUS - DIGITAL(51) International classification :G09B19/02 (71)Name of Applicant :(31) Priority Document No :NA 1)DR. BASHEER AHAMED, NAINA MOHAMED(32) Priority Date :NA Address of Applicant :NO.A1-1857, 13TH MAIN ROAD,(33) Name of priority country :NA 6TH AVENUE, ANNA NAGAR WEST, CHENNAI 600 040(86) International Application No :NA Tamil Nadu India Filing Date :NA (72)Name of Inventor :(87) International Publication No : NA 1)DR. BASHEER AHAMED, NAINA MOHAMED(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The invention discloses the Indian Abacus - Digital - its construction and operation methodology. Indian Abacus - Digital is IndianAbacus with the extended facility to work online to learn / practise / test, on-line, the Abacus based skills, giving it the digital-connect.The Indian Abacus has largely greater advantage in regard to better Visualization that the student experiences in comparison to theconventional or the generic abacus which has been in use till now. The student while operating Indian Abacus moves the Lower andthe upper sliders to unhide and hide the colour images which represent values as before. The lower sliders when moved towards thebar unhide and display green colour images and similarly the upper sliders when moved towards the bar unhide and display Redcolour images. Thus with the display of colour images the visualization in Indian Abacus is many times better - stronger and faster -when compared to the generic Abacus. Since Visualization is the key factor for better visual memory, Indian Abacus is much superiorto its predecessor. The invented New Generation tool enables children and other users to access and learn / practise / test, on-line, theAbacus based skills using the Abacus program site designed by the company for the purpose. The children aged 4 to 13 years are theprimary focus for benefitting through this specialised tool - Indian Abacus - Digital and the designed on-line program for pupils ofIndia and foreigners. The children could operate the tool in unison with the PC / LAPTOP by accessing to the On-line learn -practice -test program for Abacus based skills site designed especially for the purpose by the Indian Abacus Company. The tool has thenecessary hardware and software, which are integral parts of the tool, which make the student work online or offline, as required. Themain objective of the Abacus programme is to enhance the brain power upgrading the brain skills of the children and remove the fearof Mathematics by making the arithmetic calculations easier.No. of Pages : 53 No. of Claims : 22 PATENT OFFICE JOURNAL 02/03/2012 3464
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.594/CHE/2012 A(19) INDIA(22) Date of filing of Application :17/02/2012 (43) Publication Date : 02/03/2012(54) Title of the invention : DOUBLE SIDED KNITTED FABRIC ROTARY PRINTING MACHINE(51) International classification :B41F (71)Name of Applicant :(31) Priority Document No :NA 1)P. SADASIVAM(32) Priority Date :NA Address of Applicant :1/373 VADUGAPALAYAM(33) Name of priority country :NA KAMANAICKENPALAYAM (PO), KARADIVAVI(VIA),(86) International Application No :NA COIMBATORE - 641 658 Tamil Nadu India Filing Date :NA 2)N. MOHAN DAS GANDHI(87) International Publication No : NA (72)Name of Inventor :(61) Patent of Addition to Application Number :NA 1)P. SADASIVAM Filing Date :NA 2)N.MOHAN DAS GANDHI(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The invention related to a rotary printing device consisting of squeezing blades (4) to squeeze out the printing paste and two rotaryscreens (2) circumferences meeting tangentially and rotating in opposite directions. The edges of the squeezing blades and thetangential contact line of two screens meet in a single line. The fabric is fed from top to bottom at the same speed as that of the rotaryscreen. The two screens are connected with two end rings (7) which are connected to gears (8) which in turn is connected to a singleshaft (9). The rotary printing device prints the fabric on both sides simultaneously. The edges of the fabric are not wasted and there isless probability of shade variation.No. of Pages : 12 No. of Claims : 10 PATENT OFFICE JOURNAL 02/03/2012 3465
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.584/CHE/2012 A(19) INDIA(22) Date of filing of Application :17/02/2012 (43) Publication Date : 02/03/2012(54) Title of the invention : WATER SOLUBLE POLYELECTROLYTES BASED ON POLY (5-ETHYL 2-VINYL PYRIDINIUM)COMPOUNDS(51) International classification :C08F (71)Name of Applicant :(31) Priority Document No :NA 1)THE REGISTRAR(32) Priority Date :NA Address of Applicant :UNIVERSITY OF MADRAS,(33) Name of priority country :NA CHEPAUK CAMPUS, CHENNAI - 600 005 Tamil Nadu India(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)S. BALASUBRAMANIAN(87) International Publication No : NA 2)G. KALAISELVI(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The present invention relates to a process in which a quaternary vinyl pyridine salt may be produced as products and then polymerizeddirectly without the need for any isolation stage is disclosed. The polymerization process involves the replacement of the conventionalnon-aqueous solvent for the reaction by water; the vinyl pyridine and diethyl ether are mixed, quaternizing agent is added and themixture is stirred, finally quaternary vinyl pyridine salt is formed. The salt is soluble in water then directly acquiescent topolymerization without the necessity for the purification of salt.No. of Pages : 16 No. of Claims : 9 PATENT OFFICE JOURNAL 02/03/2012 3466
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1166/KOL/2011 A(19) INDIA(22) Date of filing of Application :06/09/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : HYDROELECTRIC FORMATION BY AUTOMATAED WATER CIRCULATION USINGGRAVITATIONAL FORCE(51) International classification :H02B1/00 (71)Name of Applicant :(31) Priority Document No :NA 1)TAPAS KUMAR MANDAL(32) Priority Date :NA Address of Applicant :VILL + P.O-SUNIA, DST-(33) Name of priority country :NA HOOGHLY, PIN-712614 West Bengal India(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)TAPAS KUMAR MANDAL(87) International Publication No : NA 2)NARGISH PARVIN(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :This automated water circulation device which can give enormous hydro electricity energy from zero energy sources. Its expansiononly one time and very very lower than other any type of energy production methods. The device is an turbine (5), generator set (7),piston pump (6, 8,9), some one way valvs (14) and bearings (19). Also two resirvior water tank upper and lower (1 and 15). Also itsother advantages are that human can made / produce hydro electricity in desert without pressure of wire hazards, no problem ofelectricity cut, no problem for new energy sources finding and headache. It is ecofriendly also.No. of Pages : 5 No. of Claims : 10 PATENT OFFICE JOURNAL 02/03/2012 3467
  • Publication After 18 Months:The following Patent Applications have been published under Section 11A (3) of The Patents (Amendment) Act, 2005. AnyPerson may file representation by way of opposition to the Controller of Patents at the appropriate office against the grant ofthe patent in the prescribed manner under section 25(1) of the Patents (Amendment) Act, 2005 read with the rule 55 of ThePatents (Amendment) Rules, 2006:(12) PATENT APPLICATION PUBLICATION (21) Application No.1232/DEL/2010 A(19) INDIA(22) Date of filing of Application :28/05/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : RADIOLABELED COMPOUNDS AND METHODS THEREOF (71)Name of Applicant : 1)GE HEALTHCARE LIMITED (51) International classification :G01B Address of Applicant :AMERSHAM PLACE, LITTLE(31) Priority Document No :NA CHALFONT, BUCKINGHAMSHIRE HP7 9NA, GREAT(32) Priority Date :NA BRITAIN U.K.(33) Name of priority country :NA (72)Name of Inventor :(86) International Application No :NA 1)IAN NEWINGTON Filing Date :NA 2)DUNCAN WYNN(87) International Publication No :NA 3)HELEN BETTS(61) Patent of Addition to Application Number :NA 4)R. JAMES NAIRNE Filing Date :NA 5)REBECCA DAVIS(62) Divisional to Application Number :NA 6)BENEDICTE GUILBERT Filing Date :NA 7)SUBRATA MANDAL 8)JINTO JOSE 9)SUNDERARAMAN VARADARAJAN 10)CHITRALEKHA RANGASWAMY(57) Abstract :The present invention relates to radiodiagnostic compounds and methods of use thereof as imaging agents for preferably a HAserotonin 5-HTIA receptor for use in PET or SPECT, preferably PET. Compositions comprising an imaging-effective amount ofradiolabeled compounds are also disclosed.No. of Pages : 166 No. of Claims : 49 PATENT OFFICE JOURNAL 02/03/2012 3468
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1237/DEL/2010 A(19) INDIA(22) Date of filing of Application :28/05/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : A PROCESS FOR COATING MATERIALS WITH TITANIUM-ALUMINIUM BASED GASNITRIDED COATINGS(51) International classification :C07D (71)Name of Applicant :(31) Priority Document No :NA 1)M/S INDIAN INSTITUTE OF TECHNOLOGY,(32) Priority Date :NA ROORKEE(33) Name of priority country :NA Address of Applicant :M/S INDIAN INSTITUTE OF(86) International Application No :NA TECHNOLOGY, ROORKEE ROORKEE, UTTARAKHAND Filing Date :NA Uttaranchal India(87) International Publication No :NA (72)Name of Inventor :(61) Patent of Addition to Application Number :NA 1)VIKASH CHAWLA Filing Date :NA 2)S. PRAKASH(62) Divisional to Application Number :NA 3)D. PURI Filing Date :NA 4)BUTA SINGH SIDHU(57) Abstract :This invention relates to a process for coating materials with Titanium-Aluminium (Ti-Al) based gas nitrided coatings, comprising thesteps of subjecting polished substrates to the step of grit blasting, preparing a mixture of Titanium and Aluminium powders, coatingthe substrates with the powder mixture by plasma spraying followed by subjecting the plasma sprayed coating to the step of gasnitriding to obtain the Ti-Al based gas nitrided coating.No. of Pages : 28 No. of Claims : 13 PATENT OFFICE JOURNAL 02/03/2012 3469
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1238/DEL/2010 A(19) INDIA(22) Date of filing of Application :28/05/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : A PROCESS FOR COATING MATERIALS WITH ALUMINIUM-CHROMIUM BASED GASNITRIDED COATINGS(51) International classification :C07D (71)Name of Applicant :(31) Priority Document No :NA 1)M/S INDIAN INSTITUTE OF TECHNOLOGY,(32) Priority Date :NA ROORKEE(33) Name of priority country :NA Address of Applicant :M/S INDIAN INSTITUTE OF(86) International Application No :NA TECHNOLOGY, ROORKEE ROORKEE, UTTARAKHAND Filing Date :NA Uttaranchal India(87) International Publication No :NA (72)Name of Inventor :(61) Patent of Addition to Application Number :NA 1)VIKASH CHAWLA Filing Date :NA 2)S. PRAKASH(62) Divisional to Application Number :NA 3)D. PURI Filing Date :NA 4)BUTA SINGH SIDHU(57) Abstract :This invention relates to a process for coating materials with Aluminium-Chromium (Al-Cr) based gas nitrided coatings, comprisingthe steps of subjecting polished substrates to the step of grit blasting, preparing a mixture of Aluminium and chromium powders,coating the substrates with the powder mixture by plasma spraying followed by subjecting the plasma sprayed coating to the step ofgas nitriding to obtain the Al-Cr based gas nitrided coating.No. of Pages : 28 No. of Claims : 13 PATENT OFFICE JOURNAL 02/03/2012 3470
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1240/DEL/2010 A(19) INDIA(22) Date of filing of Application :31/05/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : SYNTHESIS OF TRYCYCLIC THIAZOLO[4,3-E] PYRIMIDINE FUSED 1,2,4-TRIAZOLE/1,3-IMIDAZOLE DERIVATIVES(51) International classification :C07D (71)Name of Applicant :(31) Priority Document No :NA 1)COUNCIL OF SCIENTIFIC INDUSTRIAL RESEARCH(32) Priority Date :NA Address of Applicant :ANUSANDHAN BHAWAN, RAFI(33) Name of priority country :NA MARG, NEW DELHI-110 001, INDIA.(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)PRATIBHA MEHTA LUTHRA(87) International Publication No :NA 2)CHANDRA BHUSHAN MISHRA(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :890/DEL/2010 Filed on :30/04/2009(57) Abstract :Novel thiazolotriazolopyrimidine (25-36) and thiazoloimidazolo pyrimidine (39-44) designed as potential adenosine A2A receptor(A2AR) antagonists were synthesized. Molecular docking studies revealed that all compounds (25-36) and (39-44) exhibited stronginteraction with A2AR. The strong interaction of the compounds (23-33) with A2AR in silico was confirmed by their high bindingaffinity with human A2AR stably expressed in HEK293 cells using radioligand binding assay. The compounds 25-36 demonstratedsubstantial binding affinity and selectivity for A2AR as compared to SCH58261, a standard A2AR antagonist. Decline in A2AR-coupled release of endogenous cAMP in treated HEK293 cells demonstrated in vitro A2AR antagonist potential of the compounds 25-36. Attenuation in haloperidol-induced motor impairments (catalepsy and akinesia) in Swiss albino male mice pre-treated withcompounds 25-36 further support their role in the alleviation of PD symptoms.No. of Pages : 43 No. of Claims : 7 PATENT OFFICE JOURNAL 02/03/2012 3471
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1243/DEL/2010 A(19) INDIA(22) Date of filing of Application :31/05/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : A PROCESS FOR MANUFACTURING HIGH DENSITY SLIP-CAST FUSED SILICA BODIES(51) International classification :C07D (71)Name of Applicant :(31) Priority Document No :NA 1)COUNCIL OF SCIENTIFIC INDUSTRIAL RESEARCH(32) Priority Date :NA Address of Applicant :ANUSANDHAN BHAWAN, RAFI(33) Name of priority country :NA MARG, NEW DELHI 110 001, INDIA.(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)ANDI UDAYA KLUMAR(87) International Publication No :NA 2)SELVARAJ SENTHIL KUMAR(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :Fused silica ceramics plays demanding role in high velocity missile/ aircrafts radome development. Slip casting is the most commonand commercially viable process utilized for radome production. Unfortunately slip casting cannot afford high density due to its poorgreen packing density which in turn results in poor rain erosion resistance. Present invention discloses process for preparing highdensity fused silica bodies by adding boron oxide (B2O3) with the commercially available high purity fused silica as sintering aid cumde-vitrification inhibitor. Various concentrations of B2O3 were added to high purity fused silica. Thus formed compositions weremade into slip-castable slurries in aqueous medium without any addition of dispersing agents. The reheological properties like mildshear thinning and low thixotropic behaviour of the slurries were established. These slurries were then slip-casted in plaster of parriesmold. The green and sintered properties of the casted samples were studied. The sintered sample with density higher than 2 g/cc (90 -95 % of the theoretical density) was achieved without de-vitrification. XRD studies on sintered samples showed the amorphous natureof the sample. The improved properties of fused silica system can favor its utilization in radome applications.No. of Pages : 17 No. of Claims : 6 PATENT OFFICE JOURNAL 02/03/2012 3472
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1244/DEL/2010 A(19) INDIA(22) Date of filing of Application :31/05/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : ANTI TUBERCULAR AGENTS (71)Name of Applicant :(51) International classification :A61K 1)COUNCIL OF SCIENTIFIC INDUSTRIAL RESEARCH(31) Priority Document No :NA Address of Applicant :ANUSANDHAN BHAWAN, RAFI(32) Priority Date :NA MARG, NEW DELHI-110 001, INDIA(33) Name of priority country :NA (72)Name of Inventor :(86) International Application No :NA 1)DHIMAN SARKAR Filing Date :NA 2)SAMPA SARKAR(87) International Publication No :NA 3)ROHIT RAMESH JOSHI(61) Patent of Addition to Application Number :NA 4)VIJAY MURLIDHAR KHEDKAR Filing Date :NA 5)RAGHUVIR RAMAKANT PISSURLENKAR(62) Divisional to Application Number :NA 6)EVANS CLIFFTON COUTINHO Filing Date :NA 7)ANAMIK KANTILAL SHAH(57) Abstract :The present invention discloses antitubercular compounds selected from tetrahydropyrimidones/ tetrahydrothiopyrimidone derivativesof Formula 1 and its pharmaceutically acceptable salts for the treatment of Mycobacterium in the dormant phase. wherein, R is H,halogen, dihalogen, O-alkyl, di- O-alkyl , R1 is phenyl, chlorophenyl, nitrophenyl, diclorophenyl, cycloalkyl preferably cyclohexyl, Xis O or S.No. of Pages : 30 No. of Claims : 10 PATENT OFFICE JOURNAL 02/03/2012 3473
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1241/DEL/2010 A(19) INDIA(22) Date of filing of Application :31/05/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : AN IMPROVED PROCESS FOR THE PREPARATION OF STEVIOSIDES FROM STEVIAREBAUDIANA (71)Name of Applicant : 1)COUNCIL OF SCIENTIFIC & INDUSTRIAL(51) International classification :C07D RESEARCH(31) Priority Document No :NA Address of Applicant :ANUSANDHAN BHAWAN,M RAFI(32) Priority Date :NA MARG NEW DELHI-1110 001, INDIA(33) Name of priority country :NA (72)Name of Inventor :(86) International Application No :NA 1)ARUN CHANDRASHEKAR Filing Date :NA 2)CHANDRAPPA DAYANANDA(87) International Publication No :NA 3)SIDDALINGAIYA GURUDUTT PRAPULLA(61) Patent of Addition to Application Number :NA 4)MANDYAM SINGARA NARAYAN Filing Date :NA 5)BALARAMAN, MANOHAR(62) Divisional to Application Number :NA 6)GOKARE ASWATHANARAYANA RAVISHANKAR Filing Date :NA 7)SANKARAM, THADATHIL GAGADHARAN JAYAPRAKSHAN(57) Abstract :The present invention relates to an improved process for preparation of steviosides from Stevia spp. The process in particular involvesthe extraction of dried powdered leaves of Stevia with hot water and sodium chloride solution, followed by filtration. The filtrate istreated with activated calcium oxide and again filtered. The filtrate thus obtained was neutralized by bubbling CO2 and calciumcarbonate formed was removed. The resulting clarified extract was passed through activated aluminium oxide for further clarification.The clarified filtrate was again passed through macroporus resin column. Steviosides bound to the resin were eluted with 80-90 %ethanol with 99% of steviosides yield. Ethanol was concentrated to dryness and the residue is treated with dry methanol and kept at -20°C, for crystallization. The steviosides crystals are of 90-95% purity.No. of Pages : 22 No. of Claims : 7 PATENT OFFICE JOURNAL 02/03/2012 3474
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1246/DEL/2010 A(19) INDIA(22) Date of filing of Application :31/05/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : CHIP WITH ESD PROTECTION FUNCTION(51) International classification :A61N (71)Name of Applicant :(31) Priority Document No :12/753,061 1)MEDIATEK INC.(32) Priority Date :01/04/2010 Address of Applicant :No. 1 Dusing Rd. 1st Science-Based(33) Name of priority country :U.S.A. Industrial Park Hsin-Chu Taiwan(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)HUANG Fwu-Juh(87) International Publication No : NA 2)HUANG Bo-Shih(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :An exemplary chip includes an input/output(I/O) area and a core area is provided. The input/output (I/O) area has a first I/O blockoperated under a first power domain and a second I/O block operated under a second power domain placed therein, wherein a voltagerange of the first power domain is distinct from a voltage range of the second power domain. The core area has at least one circuittherein performing at least one function of the chip, and the core area further has at least one power cut cell placed therein wherein thepower cut cell is coupled to the first I/O block and the second I/O block via a plurality of connectors for providing an electrostaticdischarge (ESD) path between the first I/O block and the second I/O block.No. of Pages : 31 No. of Claims : 25 PATENT OFFICE JOURNAL 02/03/2012 3475
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1235/DEL/2010 A(19) INDIA(22) Date of filing of Application :28/05/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : GAS NITRIDED TITANIUM-ALUMINIUM AND ALUMINIUM-CHROMIUM BASED COATINGSON ASTM-SA210 GRADE A-1 STEEL(51) International classification :C07D (71)Name of Applicant :(31) Priority Document No :NA 1)M/S INDIAN INSTITUTE OF TECHNOLOGY,(32) Priority Date :NA ROORKEE(33) Name of priority country :NA Address of Applicant :M/S INDIAN INSTITUTE OF(86) International Application No :NA TECHNOLOGY, ROORKEE ROORKEE, UTTARAKHAND Filing Date :NA Uttaranchal India(87) International Publication No :NA (72)Name of Inventor :(61) Patent of Addition to Application Number :NA 1)VIKASH CHAWLA Filing Date :NA 2)S. PRAKASH(62) Divisional to Application Number :NA 3)D. PURI Filing Date :NA 4)BUTA SINGH SIDHU(57) Abstract :This invention relates to coated steel when said coating is selected from gas nitrided Ti-Al and Al-Cr coatings and said steel is ASTM-SA210-D-GRADE A-l Steel, the coatings having a porosity of <0.5%, the particle size is between 16 and 26nm, a microhardness ofbetween 600 to 950 HV and roughness in the range of 10 to 16.No. of Pages : 33 No. of Claims : 13 PATENT OFFICE JOURNAL 02/03/2012 3476
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1247/DEL/2010 A(19) INDIA(22) Date of filing of Application :31/05/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : LEVER-TYPE CONNECTOR, CONNECTOR ASSEMBLY AND CONNECTING METHOD(51) International classification :B27N (71)Name of Applicant :(31) Priority Document No :NA 1)SUMITOMO WIRING SYSTEMS, LTD.,(32) Priority Date :NA Address of Applicant :1-14, NISHISUEHIRO-CHO,(33) Name of priority country :NA YOKKAICHI-CITY, MIE 510-8503, JAPAN(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)WATARU SHAMOTO(87) International Publication No :NA 2)KENJI MAKINO(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :2958/DEL/2008 Filed on :29/12/2008(57) Abstract :An object of the present invention is to ensure sufficient contact margins between terminal fittings by preventing a housing frombecoming oblique. Two supporting portions 24 are formed on one side surface of a first housing 20 at positions symmetrical withrespect to a center of a connection area with a second housing 40 in a lengthwise direction L The lever 60 is selectively mounted in afirst mode in which the lever 60 is supported on one of the two supporting portions 24 and rotated toward one side about thissupporting portion 24 and in a second mode in which the lever 60 is supported on the other supporting portion 24 and rotated towardthe other side about this supporting portion 24. The lever 60 is formed with a first part and a second part for exerting pushing forces tothe first housing 20 in such a direction as to proceed with a connecting operation of the two housings 20, 40 as the lever 60 is rotated.The first part is formed as a cam groove 68 engageable with a follower pin 43 of the second housing 40 and the second part is formedas a recessed groove 73 engageable with the supporting portion 24 not supporting the lever 60. FIG4No. of Pages : 37 No. of Claims : 5 PATENT OFFICE JOURNAL 02/03/2012 3477
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1248/DEL/2010 A(19) INDIA(22) Date of filing of Application :31/05/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : A NOVEL FERMENTATION PROCESS FOR STREPTOCOCCUS PNEUMONIAE(51) International classification :A01J (71)Name of Applicant :(31) Priority Document No :NA 1)PANACEA BIOTEC LIMITED(32) Priority Date :NA Address of Applicant :B-1, EXTN. A/27 MOHAN CO-(33) Name of priority country :NA OPERATIVE, INDUSTRIAL ESTATE, MATHURA ROAD,(86) International Application No :NA NEW DELHI 110044 India Filing Date :NA (72)Name of Inventor :(87) International Publication No :NA 1)JAIN, RAJESH(61) Patent of Addition to Application Number :NA 2)MAITHAL,KAPIL Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The invention relates to improvement of culture and fermentation conditions for propagation and production of biomass and capsularpolysaccharides by Streptococcus pneumoniae. The invention in particular relates to a novel culture medium free of serum and animalcomponent for production of biomass and polysaccharide. The novel and optimized growth medium, optimized growth parametersemployed during the cultivation and the propagation of the bacteria, along with the other factors, result in a better biomass productionas well as better saccharide yields by S. pneumoniae during fermentation.No. of Pages : 38 No. of Claims : 20 PATENT OFFICE JOURNAL 02/03/2012 3478
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1249/DEL/2010 A(19) INDIA(22) Date of filing of Application :31/05/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : SELF EMULSIFYING DRUG DELIVERY SYSTEM FOR A CURCUMINOID BASEDCOMPOSITION(51) International classification :A61K (71)Name of Applicant :(31) Priority Document No :NA 1)JAMIA HAMDARD(32) Priority Date :NA Address of Applicant :JAMIA HAMDARD (HAMDARD(33) Name of priority country :NA UVIVERSITY) HAMDARD NAGAR, NEW DELHI-110 062(86) International Application No :NA India Filing Date :NA 2)ARBRO PHARMACEUTICALS LTD.(87) International Publication No :NA (72)Name of Inventor :(61) Patent of Addition to Application Number :NA 1)DR.KANCHAN KOHLI Filing Date :NA 2)MR.SUNNY CHOPRA(62) Divisional to Application Number :NA 3)MR.SAURABH ARORA Filing Date :NA(57) Abstract :The present invention relates to a pharmaceutical composition comprising curcuminoid as a self emulsifying drug delivery formulationand the method of preparation thereof. The pharmaceutical composition of the present invention shows an enhanced drug loadingability, better stability and an improved bioavailability.No. of Pages : 28 No. of Claims : 13 PATENT OFFICE JOURNAL 02/03/2012 3479
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1250/DEL/2010 A(19) INDIA(22) Date of filing of Application :31/05/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : SECURITY SEALS FOR UTILITY METERS(51) International classification :B31D (71)Name of Applicant :(31) Priority Document No :NA 1)NEELESH HIRANI(32) Priority Date :NA Address of Applicant :A-45, CHETAK APPT., SEC.-9,(33) Name of priority country :NA ROHINI, NEW DELHI-110085 India(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)NEELESH HIRANI(87) International Publication No :NA(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A tamper proof seal for a utility meter includes a first component having a plurality of projections, a second component having acompartment for receiving the plurality of projections of the first component, and a coupling element for coupling the first componentto the second component. The first component of the seal further comprises a slot and the second component of the seal furthercomprises a pin. The pin of the second component is configured to slide and permanently fit inside the slot of the first component. Thecoupling element comprises a wire enclosed inside a tube, and the wire is configured for forming a loop around the utility meter. Thewire protrudes outwards from the first component. The second component of the seal further comprises a base unit for recording aplurality of characteristics of the utility meter.No. of Pages : 11 No. of Claims : 10 PATENT OFFICE JOURNAL 02/03/2012 3480
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1260/DEL/2010 A(19) INDIA(22) Date of filing of Application :31/05/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : SYSTEM FOR MOUNTING A COMPONENT IN A VEHICLE CABIN(51) International classification :B29D (71)Name of Applicant :(31) Priority Document No :NA 1)CATERPILLAR INC.(32) Priority Date :NA Address of Applicant :100 N.E. ADAMS STREET, PEORIA,(33) Name of priority country :NA STATE OF ILLINOIS 61629-6490, U.S.A.(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)RANDALL E. DAVIS(87) International Publication No :NA 2)GREGORY J. PARSONS(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A system for mounting a component in a vehicle cabin is disclosed. The system includes an adaptor assembly configured forattachment to the component to be mounted in a vehicle cabin. The adaptor assembly comprises of a base with a frame coupled to thebase in substantially parallel and spaced-apart relation thereto such that the base and the frame form a well for receiving thecomponent that is to be mounted in the vehicle cabin. The system further includes a first and second opposing handles that are coupledto the base and extend substantially towards and beyond the frame and a mounting bracket that is configured to be attached to asurface in the vehicle cabin. The mounting bracket is configured to receive the adaptor assembly. A locking mechanism is provided toselectively couple or decouple the adaptor assembly and the mounting bracket to one another.No. of Pages : 24 No. of Claims : 18 PATENT OFFICE JOURNAL 02/03/2012 3481
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1261/DEL/2010 A(19) INDIA(22) Date of filing of Application :01/06/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : A NOVEL WATER SOLUBLE BIO-SURFACTANT AND A PROCESS FOR THE PREPARATIIONTHEREOF (71)Name of Applicant : 1)COUNCIL OF SCIENTIFIC & INDUSTRIAL RESEARCH(51) International classification :A01J Address of Applicant :ANUSANDHAN BHAWAN, RAFI(31) Priority Document No :NA MARG, NEW DELHI-110 001, INDIA.(32) Priority Date :NA 2)DEPARTMENT OF BIOTECHNOLOGY(33) Name of priority country :NA (72)Name of Inventor :(86) International Application No :NA 1)ARUMUGAM GNANAMANI Filing Date :NA 2)NARAYANA SWAMY RADHA KRISHNAN(87) International Publication No :NA 3)VARADHARAJAN KAVITHA(61) Patent of Addition to Application Number :NA 4)EYYUNNI MADHAV ACHARYULU Filing Date :NA 5)SAYEED SADULLA(62) Divisional to Application Number :NA 6)BOREDDY SIVA RAMI REDDY Filing Date :NA 7)GOPAL SUSEELA RAJKUMAR 8)GANESAN SEKARAN 9)ASIT BARAN MANDAL(57) Abstract :The present invention relates to an extra cellular Biosurfactant product obtained by growing the culture of Bacillus sp. and depositedin MTCC, IMTECH, Chandigarh with designation MTCC 5514, in production medium of containing peptic digested animal tissue,yeast extract and sodium chloride at pH 7.6 and incubated at 37°C for 48h. Thus obtained biosurfactant product having exhibits:water-soluble in nature, both surface & emulsifying activity. And also exhibits stable emulsion up to 60 days.No. of Pages : 18 No. of Claims : 14 PATENT OFFICE JOURNAL 02/03/2012 3482
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1263/DEL/2010 A(19) INDIA(22) Date of filing of Application :01/06/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : METHOD AND PLANT FOR THE PRODUCTION OF FLAT ROLLED PRODUCTS(51) International classification :B41D (71)Name of Applicant : :UD 2010 1)DANIELI & C. OFFICINE MECCANICHE SPA(31) Priority Document No A 000091 Address of Applicant :Via Nazionale 41 33042 Buttrio (UD)(32) Priority Date :10/05/2010 Italy(33) Name of priority country :Italy (72)Name of Inventor :(86) International Application No :NA 1)Gianpietro BENEDETTI Filing Date :NA 2)Paolo BOBIG(87) International Publication No : NA(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :Rolling method in a rolling line (10), to obtain strip with a thickness varying from 0.7 mm to 20 mm, for all qualities of steel whichcan be cast in the form of thin slabs with a thickness comprised from 30 mm to 140 mm, the line (10) comprising at least: a continuouscasting device (11); a tunnel furnace (15) for maintenance/equalization and possible heating; a rolling train consisting of a roughingtrain comprising from 1 to 4 rolling stands (18a, 18b, 18c) and a finishing train comprising from 3 to 7 stands (21a-21e); a rapidheating unit (20), with elements able to be selectively activated,No. of Pages : 35 No. of Claims : 12 PATENT OFFICE JOURNAL 02/03/2012 3483
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1264/DEL/2010 A(19) INDIA(22) Date of filing of Application :01/06/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : AYURVEDIC/HERBAL DRY SYRUP FORMULATION AND A METHOD FOR PREPARATIONTHEREOF(51) International classification :A01J (71)Name of Applicant :(31) Priority Document No :NA 1)BACFO PHARMACEUTICALS (INDIA) LTD(32) Priority Date :NA Address of Applicant :E-27, DEFENCE COLONY, NEW(33) Name of priority country :NA DELHI India(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)ARUN CHAUHAN(87) International Publication No :NA 2)CPS RAGHAV(61) Patent of Addition to Application Number :NA 3)S. KUMAR Filing Date :NA 4)AKHIL CHAUHAN(62) Divisional to Application Number :NA 5)SHRAVAN KUMAR Filing Date :NA(57) Abstract :The present invention relates to dry herbal syrup that is easily dispersible in potable water medium before use. The formulation of thepresent invention is chemically and microbiologically stable during consumption. The herbal extracts used in formulation provideanti-infective, anti-hepatotoxic, anti-inflammatory, cholegogue and appetite corrective actions.No. of Pages : 16 No. of Claims : 10 PATENT OFFICE JOURNAL 02/03/2012 3484
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1265/DEL/2010 A(19) INDIA(22) Date of filing of Application :01/06/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : HAND HELD DEVICE AS A VIRTUAL COMPANION OF CHILDREN.(51) International classification :B60D (71)Name of Applicant :(31) Priority Document No :NA 1)SPICELABS PVT. LTD(32) Priority Date :NA Address of Applicant :2ND FLOOR, D-1, SECTOR-3,(33) Name of priority country :NA NOIDA, U.P.-201301. India(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)LOKESH GUPTA(87) International Publication No :NA 2)PRASHANT SINGH(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :This invention relates to a hand held device comprising of a processor, a memory, a display screen, a key pad, a microphone, aspeaker, an antenna and a timer connected to each other wherein the processor comprising of a sound analysis module in connectionwith mood inference engine for outputting a response for avatar.No. of Pages : 15 No. of Claims : 7 PATENT OFFICE JOURNAL 02/03/2012 3485
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1267/DEL/2010 A(19) INDIA(22) Date of filing of Application :01/06/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : ENCLOSED WINDOW CLUTCH DISC(51) International classification :B60H (71)Name of Applicant :(31) Priority Document No :NA 1)CLUTCH AUTO LIMITED(32) Priority Date :NA Address of Applicant :2-E/14, [FIRST FLOOR],(33) Name of priority country :NA JHANDEWALAN EXTENSION, NEW DELHI - 110 055,(86) International Application No :NA INDIA Filing Date :NA (72)Name of Inventor :(87) International Publication No :NA 1)MEHTA, VIJAY KRISHAN(61) Patent of Addition to Application Number :NA 2)PRASAD, SANJU Filing Date :NA 3)DALAL, RAM PHAL SINGH(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The invention discloses an enclosed window clutch disc assembly having a damper mechanism wherein the retainer plates 104 haveopenings 105 for damper springs 103 such that the damper springs 103 after assembly of the clutch disc are always covered in anenclosure provided by a forming 106 in the retainer plate 104. The windows 105 are provided with a formed cover 106 from one edgeto the other edge in radial direction and having slits 107 on either side in the circumferential direction so required for forming andseparating formed window 105 from flat surface of retainer plate 104. One side face of slit 107 forms the face of formed cover, whileother face of this slit 107 is on the flat portion of retainer plate and comes into contact with the coil spring 103. Thus, adding a formedcover on the openings 105 provided a better location and better guide for damper springs 103 thereby reducing the wear and tear ofclutch disc internal components.No. of Pages : 15 No. of Claims : 4 PATENT OFFICE JOURNAL 02/03/2012 3486
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1268/DEL/2010 A(19) INDIA(22) Date of filing of Application :01/06/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : SYSTEM AND METHOD FOR MANUFACTURING FRICTION PLATE(51) International classification :B62D (71)Name of Applicant :(31) Priority Document No :NA 1)MAKINO AUTO INDUSTRIES(32) Priority Date :NA Address of Applicant :D-146-148, SECTOR 63, PHASE III,(33) Name of priority country :NA NOIDA 201 301, U.P., INDIA(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)BHANDARI, ASHOK(87) International Publication No :NA 2)BHANDARI, RAJAT(61) Patent of Addition to Application Number :NA 3)SHARMA, SUNIL Filing Date :NA 4)SATIJA, NITESH(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A system for manufacturing a clutch disc having a core plate 102 and a plurality of friction material segments 204 sequentially bondedthereon is disclosed. The system has a disc holder 104, an adhesive spraying apparatus 100 and a segment storage apparatus 200. Thedisc holder 104 rotateably holds the core plate 102. The adhesive spraying apparatus 100 have an adhesive discharging member 106for spraying adhesive on an annular surface 110 of the core plate 102. The segment storage apparatus 200 includes atleast one frictionmaterial segments holder 202 for holding the friction material segments and vertically discharging the segments in a sequential patternon the annular surface 110 of the core plate 102, while disc holder 104 rotates the core plate 102 to produce clutch disc.No. of Pages : 20 No. of Claims : 11 PATENT OFFICE JOURNAL 02/03/2012 3487
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1271/DEL/2010 A(19) INDIA(22) Date of filing of Application :01/06/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : AQUEOUS CUTTING FLUID AND SLURRY(51) International classification :G01B (71)Name of Applicant : :2009- 1)Nissin Chemical Industry Co. Ltd.(31) Priority Document No 133297 Address of Applicant :17-33 Kitago 2-chome Echizen-shi(32) Priority Date :02/06/2009 Fukui-ken Japan(33) Name of priority country :Japan (72)Name of Inventor :(86) International Application No :NA 1)Ichiro TANII Filing Date :NA 2)Takayuki HAYASHI(87) International Publication No : NA 3)Takashi KIMURA(61) Patent of Addition to Application Number :NA 4)Toru MIZUSAKI Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :An aqueous cutting fluid comprising (A) 0.01-20 wt% of an acetylene glycol or an alkylene oxide adduct thereof is combined withabrasive grains to form an aqueous cutting slurry which has advantages of dispersion stability of abrasive grains, viscosity stability,and a higher machining accuracy.No. of Pages : 18 No. of Claims : 8 PATENT OFFICE JOURNAL 02/03/2012 3488
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1272/DEL/2010 A(19) INDIA(22) Date of filing of Application :01/06/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : SELF-TRIGGERING ROTOR FOR PNEUMATIC PADDLE MOTOR(51) International classification :B60R (71)Name of Applicant : :MI 2009A 1)VALENTINI, ANDREA(31) Priority Document No 000988 Address of Applicant :VIA COMELICO, 2, 20135 MILANO,(32) Priority Date :08/06/2009 Italy(33) Name of priority country :Italy (72)Name of Inventor :(86) International Application No :NA 1)VALENTINI, ANDREA Filing Date :NA(87) International Publication No :NA(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A rotor for pneumatic paddle motor is described, comprising a plurality of segments (50) separated by radial grooves (5) adapted toslidably house paddles (4). Each segment (50) includes a surface external edge (9, 9) consisting of a convex portion (10) joined to atleast one concave abutment (11, 11). (Fig. 6).No. of Pages : 13 No. of Claims : 5 PATENT OFFICE JOURNAL 02/03/2012 3489
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1277/DEL/2010 A(19) INDIA(22) Date of filing of Application :02/06/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : LACTIC ACID-ISOSORBIDE COPOLYESTERS AND PROCESS FOR PREPARATION THEREOF(51) International classification :A01J (71)Name of Applicant :(31) Priority Document No :NA 1)COUNCIL OF SCIENTIFIC & INDUSTRIAL(32) Priority Date :NA RESEARCH(33) Name of priority country :NA Address of Applicant :ANUSANDHAN BHAWAN, RAFI(86) International Application No :NA MARG, NEW DELHI-110 001, INDIA Filing Date :NA (72)Name of Inventor :(87) International Publication No :NA 1)BHASKAR BHAIRAVNATH(61) Patent of Addition to Application Number :NA 2)SUSHEELA BHASKAR IDAGE Filing Date :NA 3)SIVARAM SWAMINATHAN(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :Copolyester with improved transition temperature (Tg), melting temperature (Tm) and crystallinity comprising units derived fromlactic acid and isosorbide, wherein ratio of lactic acid to isosorbide ranges from 99:1 to 50:50.No. of Pages : 22 No. of Claims : 10 PATENT OFFICE JOURNAL 02/03/2012 3490
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1279/DEL/2010 A(19) INDIA(22) Date of filing of Application :02/06/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : ENGINEERING OF THE METAGENOME DERIVED LIPASE(51) International classification :B27B (71)Name of Applicant :(31) Priority Document No :NA 1)COUNCIL OF SCIENTIFIC & INDUSTRIAL(32) Priority Date :NA RESEARCH(33) Name of priority country :NA Address of Applicant :ANUSANDHAN BHAWAN, RAFI(86) International Application No :NA MARG, NEW DELHI-110 001, INDIA. Filing Date :NA (72)Name of Inventor :(87) International Publication No :NA 1)JAGDEEP KAUR(61) Patent of Addition to Application Number :NA 2)PUSHPENDER KUMAR SHARMA Filing Date :NA 3)RANVIR SINGH(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The present invention relates to a method for preparing thermostable metagenome derived lipase. The thermostable lipase so obtainedis characterized with a point mutation at position 1152 of the lipase gene having Seq Id. no. 2 and at position 355 of the correspondingprotein having Seq.Id no. 3. A mutagenic library was generated using directed evolution based approach. Screening of the libraryresulted in the lip Ml mutant clone that showed 144 fold increase in the thermostability at 60°C compared to Wt enzyme. Sequencingof the lip Ml clone and its alignment with the Wt gene sequence revealed a change of single nucleotide in the Wt gene ORF coding forthe lipase enzyme. This resulted in alteration of the triplet codon that leads to substitution of aspargine to lysine at 355 position of themature polypeptide. The mutant enzyme showed altered substrate specificity towards pNP-palmitate compared to pNP-laurate with theWt. The Km was decreased from 0.73 µM to 0.33 µM and the Vmax of the mutant enzyme was enhanced from 273 umoles/ml/min to312 umoles/ml/min. Both the kcat and the kcat/Km values were increased almost 10 and 20 folds respectively compared to the Wt.No. of Pages : 30 No. of Claims : 5 PATENT OFFICE JOURNAL 02/03/2012 3491
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1280/DEL/2010 A(19) INDIA(22) Date of filing of Application :02/06/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : AGBM AUTO DEEP FRYING/BOILING MACHINE.(51) International classification :B27B (71)Name of Applicant :(31) Priority Document No :NA 1)ANIL KUMAR GUPTA(32) Priority Date :NA Address of Applicant :FLAT NO.11, POCKET A-1,(33) Name of priority country :NA SECTOR-3, ROHINI, NEW DELHI-110085. India(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)ANIL KUMAR GUPTA(87) International Publication No :NA(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The present invention relates to method and apparatus for cooking foods. The special designed and invented device, deep fries anyfood item from output of 1 kilogram per minute to one ton per minute, with saving of 75% of cooking oil and time.No. of Pages : 9 No. of Claims : 6 PATENT OFFICE JOURNAL 02/03/2012 3492
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1242/DEL/2010 A(19) INDIA(22) Date of filing of Application :31/05/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : ZN(II) BASED COLORIMETRIC SENSOR AND PROCESS FOR THE PREPARATION THEREOF(51) International classification :C07D (71)Name of Applicant :(31) Priority Document No :NA 1)COUNCIL OF SCIENTIFIC INDUSTRIAL RESEARCH(32) Priority Date :NA Address of Applicant :ANUSANDHAN BHAWAN, 2, RAFI(33) Name of priority country :NA MARG, NEW DELHI-110 001 India(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)PRASENJIT MAHATO(87) International Publication No :NA 2)AMRITA GHOSH(61) Patent of Addition to Application Number :NA 3)SANJIV KUMAR MISHRA Filing Date :NA 4)ANUPAMA SHRIVASTAVA(62) Divisional to Application Number :NA 5)SANDHYA MISHRA Filing Date :NA 6)AMITAVA DAS(57) Abstract :The present invention describes about a novel colorimetric chemosensor molecule having a aza-macrocycle Zn (II)-complex (L.Zn)(Scheme 1, Formula 1A) which can recognize selectively and efficiently ATP (Adenosine triphosphate), a biologically significanttriphosphate in aqueous medium at pH 7.4. Since ATP is the source of energy in living organisms, L.Zn (Scheme 1, Formula 1A) canalso be used as a staining agent in the living cells through binding to ATP, generated in situ during the metabolic processes. L.Zn(Scheme 1, Formula 1A) was found to be non-toxic to the living cell and microbial cell growth studies could be monitored. Thus L.Zn(Scheme 1, Formula 1A) could be used as a viable staining agent. Further, the solubility of L.Zn (Scheme 1, Formula 1A) in water wasenhanced in presence of a-CD (cyclodextrin) (Scheme 2). This helped to achieve faster and more intense staining of living cells. Thusstaining efficiency could also be improved further by using α-CD.No. of Pages : 54 No. of Claims : 24 PATENT OFFICE JOURNAL 02/03/2012 3493
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1287/DEL/2010 A(19) INDIA(22) Date of filing of Application :02/06/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : IMAGE BASED STRUCTURAL CHARACTERIZATION OF FIBROUS MATERIALS(51) International classification :G01B (71)Name of Applicant :(31) Priority Document No :NA 1)INDIAN INSTITUTE OF TECHNOLOGY KANPUR(32) Priority Date :NA Address of Applicant :Kanpur Uttar Pradesh 208016 India(33) Name of priority country :NA (72)Name of Inventor :(86) International Application No :NA 1)DHIRENDRA S. KATTI Filing Date :NA 2)ANUPAM PAL(87) International Publication No : NA 3)SHAUNAK GIRISHKUMAR PANDYA(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract : A method for characterizing a fibrous material having a plurality of fibers is provided. The method includes accessing an image ofthe fibrous material with the plurality of fibers and identifying each of the plurality of fibers based upon a magnitude and a directionof an intensity gradient of the image. The method also includes tracking each of the identified fibers based upon at least one of adiameter of the fiber, a fiber alignment angle and a vector orientation angle of the fiber and estimating a plurality of structuralparameters for each of the tracked fibers of the fibrous material.No. of Pages : 33 No. of Claims : 10 PATENT OFFICE JOURNAL 02/03/2012 3494
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1288/DEL/2010 A(19) INDIA(22) Date of filing of Application :02/06/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : PROCESS FOR PRODUCING ENANTIOMERICALLY ENRICHED ISOMER OF 3-(1-AMINOETHYL)PHENYL DERIVATIVE AND EMPLOYING THE SAME TO PRODUCE RIVASTIGMINE OR ITSPHARMACEUTICALLY ACCEPTABLE SALT (71)Name of Applicant :(51) International classification :C07D 1)JUBILANT ORGANOSYS LIMITED(31) Priority Document No :NA Address of Applicant :PLOT NO. 1A, SECTOR 16 A,(32) Priority Date :NA INSTITUTIONAL AREA, NOIDA-201 301, UP, INDIA(33) Name of priority country :NA (72)Name of Inventor :(86) International Application No :NA 1)BANSAL, VIKAS Filing Date :NA 2)VERMA, VED PRAKASH(87) International Publication No :NA 3)DUBEY, SHAILENDRA KUMAR(61) Patent of Addition to Application Number :NA 4)BISWAS, SUJAY Filing Date :NA 5)VIR, DHARAM(62) Divisional to Application Number :NA 6)AGGARWAL, ASUTOSH Filing Date :NA 7)KHANNA, J M(57) Abstract :The present invention relates to an economic and efficient process for producing enatiomerically enriched 3-(l-aminoethyl)phenylderivative and employing the same to produce Rivastigmine or its pharmaceutically acceptable salt.No. of Pages : 29 No. of Claims : 34 PATENT OFFICE JOURNAL 02/03/2012 3495
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1286/DEL/2010 A(19) INDIA(22) Date of filing of Application :02/06/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : TIME-DEPENDENT RELEASE SYSTEM OF AMOXICILLIN TRIHYDRATE-COMPOSITION ANDMETHODS OF PREPARATION THEREOF(51) International classification :A01J (71)Name of Applicant :(31) Priority Document No :NA 1)KANCHAN KOHLI(32) Priority Date :NA Address of Applicant :DEPARTMENT OF(33) Name of priority country :NA PHARMACEUTICS, FACULTY OF PHARMACY, JAMIA(86) International Application No :NA HAMDARD, HAMDARD NAGAR, NEW DELHI-62 India Filing Date :NA (72)Name of Inventor :(87) International Publication No :NA 1)KANCHAN KOHLI(61) Patent of Addition to Application Number :NA 2)SARWAR BEG Filing Date :NA 3)SACHIN GAHOI(62) Divisional to Application Number :NA 4)SAIMA AMIN Filing Date :NA(57) Abstract :In this invention, once a day Matrix based Time-dependent release system of Amoxicillin Trihydrate was developed consisting of abilayer tablet comprising of one delayed release component and a sustained release component. It contains divided amount of drugaround 10 to 40% in the delayed release part of the tablet containing a pH-sensitive polymer to form the enteric coated granules toachieve time-dependent pulsatile release in the intestine followed by sustained release part comprising of 70 to 90% drug in ahydrophilic matrix forming polymer to achieve sustained release profile of the drug delivery. Both the parts were directly compressedto form a single bilayer tablet by direct compression along with additives. The invention provides once a day time-dependent releasetablet formulation having a robust composition of drug with polymer, easier and cost-effective methods of preparation with industrialapplication.No. of Pages : 22 No. of Claims : 8 PATENT OFFICE JOURNAL 02/03/2012 3496
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1292/DEL/2010 A(19) INDIA(22) Date of filing of Application :02/06/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : NOVEL SUPERABOSRBENTS AND THE METHOD (S) OF OBTAINING THE SAME(51) International classification :A01J (71)Name of Applicant :(31) Priority Document No :NA 1)INDIAN COUNCIL OF AGRICULTURAL RESEARCH(32) Priority Date :NA (ICAR) KRISHI BHAWAN,(33) Name of priority country :NA Address of Applicant :1, DR. RAJENDRA PRASAD ROAD,(86) International Application No :NA NEW DELHI-110 001, INDIA. Filing Date :NA (72)Name of Inventor :(87) International Publication No :NA 1)MRS. ANUPAMA(61) Patent of Addition to Application Number :NA 2)SARKAR DHRUBA JYOTI Filing Date :NA 3)PARMAR BALRAJ SINGH(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :This invention relates to novel non-composite and composite superabsorbents, wherein the dry superabsorbents are xerogels, moreparticularly the bio-xerogels or the composites, particularly the biocomposites, more particularly the bionanocomposites and themethod(s) of obtaining the same characterized by simultaneous in situ grafting and cross linking of ethylinically unsaturatedmonomers on to a single biopolymer of plant or animal origin, or on combination of different biopolymers or biopolymer(s) or / andclay(s), in a homogeneous polar phase, in the presence of initiator and crosslinker of chemical or non-chemical origin, at a temperatureof 40 to 90 C, achieved by conventional or microwave heating, reaction time varying from instantaneous to 48 hours, involving use ofalkali, either in situ or post reaction at room or elevated temperatures for achieving superior absorbency, in an inert or ambientreaction environment, to yield a neutral or near neutral product.No. of Pages : 34 No. of Claims : 25 PATENT OFFICE JOURNAL 02/03/2012 3497
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1300/DEL/2010 A(19) INDIA(22) Date of filing of Application :04/06/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : CONTENT-DISPLAY-ENABLING SYSTEM(51) International classification :G01B (71)Name of Applicant :(31) Priority Document No :NA 1)POONAM KHANNA(32) Priority Date :NA Address of Applicant :A-379, TRIVENI NAGAR,(33) Name of priority country :NA GOPALPURA BYE PASS, JAIPUR - 302018, RAJASTHAN(86) International Application No :NA INDIA Filing Date :NA (72)Name of Inventor :(87) International Publication No :NA 1)POONAM KHANNA(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A content-display-enabling system capable of enabling display of a plurality of advertisement content and a plurality of non-advertisement content is provided. The content-display-enabling system has a receiver, a processor and a transmitter. The receiver canreceive a first advertisement content from the plurality of advertisement content. The first advertisement content is associated with aone or more utility and is characterized by a first time duration. The processor enables display of the first advertisement content on adisplay unit. The first advertisement content is displayed for the first time duration. The processor further enables detection of one ormore input form a user. At least a fraction of the one or more input is detected substantially within the first time duration. Atransmitter can transmit an order associated with the one or more utility.No. of Pages : 23 No. of Claims : 9 PATENT OFFICE JOURNAL 02/03/2012 3498
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1301/DEL/2010 A(19) INDIA(22) Date of filing of Application :04/06/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : PNEUMATICALLY POWERED STEPS FOR STAIRCASES(51) International classification :G01B (71)Name of Applicant :(31) Priority Document No :NA 1)BHUPINDER SINGH GILL(32) Priority Date :NA Address of Applicant :H-45, SARITA VIHAR, NEW DELHI-(33) Name of priority country :NA 110076 India(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)BHUPINDER SINGH GILL(87) International Publication No :NA(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :This invention relates to pneumatically powered steps for staircases comprising of atleast two powered steps supporting platform and apneumatic means wherein the platform is connected to atleast two guide rods to guide the platform in its vertical motion so as toenhance its stability in which the rods are connected to a movable plate on the next step wherein the powered steps are operated bypneumatic system such as herein described, in which the powered steps may be provided without the guide rods with a plurality ofdummy rods in cylinders.No. of Pages : 14 No. of Claims : 8 PATENT OFFICE JOURNAL 02/03/2012 3499
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1311/DEL/2010 A(19) INDIA(22) Date of filing of Application :04/06/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : A GALACTOPYRANOSE COMPOUND OF FORMULA (I) AND ITS USE THEREOF(51) International classification :A61K (71)Name of Applicant :(31) Priority Document No :NA 1)NATIONAL INSTITUTE OF PHARMACEUTICAL(32) Priority Date :NA EDUCATION AND RESEARCH (NIPER)(33) Name of priority country :NA Address of Applicant :a Society Registered under the Societies(86) International Application No :NA Registration Act XXI of 1860 having its office at Sector 67 Filing Date :NA S.A.S. Nagar Punjab-160 062 India(87) International Publication No : NA (72)Name of Inventor :(61) Patent of Addition to Application Number :NA 1)KUNNATHERI PALLATHU MADHOM Filing Date :NA RAVINDRANATHAN KARTHA(62) Divisional to Application Number :NA 2)MUGUNTHAN GOVINDARAJAN Filing Date :NA 3)KUPPALA RAMAKRISHNA(57) Abstract :This invention relates to novel galactopyranose compounds of formula I and their use as antimycobacterial agents. Moleculesdisclosed herein can be used to treat mycobacterial infection, in particular Mycobacterium tuberculosis.No. of Pages : 27 No. of Claims : 3 PATENT OFFICE JOURNAL 02/03/2012 3500
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1312/DEL/2010 A(19) INDIA(22) Date of filing of Application :04/06/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : DIN RAIL TERMINAL BLOCK(51) International classification :B23B (71)Name of Applicant :(31) Priority Document No :NA 1)SHANG TSAI WU(32) Priority Date :NA Address of Applicant :NO.3 MIN AN ROAD, HSIN(33) Name of priority country :NA CHUANG. 242, TAIPEI HSIEN, TAIWAN(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)SHANG TSAI WU(87) International Publication No :NA(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A DIN rail terminal block essentially includes a plastic main body, a resilient plate, and a terminal. The resilient plate and the terminalare coupled together by multiple fastening structures and are simultaneously secured in position to the plastic main body, wherein themultiple fastening structures prevent the resilient plate and the terminal from shifting leftward, rightward, upward, or downward withrespect to each other. With the terminal configured for ground connection, and the resilient plate configured for pressing tightlyagainst a DIN rail, the terminal block is stably positioned, provides good electrical connection, and allows easy operation.No. of Pages : 16 No. of Claims : 5 PATENT OFFICE JOURNAL 02/03/2012 3501
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1327/DEL/2010 A(19) INDIA(22) Date of filing of Application :08/06/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : DE NOVO DESIGNED CATIONIC AMPHIPATHIC ANTIBACTERIAL PEPTIES(51) International classification :A01J (71)Name of Applicant :(31) Priority Document No :NA 1)INTERNATIONAL CENTRE FOR GENETIC(32) Priority Date :NA ENGINEERING AND BIOTECHNOLOGY(33) Name of priority country :NA Address of Applicant :ICGEB CAMPUS, P.O. BOX 10504,(86) International Application No :NA ARUNA ASAF ALI MARG, NEW DELHI-110 067, INDIA Filing Date :NA (72)Name of Inventor :(87) International Publication No :NA 1)CHAUHAN, V. S.(61) Patent of Addition to Application Number :NA 2)PATHAK, SARIKA Filing Date :NA 3)GUPTA, MADHVI(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The present invention relates to a series of amphipathic, helical antibacterial peptides comprising tryptophan anddehydrophenylalanine residues. The peptides possess significant antibacterial activity without causing significant lysis of RBCs.No. of Pages : 38 No. of Claims : 17 PATENT OFFICE JOURNAL 02/03/2012 3502
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1309/DEL/2010 A(19) INDIA(22) Date of filing of Application :04/06/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : A METHOD FOR CHEMICAL RECYCLING OF ORTHODONTIC BRACKETS(51) International classification :C07D (71)Name of Applicant :(31) Priority Document No :NA 1)SONAL CHOWDHARY(32) Priority Date :NA Address of Applicant :C/O. DR. P.N. SINGLA, 11,(33) Name of priority country :NA UPENDRA NAGAR, DURGAKUND, VARANASI-221005, U.P.(86) International Application No :NA India Filing Date :NA (72)Name of Inventor :(87) International Publication No :NA 1)SONAL CHOWDHARY(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :This invention relates to a method for chemical recycling of orthodontic brackets comprising of treatment of bracket with requiredamount of sulphuric acid followed by ultrasonication.No. of Pages : 14 No. of Claims : 6 PATENT OFFICE JOURNAL 02/03/2012 3503
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1245/DEL/2010 A(19) INDIA(22) Date of filing of Application :31/05/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : PHOTOVOLTAIC POWER GENERATION SYSTEM AND PHOTOVOLTAIC POWERGENERATION DEVICE(51) International classification :B03C (71)Name of Applicant : :2009- 1)Smart Solar International Inc.(31) Priority Document No 132440 Address of Applicant :Tokyo University Entrepreneur Plaza(32) Priority Date :01/06/2009 7-3-1 Hongou Bunkyo-ku Tokyo Japan(33) Name of priority country :Japan (72)Name of Inventor :(86) International Application No :NA 1)Takashi TOMITA Filing Date :NA(87) International Publication No : NA(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :It is an object to obtain a photovoltaic power generation system. A photovoltaic power generation system includes multiple solar cellmodules each having a different band gap and step-up voltage transformers (boosters) that receive outputs from load resistors, the loadresistors being controlled to maximize outputs of the respective solar cell modules. An output voltage of each step-up voltagetransformer (booster) is controlled to be a predetermined output voltage (or output current), and the step-up voltage transformers(boosters) are connected in parallel (or in series) to obtain predetermined electric power.No. of Pages : 44 No. of Claims : 25 PATENT OFFICE JOURNAL 02/03/2012 3504
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1236/DEL/2010 A(19) INDIA(22) Date of filing of Application :28/05/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : GAS NITRIDED ALUMINIUM-CHROMIUM COATING ON ASTM-SA213-T-22 BOILER STEEL(51) International classification :C07D (71)Name of Applicant :(31) Priority Document No :NA 1)M/S INDIAN INSTITUTE OF TECHNOLOGY,(32) Priority Date :NA ROORKEE(33) Name of priority country :NA Address of Applicant :INDIAN INSTITUTE OF(86) International Application No :NA TECHNOLOGY, ROORKEE ROORKEE, UTTARAKHAND Filing Date :NA Uttaranchal India(87) International Publication No :NA (72)Name of Inventor :(61) Patent of Addition to Application Number :NA 1)VIKASH CHAWLA Filing Date :NA 2)S. PRAKASH(62) Divisional to Application Number :NA 3)D. PURI Filing Date :NA 4)BUTA SINGH SIDHU(57) Abstract :This invention relates to coated steel when said coating is a gas nitrided AlCr coating and said steel is ASTM-SA213-T-22 Boiler, thecoating having a porosity of <0.45%, a particle size of from 5 to 90 µm, a microhardness of from 600 to 700 HV and roughness in therange of 10.63 to 15.60µm.No. of Pages : 74 No. of Claims : 13 PATENT OFFICE JOURNAL 02/03/2012 3505
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1360/DEL/2010 A(19) INDIA(22) Date of filing of Application :11/06/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : ANTI-REFLECTION BARRIER LAYER IN PHOTOVOLTAIC DEVICE(51) International classification :B23B (71)Name of Applicant :(31) Priority Document No :NA 1)MOSER BAER INDIA LIMITED(32) Priority Date :NA Address of Applicant :43B, OKHLA INDUSTRIAL ESTATE(33) Name of priority country :NA NEW DELHI-110020. INDIA(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)A.J.M. VAN ERVEN(87) International Publication No :NA(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A photovoltaic device for photoelectric conversion of incident solar light is provided. The photovoltaic device includes a transparentsubstrate having a substantially flat surface. Further, the photovoltaic device includes a layer of a viscous curable material depositedon the flat surface of the transparent substrate to form a texture on a surface of the layer of the viscous curable material. The textureenhances light trapping capability of the photovoltaic device. The photovoltaic device also includes a barrier layer deposited on thelayer of the viscous curable material. The barrier layer is impermeable to one or more fluids released by the viscous curable material.Further, the photovoltaic device includes one or more semiconductor layers deposited on the barrier layer. The barrier layer preventscontamination of the one or more semiconductor layers from the one or more fluids. Finally, the photovoltaic device includes a coversubstrate.No. of Pages : 20 No. of Claims : 10 PATENT OFFICE JOURNAL 02/03/2012 3506
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1361/DEL/2010 A(19) INDIA(22) Date of filing of Application :11/06/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : PORTABLE STORAGE DEVICE WITH ANTI-VIRUS(51) International classification :A01J (71)Name of Applicant :(31) Priority Document No :NA 1)MOSER BAER INDIA LIMITED(32) Priority Date :NA Address of Applicant :43B, OKHLA INDUSTRIAL EATATE(33) Name of priority country :NA NEW DELHI-110020. INDIA(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)VARUN MEHTA(87) International Publication No :NA 2)VIJAY MALHI(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A portable storage device having a defense mechanism to prevent one or more malicious activities is provided. The portable storagedevice includes a device interface to facilitate association with an external medium like a computer. The portable device also includesa launch platform which is configured to automatically load the defense mechanism onto the external medium once the associationbetween the portable storage device and the external medium has been established. Thereafter, the defense mechanism is executed toprevent the portable storage device from the one or more malicious activities.No. of Pages : 21 No. of Claims : 10 PATENT OFFICE JOURNAL 02/03/2012 3507
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1749/DEL/2010 A(19) INDIA(22) Date of filing of Application :27/07/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : RELIZATION OF LAYERWISE MOBILE NODE DETECTION IN THE LIGHT OF COMPLEXVARIABLE(51) International classification :A61N (71)Name of Applicant :(31) Priority Document No :NA 1)DR.PRASUN CHAKRABARTI(32) Priority Date :NA Address of Applicant :SIR PADAMPAT SINGHANIA(33) Name of priority country :NA UNIVERSITY, UDAIPUR-313601, RAJASTHAN, INDIA(86) International Application No :NA 2)MR. AMRIT GHOSH Filing Date :NA (72)Name of Inventor :(87) International Publication No :NA 1)CHAKRABARTI PRASUN(61) Patent of Addition to Application Number :NA 2)GHOSH AMRIT Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The invention deals with mobile node tracking using Jordan Arc of complex integration. In case of existence of stationary node, it willbe utilized for trend analysis of the motion of target node with respect to the stationary node treating it as a sensor node. The contourmapping will be applicable in case the target nodes position is identical to that of the stationary node.No. of Pages : 3 No. of Claims : 2 PATENT OFFICE JOURNAL 02/03/2012 3508
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1899/DEL/2010 A(19) INDIA(22) Date of filing of Application :13/08/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : A PROCESS FOR COVALENT IMMOBILIZATION OF OXIDATION CATALYST (71)Name of Applicant :(51) International classification :A23J 1)COUNCIL OF SCIENTIFIC & INDUSTRIAL(31) Priority Document No :NA RESEARCH(32) Priority Date :NA Address of Applicant :ANUSANDHAN BHAWAN RAFI(33) Name of priority country :NA MARG, NEW DELHI - 110 001, INDIA(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)JAIN SUMAN LATA(87) International Publication No :NA 2)SINHA ANIL KUMAR(61) Patent of Addition to Application Number :NA 3)SINGH BHAWAN Filing Date :NA 4)RANA BHARAT SINGH(62) Divisional to Application Number :NA 5)KHATRI PRAVEEN KUMAR Filing Date :NA 6)SAIN BIR(57) Abstract :The present invention provides an improved process for the preparation of nitrones using covalently immobilized catalyst. It alsoprovides a novel covalently immobilized highly dispersed silica supported oxo-rhenium catalyst for the oxidation reaction by usingurea-hydrogen peroxide (UHP) as oxidant. The prepared catalyst could readily be recovered from the reaction mixture by simplefiltration and reused several times with consistent catalytic activity.No. of Pages : 24 No. of Claims : 12 PATENT OFFICE JOURNAL 02/03/2012 3509
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1901/DEL/2010 A(19) INDIA(22) Date of filing of Application :13/08/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : A SYSTEM FOR STORING AND MAINTAINING CULTURES AND CULTURING THEBIOLOGICAL SAMPLES(51) International classification :A23J (71)Name of Applicant :(31) Priority Document No :NA 1)INDIAN COUNCIL OF MEDICAL RESEARCH(32) Priority Date :NA Address of Applicant :V. RAMALINGASWAMI BHAWAN,(33) Name of priority country :NA ANSARI NAGAR, POST BOX 4911, NEW DELHI - 110 029,(86) International Application No :NA INDIA. Filing Date :NA (72)Name of Inventor :(87) International Publication No :NA 1)THAVARAJ, VASANTHA(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The present invention provides a system which is useful for storing and maintaining the cultures and for culturing biological samples.The system of the invention operates with or without electricity and can operate on solar energy as a source of power.No. of Pages : 26 No. of Claims : 24 PATENT OFFICE JOURNAL 02/03/2012 3510
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1938/DEL/2010 A(19) INDIA(22) Date of filing of Application :17/08/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : A CONTROL AND DATA ACQUISITION SYSTEM FOR MONITORING AND STORING MILKCOLLECTION DATA(51) International classification :A23J (71)Name of Applicant :(31) Priority Document No :NA 1)RAJASTHAN ELECTRONICS & INSTRUMENTS(32) Priority Date :NA LIMITED, (AN ISO 9001:2000, MINI RATNA, PUBLIC(33) Name of priority country :NA SECTOR ENTERPRISE)(86) International Application No :NA Address of Applicant :2, KANAKPURA INDUSTRIAL Filing Date :NA AREA, SIRSI ROAD, JAIPUR 302 012, Rajasthan India(87) International Publication No :NA (72)Name of Inventor :(61) Patent of Addition to Application Number :NA 1)A. K. JAIN Filing Date :NA 2)A. K. SHARDA(62) Divisional to Application Number :NA 3)R. K. GUPTA Filing Date :NA 4)SATYAVRAT SINGH(57) Abstract :This invention relates to a control and data acquisition system for monitoring and storing milk collection data. This is used for bulkmilk cooler (BMC), silos and water tanks.No. of Pages : 9 No. of Claims : 7 PATENT OFFICE JOURNAL 02/03/2012 3511
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1939/DEL/2010 A(19) INDIA(22) Date of filing of Application :17/08/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : VASTRAM READY TO USE COTTON MANUFACTURING PROCESS(51) International classification :A23J (71)Name of Applicant :(31) Priority Document No :NA 1)VASTRAM WORLDWIDE PVT. LTD.(32) Priority Date :NA Address of Applicant :302 & 303, 3RD FLOOR, PACIFIC(33) Name of priority country :NA SQUARE, SECTOR 15, GURGAON 122001, HARYANA(86) International Application No :NA (INDIA). Filing Date :NA (72)Name of Inventor :(87) International Publication No :NA 1)PARAKASH MISHRA(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :This invention relates to a vastram ready to use cotton with homogeneous blend of different fibre with fibre reconciliation which canbe directly used by spinning mills and the manufacturing process thereof comprising the steps of, preparation involving Ginning ofVirgin cotton and reclamation of fibres from waste generated during spinning process like blow room dropping, carding dropping,carding flat waste, comber noils, processing involving the steps of Bale plucker, Bale opener, super waste cleaner, grading for Ringspinning and open end spinning, Weighing Hopper, Multi mixer, condenser, step cleaner/ tumbling machine, moisture and chemicaltreatment, Finishing involving steps, cleaning, pre-opening and cleaning, Bale pressing.No. of Pages : 25 No. of Claims : 9 PATENT OFFICE JOURNAL 02/03/2012 3512
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1941/DEL/2010 A(19) INDIA(22) Date of filing of Application :17/08/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : SKIN FAIRNESS MEASURING INSTRUMENT.(51) International classification :A61K (71)Name of Applicant :(31) Priority Document No :NA 1)SANJEEV ARJUN GAUR(32) Priority Date :NA Address of Applicant :A-29, SECTOR-36, NOIDA-201303,(33) Name of priority country :NA Uttar Pradesh India(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)SANJEEV ARJUN GAUR(87) International Publication No :NA(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :This invention relates to a skin fairness measuring instrument comprising of a probe, display and control circuitry connected to eachother wherein the probe comprising of a light source and a light sensor along with a resistor constituting a network.No. of Pages : 9 No. of Claims : 7 PATENT OFFICE JOURNAL 02/03/2012 3513
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1940/DEL/2010 A(19) INDIA(22) Date of filing of Application :17/08/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : A FORMULATION OF A HEALTH BEVERAGE SEAPRICOT. (71)Name of Applicant :(51) International classification :A23J 1)DIRECTOR GENERAL, DEFENCE RESEARCH &(31) Priority Document No :NA DEVELOPMENT ORGANISATION, MINISTRY OF(32) Priority Date :NA DEFENCE, GOVT. OF INDIA,(33) Name of priority country :NA Address of Applicant :DRDO BHAWAN, RAJAJI MARG,(86) International Application No :NA NEW DELHI-110011 India Filing Date :NA (72)Name of Inventor :(87) International Publication No :NA 1)TSERING STOBDAN,(61) Patent of Addition to Application Number :NA 2)ASHISH YADAV Filing Date :NA 3)KONCHOK TARGAIS(62) Divisional to Application Number :NA 4)OM PRAKASH CHAURASIA Filing Date :NA 5)BASANT BALLABH 6)SHASHI BALA SINGH(57) Abstract :This invention relates to a formulation of a health beverage-Seapricot comprising of pulp of seabuckthorn (Hippophae rhamnoides L) :Apricot (Prunus armeniaca) in 20:80, sugar and preservative.No. of Pages : 19 No. of Claims : 5 PATENT OFFICE JOURNAL 02/03/2012 3514
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1943/DEL/2010 A(19) INDIA(22) Date of filing of Application :17/08/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : SCAR PRIMERS AND A KIT FOR THE AUTHENTICATION OF UNANI DRUG MULETHI(GLYCERRHIZA GLABRA) AND ITS ADULTERANT ABRUS PRECATORIOUS.(51) International classification :A61K (71)Name of Applicant :(31) Priority Document No :NA 1)CENTRAL COUNCIL FOR RESEARCH IN UNANI(32) Priority Date :NA MEDICINE(33) Name of priority country :NA Address of Applicant :NO. 61-65, INSTITUTIONAL AREA,(86) International Application No :NA OPP. D-BLOCK JANAKPURI, NEW DELHI-110058. India Filing Date :NA (72)Name of Inventor :(87) International Publication No :NA 1)M.Z.ABDIN(61) Patent of Addition to Application Number :NA 2)KHANDA JABEEN MIRZA SALIM KHAN Filing Date :NA 3)USHA KIRAN(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :This invention relates to SCAR Primers and a Kit for the Authentication of Unani Drug Mulethi (Glycerrhiza glabra) and its adulterantAbrus precatorious, 1-An oligonucleotide primer set (SCAR primers) for authentification of genuine single Unani drug and itsadulterant each comprising a forward and a reverse primer, 1(a) Genuine drug ,Mulethi (Glycerrhiza glabra),5GGCACTTCAACTTCCCCAAATTACCC-3 5GATTCACTCTCCTCCAACCCATCAC-3, and its adulterant 1(b) Abrusprecatorious,5TCGCAGCTGCAGACGCGTTACGTA3, 5CGTTCGAGTTCGT AGTCCACGTTCTT-3 and a kit for authenticationof genuine drug, which comprises: Kit (a) an oligonucleotide primer set genuine drug Glycerrhiza glabra that comprises a forwardoligonucleotide primer having the nucleotide sequence set forth in SEQ ID NO:23 (5GGCACTTCAACTTCCCCAAATTACCC-3),and a reverse oligonucleotide primer having the nucleotide sequence set forth in SEQ ID NO:24(5GATTCACTCTCCTCCAACCCATCAC-3), (a) an oligonucleotide primer set for the adulterant Abrus precatorious that comprisesa forward oligonucleotide primer having the nucleotide sequence set forth in SEQ IDNO:25(5TCGCAGCTGCAGACGCGTTACGTA3) and a reverse oligonucleotide primer having the nucleotide sequence set forth inSEQ ID NO:26 (5CGTTCGAGTTCGTAGTCCACGTTCTT-3,).No. of Pages : 25 No. of Claims : 6 PATENT OFFICE JOURNAL 02/03/2012 3515
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1946/DEL/2010 A(19) INDIA(22) Date of filing of Application :17/08/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : SCAR PRIMERS AND A KIT FOR THE AUTHENTICATION OF UNANI DRUG (ZIZYPHUSJUJUBE) AND ITS ADULTERANT JHAD BERI (ZIZYPHUS NUMMULARIA).(51) International classification :A61K (71)Name of Applicant :(31) Priority Document No :NA 1)CENTRAL COUNCIL FOR RESEARCH IN UNANI(32) Priority Date :NA MEDICINE(33) Name of priority country :NA Address of Applicant :NO. 61-65, INSTITUTIONAL AREA,(86) International Application No :NA OPP. D-BLOCK JANAKPURI, NEW DELHI-110058. India Filing Date :NA (72)Name of Inventor :(87) International Publication No :NA 1)M.Z.ABDIN(61) Patent of Addition to Application Number :NA 2)KHANDA JABEEN MIRZA SALIM KHAN Filing Date :NA 3)ATHAR ALI(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :This invention relates to SCAR Primers and a Kit for the Authentication of Unani Drug (Zizyphus jujube) and its adulterant Jhad Beri(Zizyphus nummularia), 1(a) Genuine drug ,Unnab (Zizyphus jujube), 5-GATGGGGCCAGACGTCGCAT-3, 5-CCCTGCGAAAAATGGGCTCGC-3, and its adulterant l(b)jhad beri (Zizyphus nummularia), 5-AGGATCACTTTGAACTCAAGGCATGGG-3, 5- CTGCATCGTGGGGTGACAACG-3, and a kit for authentication of genuinedrug, which comprises: kit, (a) an oligonucleotide primer set genuine drug Zizyphus jujube comprises a forward oligonucleotideprimer having the nucleotide sequence set forth in SEQ ID NO:7 (5-GATGGGGCCAGACGTCGCAT-3) and a reverseoligonucleotide primer having the nucleotide sequence set forth in SEQ ID NO:8 (5-CCCTGCGAAAAATGGGCTCGC-3), (b) anoligonucleotide primer set for the adulterant Zizyphus nummularia that comprises a forward oligonucleotide primer having thenucleotide sequence set forth in SEQ ID NO:9 (5-AGGATCACTTTGAACTCAAGGCATGGG-3) and a reverse oligonucleotideprimer having the nucleotide sequence set forth in SEQ ID NO: 10 (5-CTGCATCGTGGGGTGAC AACG-3,.)-No. of Pages : 22 No. of Claims : 6 PATENT OFFICE JOURNAL 02/03/2012 3516
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1947/DEL/2010 A(19) INDIA(22) Date of filing of Application :17/08/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : SCAR PRIMERS AND A KIT FOR THE AUTHENTICATION OF UNANI DRUG ZAAFRAN(CROCUS SATIVUS) AND ITS ADULTERANT QURTUM (CARTHAMUS TINCTORIOUS).(51) International classification :A61K (71)Name of Applicant :(31) Priority Document No :NA 1)CENTRAL COUNCIL FOR RESEARCH IN UNANI(32) Priority Date :NA MEDICINE(33) Name of priority country :NA Address of Applicant :NO. 61-65, INSTITUTIONAL AREA,(86) International Application No :NA OPP. D-BLOCK JANAKPURI, NEW DELHI-110058. India Filing Date :NA (72)Name of Inventor :(87) International Publication No :NA 1)M.Z.ABDIN(61) Patent of Addition to Application Number :NA 2)KHANDA JABEEN MIRZA SALIM KHAN Filing Date :NA 3)PARUL SAXENA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :SCAR Primers and a Kit for the Authentication of Unani Drug Zaafran (Crocus sativus) and its adulterant Qurtum (Carthamustinctorious). This invention relates to SCAR Primers and a Kit for the Authentication of Unani Drug Zaafran (Crocus sativus) and itsadulterant Qurtum (Carthamus tinctorious) 1-An oligonucleotide primer set (SCAR primers) for authentication of genuine singleUnani drug and its adulterant each comprising a forward and a reverse primer, 1(a) Genuine drug ,Zaafraan (Crocus sativus) 5GGGAATTCGATTAGTCGTC -3, 5 ACAGGAAATCAGTTACGAACG 3 and its adulterant l(b)Qurtum (Carthamus tinctorious), 5AATTCGATTAGTTCGTCCCCTG ,3, 5 CGCCAAGCTATTTAGGTGACA 3, and a kit for authentication of genuine drug, whichcomprises: kit (a) an oligonucleotide primer set genuine drug Crocus sativus comprises a forward oligonucleotide primer having thenucleotide sequence set forth in SEQ ID NO:3 (5 GGGAATTCGATTAGTCGTC -3) and a reverse oligonucleotide primer having thenucleotide sequence set forth in SEQ ID NO:4 (5 ACAGGAAATCA GTTACGAACG 3) (b) an oligonucleotide primer set for theadulterant Carthamus tinctorious that comprises a forward oligonucleotide primer having the nucleotide sequence set forth in SEQ IDNO:5(5 AATTCGATTAGTTCGTCCCCTG 3) and a reverse oligonucleotide primer having the nucleotide sequence set forth in SEQID NO:6 (5CGCCAAGCTATTTAGGTGACA 3).No. of Pages : 23 No. of Claims : 6 PATENT OFFICE JOURNAL 02/03/2012 3517
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1948/DEL/2010 A(19) INDIA(22) Date of filing of Application :17/08/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : SCAR PRIMERS AND A KIT FOR THE AUTHENTICATION OF UNANI DRUG (REWAND CHINI)RHEUM EMODI AND ITS ADULTERANT RHEUM PALMATUM.(51) International classification :A61K (71)Name of Applicant :(31) Priority Document No :NA 1)CENTRAL COUNCIL FOR RESEARCH IN UNANI(32) Priority Date :NA MEDICINE(33) Name of priority country :NA Address of Applicant :NO. 61-65, INSTITUTIONAL AREA,(86) International Application No :NA OPP. D-BLOCK JANAKPURI, NEW DELHI-110058. India Filing Date :NA (72)Name of Inventor :(87) International Publication No :NA 1)M.Z.ABDIN(61) Patent of Addition to Application Number :NA 2)KHANDA JABEEN MIRZA SALIM KHAN Filing Date :NA 3)PRAVEJ ALAM(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :This invention relates to SCAR Primers and a Kit for the Authentication of Unani Drug (Rewand Chini) Rheum emodi and itsadulterant Rheum palmatum, 1 (a) Genuine drug ,Rewand chini (Rheum emodi), 5-CCATGGTGGCCGCGGGAAT-3,5-AAGAGGAGCGTCTGTCGGGACG-3, and its adulterant 1(b) (Rheum palmatum), 5-ACCTAGAAGGCGGCCGCGAA-3 , 5-TGCGAAAATCCCTGTTTTCTAAGGTGT-3, and a kit for authentication of genuine drug which comprises, kit, (a) anoligonucleotide primer set genuine drug Rheum emodi comprises a forward oligonucleotide primer having the nucleotide sequence setforth in SEQ ID NO: 11 (5-CCATGGTGGCCGCGGGAAT-) and a reverse oligonucleotide primer having the nucleotide sequence setforth in SEQ ID NO: 12 (5-AAGAGGAGCGTCTGTCGGGACG-3), (b) an oligonucleotide primer set for the adulterant Rheumpalmatum that comprises a forward oligonucleotide primer having the nucleotide sequence set forth in SEQ ID NO:13(5-ACCTAGAAGGCGGCCGCGAA-3)and a reverse oligonucleotide primer having the nucleotide sequence set forth in SEQ ID NO:14(5-TGCGAAAATCCCTGTTTTCTAAGGTGT-3)No. of Pages : 23 No. of Claims : 6 PATENT OFFICE JOURNAL 02/03/2012 3518
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1951/DEL/2010 A(19) INDIA(22) Date of filing of Application :17/08/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : METHOD OF ISOLATION OF LACCASE ENZYME FROM ARTHROGRAPHIS SP.(51) International classification :A01J (71)Name of Applicant :(31) Priority Document No :NA 1)COUNCIL OF SCIENTIFIC & INDUSTRIAL(32) Priority Date :NA RESEARCH(33) Name of priority country :NA Address of Applicant :ANUSANDHAN BHAWAN RAFI(86) International Application No :NA MARG, NEW DELHI - 110 001, INDIA. Filing Date :NA (72)Name of Inventor :(87) International Publication No :NA 1)VIJAY CHINTAMAN SONAWANE(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The invention relates to a method of isolating Laccase enzyme from a novel strain Arthrography sp. The enzyme is active in the widepH range from 3-8 However, the pH optimum lies in the range of 3-5 to 6 for various substrates. The enzyme is active in the range of25 to 80 C, However, the optimum temperature of the enzyme is in the range of 40-50 for various substrates. The isoelectric point ofthe enzyme is about 3.5 as determined by isoelectric focusing. The molecular weight of the enzyme is about 63 kDa, as determined bySDS-PAGE and gel filtration chromatography. The molecular weight of the enzyme by MALDI-ToF is 58.33 kDa. The enzyme canefficiently degrade various textile dyes including to anthroquinone group, azo group, triarylmethane group, eurhodin group, indigo,triazine and reactive dyes. In the presence of mediators such as hydroxybenzotriole, violuric acid and acetosyringone, the rate ofdecolorization of dyes is enhanced. The enzyme may also be employed in application in exist in bakery, brewery and wine industry,synthesis of chemicals, fabrication of cathode for fuel cellNo. of Pages : 28 No. of Claims : 9 PATENT OFFICE JOURNAL 02/03/2012 3519
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1952/DEL/2010 A(19) INDIA(22) Date of filing of Application :17/08/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : A PROCESS FOR THE EXTRACTION OF AN ANTIOXIDANT PRINCIPLE FROM ELEPHANT-FOOT-YAM (AMORPHOPHALLUS PAEONIIFOLIUS SYN A.CAMPANULATUS) CORM.(51) International classification :A01J (71)Name of Applicant :(31) Priority Document No :NA 1)COUNCIL OF SCIENTIFIC & INDUSTRIAL(32) Priority Date :NA RESEARCH(33) Name of priority country :NA Address of Applicant :ANUSANDHAN BHAWAN RAFI(86) International Application No :NA MARG, NEW DELHI - 110 001, INDIA. Filing Date :NA (72)Name of Inventor :(87) International Publication No :NA 1)HARSHAVARDHAN REDDY, A.(61) Patent of Addition to Application Number :NA 2)ARADHYA S.M. Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The present invention relates to a process for the extraction of an antioxidant principle from elephant-foot-yam {Amorphophalluspaeoniifolius syn A. campanulatus) corm by solvent extraction, which comprises collection of corm, slicing and drying in hot air ovenat 48 °C for a period of 36 hours, powdering in apex grinder to 60 mesh after which 50 g of elephant-foot-yam corm powder wasextracted serially with suitable solvents such as hexane, chloroform, ethyl acetate, acetone and methanol and solvent was removed bydistillation to obtain 152.1mg,87.9mg,19.4mg,65.9mg and 521.5mg of crude extracts respectively. These extracts were subjected toantioxidant assay by DPPH method. The hexane, chloroform, ethyl acetate, acetone and methanol extracts showed antioxidant activityof 12.00%,14.79%,12.76%,75.34% and 73.50% respectively.IC50 values of acetone and methanol extracts were found to be 8.5 and30 µg/ml reaction mixture.No. of Pages : 8 No. of Claims : 4 PATENT OFFICE JOURNAL 02/03/2012 3520
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1957/DEL/2010 A(19) INDIA(22) Date of filing of Application :17/08/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : COMPLEX VARIABLE BASED MARKOV MODEL REALIZATION AND NODE SENSING INMOBILE COMPUTING(51) International classification :G04G (71)Name of Applicant :(31) Priority Document No :NA 1)DR. PRASUN CHAKRABARTI(32) Priority Date :NA Address of Applicant :SIR PADAMPAT SINGHANIA(33) Name of priority country :NA UNIVERSITY, UDAIPUR-313601, RAJASTHAN, INDIA(86) International Application No :NA 2)MR. AMRIT GHOSH Filing Date :NA (72)Name of Inventor :(87) International Publication No :NA 1)CHAKRABARTI PRASUN(61) Patent of Addition to Application Number :NA 2)GHOSH AMRIT Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :Markov model based nodal transition deals with probabilistic weight assignment in outdegree path(s).The invention deals with suchweight determination in complex domain such that the parameters include modulus of non-zero real part and that of nonzeroimaginary co-efficient of transition node(s). The invention also deals with node selection on the basis of complex orientations on anode with respect to a fixed stationary node .No. of Pages : 3 No. of Claims : 3 PATENT OFFICE JOURNAL 02/03/2012 3521
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1953/DEL/2010 A(19) INDIA(22) Date of filing of Application :17/08/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : PROCESS FOR THE PREPARATION OF HIGHLY EFFICIENT AND STABILIZED COPPER (0)NANOPARTICLES FOR HECK-, SUZUKI-, SONOGASHIRA-, AND STILLE- TYPE COUPLING OF CHLOROARENES(51) International classification :B60D (71)Name of Applicant :(31) Priority Document No :NA 1)COUNCIL OF SCIENTIFIC & INDUSTRIAL(32) Priority Date :NA RESEARCH(33) Name of priority country :NA Address of Applicant :ANUSANDHAN BHAWAN RAFI(86) International Application No :NA MARG, NEW DELHI - 110 001, INDIA. Filing Date :NA (72)Name of Inventor :(87) International Publication No :NA 1)LIKHAR PRAVIN RAYBAJI(61) Patent of Addition to Application Number :NA 2)RACHA ARUNDHATHI Filing Date :NA 3)DANDU DAMODARA(62) Divisional to Application Number :NA 4)MANEPALLI LAKSHMI KANTAM Filing Date :NA(57) Abstract :The present invention relates to an a-alumina supported nanoCopper catalyst prepared from copper aluminium hydrotalcite precursorby reduction of copper aluminium hydrotalcites under the flow of hydrogen gas. This a-alumina supported nanoCopper catalystexhibits higher activity and selectivity in C--C bond coupling reactions such as Heck, Suzuki, Sonogashira and Stille type reactionsinvolving chloroarenes that include both electron poor and electron rich chloroarenes. A phosphine free new recyclable heterogeneouscatalytic system is developed to dispense the use of expensive and air sensitive basic phosphines for palladium catalyzed couplingreactions of chloroarenes. In situ generated basic α-alumina (α-Al2O3) support not only stabilizes the nanocopper [Cu(0)]particles byseizing coppers propensity for the oxidation but also provides the adequate electron density to the anchored Cu(0) species to facilitateoxidative addition of even the deactivated electron rich chloroarenes.No. of Pages : 27 No. of Claims : 17 PATENT OFFICE JOURNAL 02/03/2012 3522
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1996/DEL/2010 A(19) INDIA(22) Date of filing of Application :24/08/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : TOILET WASTE TREATMENT SYSTEM AND DEVICE(51) International classification :B09B1/00 (71)Name of Applicant :(31) Priority Document No :NA 1)INDIAN INSTITUTE OF TECHNOLOGY KANPUR(32) Priority Date :NA Address of Applicant :DEAN, RESEARCH &(33) Name of priority country :NA DEVELOPMENT, 255, FACULTY BUILDING, INDIAN(86) International Application No :NA INSTITUTE OF TECHNOLOGY KANPUR, KANPUR - Filing Date :NA 208016, UTTAR PRADESH, INDIA(87) International Publication No :NA (72)Name of Inventor :(61) Patent of Addition to Application Number :NA 1)TARE, VINOD Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :Described herein is a system (100) having a separator (102) to separate a mixture into at least a first component and a secondcomponent. The separator includes a top portion (202) having a substantial tapered portion; at least one inlet (306) disposed adjacentto a top end of the top portion (202); a bottom portion (204) disposed below the top portion (202), wherein the bottom portion (204) issimilar in shape to the top portion (202) and is disposed inverted with regard to the top portion (202); and a connecting portion (206)coupling the top portion (202) to the bottom portion (204). The system further includes at least one tank (107) having a first portion(108) and a second portion (110) configured to receive the first and the second components, respectively, wherein the first portion(108) is disposed below and inline with a center of the separator (102).No. of Pages : 20 No. of Claims : 18 PATENT OFFICE JOURNAL 02/03/2012 3523
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1993/DEL/2010 A(19) INDIA(22) Date of filing of Application :23/08/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : SMART TOLL PLAZA AUTOMATION(51) International classification :G06M1/00 (71)Name of Applicant :(31) Priority Document No :NA 1)NATURE-ALLY ENERGY SERVICES PVT., LIMITED.(32) Priority Date :NA Address of Applicant :35 KESHAV NAGAR, HAWA(33) Name of priority country :NA SADAK CIVIL LINES JAIPUR. Rajasthan India(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)ANKIT SINGHVI(87) International Publication No :NA(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The instant invention generally relates to a system and method for toll plaza automation and more particularly relates to a system andmethod for a tamper proof, reliable, scalable and an energy efficient toll plaza system and to an associated method thereof to build saidsystem.No. of Pages : 10 No. of Claims : 12 PATENT OFFICE JOURNAL 02/03/2012 3524
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1997/DEL/2010 A(19) INDIA(22) Date of filing of Application :24/08/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : A NOVEL INDIGENOUS FORMULATION FOR TREATMENT AND PREVENTION OF HAIRLOSS/ALOPECIA/HAIR FALL AND THINNING OF SCALP HAIR AND A METHOD OF PREPARING THEREOF.(51) International classification :A61K31/00 (71)Name of Applicant :(31) Priority Document No :NA 1)REGISTRAR, JAMIA HAMDARD (DEEMED(32) Priority Date :NA UNIVERSITY),(33) Name of priority country :NA Address of Applicant :HAMDARD NAGAR, NEW DELHI(86) International Application No :NA 110062, India Filing Date :NA 2)FATIMA HASN,(87) International Publication No :NA (72)Name of Inventor :(61) Patent of Addition to Application Number :NA 1)FATIMA HASAN Filing Date :NA 2)ROOP KRISHEN KHAR(62) Divisional to Application Number :NA 3)FARHAN JALEES AHMAD Filing Date :NA(57) Abstract :This invention relates to a novel indigenous formulation for treatment and prevention of hair loss/ alopecia/ hair fall and thinning ofscalp hair comprising of a mixture of leech extract, egg oil and perfume and also this invention relates to a method for the preparationof an indigenous formulation for prevention of hair loss and/or for growth of new hair on the scalp made of dried leech/ bloodextracted leeches/ extract of leech/ leech in mustard oil, egg oil and perfume comprising steps of preparing leech extract byintroducing dried leech/extract of leech/blood extracted from leeches to a steel vessel, pouring 1 litre mustard oil in it, the mixture isboiled at 90-140°C for 10 minutes and then at 45-75°C for 4.5 hours, the said mixture is then filtered and centrifuged at 5000 rpm for30 minutes, supernatant is collected, preparing egg oil by boiling hen eggs in water, egg yolk is separated, yolk is crushed and heatedtill it is dry, petroleum ether is added to the dried egg yolk, the said mixture is shaken for 5 minutes and kept for 2 hours to providediffusion of extract in petroleum ether, the said mixture is distilled, the distillate is filtered and centrifuged at 5000 rpm for 30 minutes,the supernatant (egg oil) is collected in glass container, mixing leech extract from step (a) in egg oil from step (b) by thoroughlystirring the mixture, heating the mixture at 50-80°C for 30 minutes, cooling the mixture to room temperature, filtering the mixture,adding perfume to the filtrate and mixed thoroughly to prepare the formulation.No. of Pages : 23 No. of Claims : 4 PATENT OFFICE JOURNAL 02/03/2012 3525
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1998/DEL/2010 A(19) INDIA(22) Date of filing of Application :24/08/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : ALPHA-TERPINENE AS A NOVEL PERMEATION ENHANCER(51) International classification :A61K31/00 (71)Name of Applicant :(31) Priority Document No :NA 1)JAMIA HAMDARD (HAMDARD UNIVERSITY)(32) Priority Date :NA Address of Applicant :HAMDARD NAGAR, NEW DELHI(33) Name of priority country :NA 110062. India(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)MOHAMMED AQIL(87) International Publication No :NA 2)ABDUL AHAD(61) Patent of Addition to Application Number :NA 3)KANCHAN KOHLI Filing Date :NA 4)YASMIN SULTANA(62) Divisional to Application Number :NA 5)MOHD. MUJEEB Filing Date :NA 6)ASGAR ALI(57) Abstract :This invention relates to a novel formulation to transdermally/transmucosally deliver a pharmaceutically active principle at atherapeutically effective rate by a skin permeation enhancing factor comprising a a-terpinene 1-5% w/v, a covalent ethanol 0-40% v/vin the main solvent isotonic phosphate buffer (pH 7.4) and the method of preparation thereof comprising the steps of, Preparing a subsaturated or saturated drug solution in the vehicle, i.e. ethanol: IPB (pH 7.4) (40:60) mixture, Adding a- terpinene to the donor phasein increasing concentration ie 1%, 3% and 5%.No. of Pages : 34 No. of Claims : 9 PATENT OFFICE JOURNAL 02/03/2012 3526
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1999/DEL/2010 A(19) INDIA(22) Date of filing of Application :24/08/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : SABINENE HYDRATE AS A NOVEL PERMEATION ENHANCER.(51) International classification :A61K31/00 (71)Name of Applicant :(31) Priority Document No :NA 1)JAMIA HAMDARD (HAMDARD UNIVERSITY)(32) Priority Date :NA Address of Applicant :HAMDARD NAGAR, NEW DELHI(33) Name of priority country :NA 110062. India(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)MOHAMMED AQIL(87) International Publication No :NA 2)ABDUL AHAD(61) Patent of Addition to Application Number :NA 3)KANCHAN KOHLI Filing Date :NA 4)YASMIN SULTANA(62) Divisional to Application Number :NA 5)MOHD. MUJEEB Filing Date :NA 6)ASGAR ALI(57) Abstract :This invention relates to a novel formulation to dermally/ transdermally/ transmucosally deliver a pharmaceutically active principle ata therapeutically effective rate by a skin permeation enhancing factor comprising sabinene hydrate 1-5% w/v, a cosolvent ethanol 0-40% v/v in the main solvent isotonic phosphate buffer (pH-7.4) and the method of preparation thereof comprising the steps of,preparing a subsaturated or saturated drug solution in the vehicle, ie ethanol: IPB (pH 7.4) (40:60) mixture, adding sabinene hydrate todonor phase in increasing concentration ie 1%, 3% and 5%.No. of Pages : 35 No. of Claims : 9 PATENT OFFICE JOURNAL 02/03/2012 3527
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2002/DEL/2010 A(19) INDIA(22) Date of filing of Application :25/08/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : JOINT TURBINE ROTOR COMPONENTS AND METHOD THEREOF(51) International classification :B23K28/00 (71)Name of Applicant :(31) Priority Document No :09168600.6 1)ALSTOM TECHNOLOGY LTD(32) Priority Date :25/08/2010 Address of Applicant :BROWN BOVERI STRASSE 7, CH-(33) Name of priority country :EPO 5400 BADEN, SWITZERLAND(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)RICHARD BRENDON SCARLIN(87) International Publication No :NA 2)MARTIN REIGL(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The invention relates to provides a method for joining a steel (10) and nickel alloy (30) turbine rotor components together and joinedturbine rotor components (10,30) produced by the method. The method includes the steps of: providing a steel rotor component (10);laying down a nickel alloy butter layer (20) on the steel component (10); providing a nickel alloy rotor component (30); and thenwelding the nickel alloy butter layer (10) to the nickel alloy component (30) using a nickel alloy weld filler (25) so as to join togetherthe components (10,30). The butter layer (20), laid first to the steel component (10), enables reliable testing, for defect, of the nickelalloy / steel fusion line.No. of Pages : 11 No. of Claims : 10 PATENT OFFICE JOURNAL 02/03/2012 3528
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2003/DEL/2010 A(19) INDIA(22) Date of filing of Application :25/08/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : LEAD-THROUGH BLOCK(51) International classification :C08J5/00 (71)Name of Applicant :(31) Priority Document No :P-388887 1)ALSTOM TECHNOLOGY LTD(32) Priority Date :26/08/2010 Address of Applicant :BROWN BOVERI STRASSE 7, CH-(33) Name of priority country :Poland 5400 BADEN, SWITZERLAND(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)ARKADIUSZ WASZKOWSKI(87) International Publication No :NA 2)WOJCIECH FERENS(61) Patent of Addition to Application Number :NA 3)WLADYSLAW PIETRUSZEWICZ Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The present invention concerns a lead-through plate for leading electric contacts and/or measurements of electric sensors out of anenvironment containing a gas, said lead-through plate comprising a plate essentially consisting of a synthetic polymer material.No. of Pages : 13 No. of Claims : 16 PATENT OFFICE JOURNAL 02/03/2012 3529
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2005/DEL/2010 A(19) INDIA(22) Date of filing of Application :25/08/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : SURFACE WATER PUMP.(51) International classification :F04B19/00 (71)Name of Applicant :(31) Priority Document No :NA 1)RAJESH KUMAR(32) Priority Date :NA Address of Applicant :RAJESH KUMAR ABDOLLAPUR,(33) Name of priority country :NA P.O. CHILKANA SAHARANPUR (U.P.) 247132. Uttar Pradesh(86) International Application No :NA India Filing Date :NA (72)Name of Inventor :(87) International Publication No :NA 1)RAJESH KUMAR(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :Inventing surface water pump has the solution of low sucking power of the old (prior) surface water pump having single or twocentrifugal impellers. The prior water pump does not lift the water from more than 10 meter depth the earth. I have used multiplescrew impellers with centrifugal impellers in the inventing surface water pump to increase its lifting (suction) limit more than 10meters and have an option to use multiple screw impellers with centrifugal impellers we require more pressure (suction limit) we canintroduce more no of screw impellers in the system. And can be increased the sucking (lifting) power of the system.No. of Pages : 12 No. of Claims : 4 PATENT OFFICE JOURNAL 02/03/2012 3530
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2010/DEL/2010 A(19) INDIA(22) Date of filing of Application :25/08/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : OPTICAL STORAGE MEDIA(51) International classification :G02B (71)Name of Applicant :(31) Priority Document No :NA 1)MOSER BAER INDIA LIMITED(32) Priority Date :NA Address of Applicant :43B, OKHLA INDUSTRIAL ESTATE(33) Name of priority country :NA NEW DELHI - 110020. INDIA(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)JITENDRA RANA(87) International Publication No :NA 2)VISHAL SRIVASTAVA(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :An optical storage media capable of being offset printed is provided. The optical storage media includes a substantially transparentpolycarbonate substrate having a pattern of depressions and one or more substantially flat portions, a dye layer confined in the patternof depressions to facilitate data storage, a reflective layer substantially bonded to the one or more substantially flat portions of thepolycarbonate substrate such that there is an increased adhesion between the reflective layer and the polycarbonate substrate and aprintable layer substantially bonded to the reflective layer such that the printable layer is capable of being offset printed without beingseparated from the reflective layer and the polycarbonate substrate.No. of Pages : 26 No. of Claims : 5 PATENT OFFICE JOURNAL 02/03/2012 3531
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2018/DEL/2010 A(19) INDIA(22) Date of filing of Application :25/08/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : AUTO REFRESH ETCO2 SAMPLING LINE(51) International classification :A61K (71)Name of Applicant :(31) Priority Document No :NA 1)DR. NAVDEEP SOKHAL(32) Priority Date :NA Address of Applicant :11, LAXMAN COLONY, NEW(33) Name of priority country :NA SANGANER ROAD, JAIPUR, RAJ. 302019 Rajasthan India(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)DR. NAVDEEP SOKHAL(87) International Publication No :NA(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :This invention reduce ETCO2 monitor sampling line blockade due to water vapour is a very efficient way and very cost effective.Improves patient monitoring and case.No. of Pages : 5 No. of Claims : 8 PATENT OFFICE JOURNAL 02/03/2012 3532
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2031/DEL/2010 A(19) INDIA(22) Date of filing of Application :27/08/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : AN IMPROVED TRACTOR WITH LIFT METER.(51) International classification :G07D (71)Name of Applicant :(31) Priority Document No :NA 1)PAVITAR SINGH(32) Priority Date :NA Address of Applicant :V.P.O. TALWANDI MANGE KHAN(33) Name of priority country :NA TEH ZIRA DISTT. FEROZEPUR, PUNJAB, PIN CODE-(86) International Application No :NA 142047, India Filing Date :NA (72)Name of Inventor :(87) International Publication No :NA 1)PAVITAR SINGH(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :Currently known tractor is not provided with a provision for automatic operation of lift by means of an electronic system and a meterto indicate the height by which the lift goes up/down.No. of Pages : 9 No. of Claims : 8 PATENT OFFICE JOURNAL 02/03/2012 3533
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2032/DEL/2010 A(19) INDIA(22) Date of filing of Application :27/08/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : AN AUTOMATIC SYSTEM FOR OPERATING A TUBEWELL.(51) International classification :B31C (71)Name of Applicant :(31) Priority Document No :NA 1)PAVITAR SINGH(32) Priority Date :NA Address of Applicant :V.P.O. TALWANDI MANGE KHAN(33) Name of priority country :NA TEH ZIRA DISTT. FEROZEPUR, PUNJAB, PIN CODE-(86) International Application No :NA 142047, India Filing Date :NA (72)Name of Inventor :(87) International Publication No :NA 1)PAVITAR SINGH(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :Presently, it is not known to have provided an automatic system for operation of tubewell, which can also control the tubewellsoperation after detecting and indicating fault of the system.No. of Pages : 8 No. of Claims : 8 PATENT OFFICE JOURNAL 02/03/2012 3534
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2033/DEL/2010 A(19) INDIA(22) Date of filing of Application :27/08/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : A MAGNETIC-ABRASIVE POWDER AND A METHOD FOR PREPARATION OF THE SAME(51) International classification :G01B (71)Name of Applicant :(31) Priority Document No :NA 1)GURU NANAK DEV ENGG COLLEGE LUDHIANA,(32) Priority Date :NA PUNJAB(33) Name of priority country :NA Address of Applicant :G. N. D ENGINEERING COLLEGE,(86) International Application No :NA LUDHIANA Punjab India Filing Date :NA 2)BABA BANDA SINGH BAHADUR ENGINEERING(87) International Publication No :NA COLLEGE FATHEGARH SAHIB(61) Patent of Addition to Application Number :NA (72)Name of Inventor : Filing Date :NA 1)SEHIJPAL SINGH(62) Divisional to Application Number :NA 2)LAKHBIR SINGH Filing Date :NA 3)P. S. MISHRA(57) Abstract :This invention relates to a method of preparing magnetic-abrasive powder comprising steps of: a) alloying of magnetic component andan abrasive component; b) compaction of the powder of step (a); c) annealing of the compacts of step b in hydrogen gas d) crushing ofsaid compacts to form powder; e) grading of the crushed powder into different sizes using sieves of different sizes. Further, thisinvention also relates to a magnetic-abrasive powder comprises of a magnetic component (e.g. iron) in the range of 50-90% and anabrasive component (e.g. Al2O3) in the range of 10-50%.No. of Pages : 16 No. of Claims : 8 PATENT OFFICE JOURNAL 02/03/2012 3535
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2065/DEL/2010 A(19) INDIA(22) Date of filing of Application :31/08/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : A NOVEL TAILOR -MADE CU/ZU SUPEROXIDE DISMUTASE (SOD) ENZYME AND A PROCESSFOR PRODUCTION OF THE SAME FROM AN ISOLATED POLYNUCLEOTIDE FROM THE PLANT WITHANIASOMNIFERA(51) International classification :C08B (71)Name of Applicant :(31) Priority Document No :NA 1)COUNCIL OF SCIENTIFIC & INDUSTRIAL(32) Priority Date :NA RESEARCH(33) Name of priority country :NA Address of Applicant :ANUSANDHAN BHAWAN, RAFI(86) International Application No :NA MARG, NEW DELHI-110 001, INDIA. Filing Date :NA (72)Name of Inventor :(87) International Publication No :NA 1)MADANALA RAJU(61) Patent of Addition to Application Number :NA 2)SINGH PRADHYUMNA KUMAR Filing Date :NA 3)VISHWANATH SAWANTH SAMIR(62) Divisional to Application Number :NA 4)PANDEY VIVEK Filing Date :NA 5)TULI RAKESH(57) Abstract :The present invention provides an enzyme Cu/Zn superoxide dismutase (Cu/Zn SOD) enzyme from Withania somnifera. Presentinvention particularly describes a method for isolation of DNA sequence encoding said Cu/Zn SOD enzyme and its expression inheterologous system that comprises of a construct which carries the coding nucleotide sequence which is responsible for synthesis ofsaid enzyme (SOD) and transformation of E. coli for production of the said SOD enzyme. This SOD enzyme is stable up to 100°Chaving half life of inactivation of enzyme t1/2 more than 280 minutes at 95°C and also stable over a wide range of pH (2.0 to 11.5), itis also stable in alcohol, SDS and resistant to protease digestion.No. of Pages : 41 No. of Claims : 8 PATENT OFFICE JOURNAL 02/03/2012 3536
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2061/DEL/2010 A(19) INDIA(22) Date of filing of Application :31/08/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : A LIFT-O-MATIC/AUTO LIFT SYSTEM FOR AGRICULTURAL TRACTORS.(51) International classification :B31C (71)Name of Applicant :(31) Priority Document No :NA 1)ESCORTS LIMITED(32) Priority Date :NA Address of Applicant :KNOWLEDGE MANAGEMENT(33) Name of priority country :NA CENTRE, 15/5, MATHURA ROAD, FARIDABAD- 121 003(86) International Application No :NA HARYANA India Filing Date :NA (72)Name of Inventor :(87) International Publication No :NA 1)YOGESH PATIL(61) Patent of Addition to Application Number :NA 2)GANESH T. JADHAV Filing Date :NA 3)J.G. TRIVEDI(62) Divisional to Application Number :NA 4)NEERAJ VIJ ESCORTS LIMITED Filing Date :NA(57) Abstract :This invention relates to a lift-o-matic/auto lift system for agricultural tractors.No. of Pages : 18 No. of Claims : 5 PATENT OFFICE JOURNAL 02/03/2012 3537
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2066/DEL/2010 A(19) INDIA(22) Date of filing of Application :31/08/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : EARTHQUAKE PROTECTION DEVICE FOR BRIDGES(51) International classification :B41G (71)Name of Applicant :(31) Priority Document No :NA 1)COUNCIL OF SCIENTIFIC & INDUSTRIAL(32) Priority Date :NA RESEARCH(33) Name of priority country :NA Address of Applicant :ANUSANDHAN BHAWAN,RAFI(86) International Application No :NA MARG, NEW DELHI-110 001, INDIA. Filing Date :NA (72)Name of Inventor :(87) International Publication No :NA 1)RAMACHANDRAN NAIR SREEKALA(61) Patent of Addition to Application Number :NA 2)KRISHNAMOORTHY MUTHUMANI Filing Date :NA 3)NAGASUBRAMANIAN GOPALAKRISHNAN(62) Divisional to Application Number :NA 4)KANNIAN IYER NAGESH Filing Date :NA 5)NARAYANAN LAKSHMANAN(57) Abstract :The present invention provides an earthquake protection device for bridges delivers stable hysteresis for wide range of earthquakeground motions with re centering characteristics by making use of specific non linear material properties and mechanical interaction ofconstituent components. This device can be used for existing or new structures and for retrofitting purposes. Non-re-centering andsupplementary re-centering devices can also be made on the basis of this device. This device with suitable modification can be used invibration control of non-structural elements.No. of Pages : 22 No. of Claims : 6 PATENT OFFICE JOURNAL 02/03/2012 3538
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2068/DEL/2010 A(19) INDIA(22) Date of filing of Application :31/08/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : A METHOD OF DYEING COTTON FABRIC USING NATURAL COLORANT FROM TOBACCO(51) International classification :A01K (71)Name of Applicant :(31) Priority Document No :NA 1)COUNCIL OF SCIENTIFIC & INDUSTRIAL(32) Priority Date :NA RESEARCH(33) Name of priority country :NA Address of Applicant :ANUSANDHAN BHAWAN, RAFI(86) International Application No :NA MARG, NEW DELHI-110 001, INDIA. Filing Date :NA (72)Name of Inventor :(87) International Publication No :NA 1)NEHA LALIT SHARMA(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The present invention relates to a method of dyeing cotton fabric using natural colorant from tobacco. The method describes dyeing ofmordanted cotton fabric in launder-o-metre using natural colorant extracted from chewing tobacco leaves at a concentration range of 1to 10%. The natural colorant extracted from tobacco leaves imparts requisite color strength, shade and fastness properties to the dyedcotton textiles. 17No. of Pages : 25 No. of Claims : 10 PATENT OFFICE JOURNAL 02/03/2012 3539
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2076/DEL/2010 A(19) INDIA(22) Date of filing of Application :01/09/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : FOLDING CRATES.(51) International classification :C08C (71)Name of Applicant :(31) Priority Document No :NA 1)MADAN MANOIHA(32) Priority Date :NA Address of Applicant :178-CL MODEL TOWN KARNAL(33) Name of priority country :NA Haryana India(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)DAVINDER KUMAR(87) International Publication No :NA(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :THIS INVENTION RELATES TO NEW INNOVATIVE PLASTIC OR WOODEN CRATE TO CARRY GOODS. THESE CRATESARE FOLDABLE AND IN A BID TO UTILISE THE SPACE OF GOODS CARRIERS, WHILE RETURNING BACK TO ITSDESTINATION. THESE FOLDABLE CRATES WOULD BE IN POSITION TO SAVE HUGE AMOUNT AND LABOUR SPENTON ACCOUNT OF ITS TRANSPORTATIONS ETC. THE USAGE OF SPACE WOULD BE REDUCED UP TO ONE/ FOUTH ORONE/FIFTH.No. of Pages : 10 No. of Claims : 8 PATENT OFFICE JOURNAL 02/03/2012 3540
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2090/DEL/2010 A(19) INDIA(22) Date of filing of Application :01/09/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : MUTANTS OF L-ASPARAGINASE(51) International classification :A01K (71)Name of Applicant :(31) Priority Document No :NA 1)INDIAN INSTITUTE OF TECHNOLOGY(32) Priority Date :NA Address of Applicant :INDIAN INSTITUTE OF(33) Name of priority country :NA TECHNOLOGY, HAUZ KHAS, NEW DELHI - 110016 India(86) International Application No :NA 2)DEPARTMENT OF BIOTECHNOLOGY Filing Date :NA (72)Name of Inventor :(87) International Publication No :NA 1)KUNDU, BISHWAJIT(61) Patent of Addition to Application Number :NA 2)BANSAL, SAURABH Filing Date :NA 3)MISHRA, PRASHANT(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The present invention relates to a novel and stable mutant of L-asparaginase and the process of preparing and isolating the same fromPyrococcus furiosus.No. of Pages : 39 No. of Claims : 24 PATENT OFFICE JOURNAL 02/03/2012 3541
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2252/DEL/2011 A(19) INDIA(22) Date of filing of Application :10/08/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : SWITCHGEAR(51) International classification :B41F (71)Name of Applicant : :2010- 1)HITACHI LTD.(31) Priority Document No 186091 Address of Applicant :6-6, MARUNOUCHI 1-CHOME,(32) Priority Date :23/08/2010 CHIYODA-KU, TOKYO 100-8280, Japan(33) Name of priority country :Japan (72)Name of Inventor :(86) International Application No :NA 1)KEIICHI TAKAHASHI Filing Date :NA 2)KENJI TSUCHIYA(87) International Publication No :NA 3)AYUMU MORITA(61) Patent of Addition to Application Number :NA 4)MASATO KOBAYASHI Filing Date :NA 5)DAISUKE SUGAI(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A switchgear includes a chassis which is partitioned by metal earthed plates and includes a bus bar section located at a central portion,a switch section located below the bus bar section, a cable section located at a rear surface side, and a control section located at a frontsurface side; an air-insulated earthed disconnecting switch provided in the switch section; and a manipulating device. The switchsection is separable from the chassis, and is configured as a case having a semi-closed structure which allows air to pass therethroughbut prevents particles of oil and water from passing therethrough.No. of Pages : 21 No. of Claims : 7 PATENT OFFICE JOURNAL 02/03/2012 3542
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2255/DEL/2011 A(19) INDIA(22) Date of filing of Application :10/08/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : HEAT SINK AND COOLING AND PACKAGING STACK FOR PRESS PACKAGES(51) International classification :B64D (71)Name of Applicant :(31) Priority Document No :12/861,181 1)GENERAL ELECTRIC COMPANY(32) Priority Date :23/08/2010 Address of Applicant :1 RIVER ROAD, SCHENECTADY,(33) Name of priority country :U.S.A. NEW YORK, 12345 U.S.A.(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)PAUTSCH ADAM GREGORY(87) International Publication No :NA 2)GUNTURI SATISH SIVARAMA(61) Patent of Addition to Application Number :NA 3)LAZATIN PATRICK JOSE Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A heat sink (10) is provided for directly cooling at least one electronic device package (20) having an upper contact surface (22) and alower contact surface (24). The heat sink comprises a cooling piece (16) formed of at least one thermally conductive material, wherethe cooling piece defines at least one inlet manifold (30) configured to receive a coolant and at least one outlet manifolds (32)configured to exhaust the coolant. The inlet and outlet manifolds are interleaved and are disposed in a spiral arrangement. The coolingpiece further defines a number of millichannels (34) disposed in a radial arrangement and configured to receive the coolant from theinlet manifolds (30) and to deliver the coolant to the outlet manifolds (32). The millichannels (34) and inlet and outlet manifolds (30,32) are further configured to directly cool one of the upper and lower contact surface (22, 24) of the electronic device package (20) bydirect contact with the coolant, such that the heat sink (10) comprises an integral heat sink (10). Fig 3.No. of Pages : 21 No. of Claims : 11 PATENT OFFICE JOURNAL 02/03/2012 3543
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2272/DEL/2011 A(19) INDIA(22) Date of filing of Application :11/08/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : CENTERING DEVICE AND SYSTEM FOR DRIVING RING(51) International classification :B27M (71)Name of Applicant :(31) Priority Document No :CO2010A000049 1)NUOVO PIGNONE S.P.A.(32) Priority Date :31/08/2010 Address of Applicant :VIA FELICE MATTEUCCI, 2, 50127(33) Name of priority country :Italy FLORENCE, Italy(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)SARRI FRANCO(87) International Publication No :NA 2)IURISCI GIUSEPPE(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A centering device includes a pivoting part configured to pivot around a first axis that extends along an axial direction of a holeformed in the pivoting part; a roller attached to a first end of the pivoting part and configured to rotate; a rod attached to a second endof the pivoting part and configured to move along a second axis; a spring mechanism enclosing a part of the rod and configured toapply a biasing force to the pivoting part; and a rod housing configured to receive an end of the rod and to allow the rod to freelymove through the rod housing.No. of Pages : 26 No. of Claims : 13 PATENT OFFICE JOURNAL 02/03/2012 3544
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2273/DEL/2011 A(19) INDIA(22) Date of filing of Application :11/08/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : METHOD AND APPARATUS FOR CONTROLLING WIND TURBINE ELECTRIC POWERGENERATION(51) International classification :B27M (71)Name of Applicant :(31) Priority Document No :12/869,522 1)GENERAL ELECTRIC COMPANY(32) Priority Date :26/08/2010 Address of Applicant :1 RIVER ROAD, SCHENECTADY,(33) Name of priority country :U.S.A. NEW YORK 12345 U.S.A.(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)TEICHMANN RALPH(87) International Publication No :NA 2)OBRIEN KATHLEEN ANN(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A wind turbine farm electrical control system (300/500) includes at least one wind turbine farm regulating device(315/316/318/320/322/515/516/518/ 326/526). The wind turbine farm electrical control system also includes at least one wind turbinefarm control input device (308). The wind turbine farm electrical control system further includes at least one processor (302/304/504)operatively coupled with the wind turbine farm regulating device and the wind turbine farm control input device. The processor isprogrammed with at least one algorithm representative of a relationship between at least one electric power grid tolerance range andan electric power generation rating. The at least one processor is further programmed to generate at least one wind turbine farmtolerance adjustment signal representative of a wind turbine farm tolerance range.No. of Pages : 34 No. of Claims : 12 PATENT OFFICE JOURNAL 02/03/2012 3545
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2299/DEL/2011 A(19) INDIA(22) Date of filing of Application :12/08/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : A SUPERSONIC COMPRESSOR ROTOR AND METHOD OF ASSEMBLING SAME(51) International classification :B60D (71)Name of Applicant :(31) Priority Document No :12/873,228 1)GENERAL ELECTRIC COMPANY(32) Priority Date :31/08/2010 Address of Applicant :1 RIVER ROAD, SCHENECTADY,(33) Name of priority country :U.S.A. NEW YORK 12345 U.S.A.(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)HOFER DOUGLAS CARL(87) International Publication No :NA 2)NAGEL ZACHARY WILLIAM(61) Patent of Addition to Application Number :NA 3)HOLMES DAVID GRAHAM Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A supersonic compressor rotor includes a rotor disk (48) comprising an upstream surface (60), a downstream surface (62), and aradially outer surface (58) that extends between the upstream surface and the downstream surface, the radially outer surface includingan inlet surface (148), an outlet surface (150), and a transition surface (152) extending between the inlet surface and the outlet surface,the rotor disk defining a centerline axis (54), a plurality of vanes (46) coupled to the radially outer surface, adjacent the vanes forminga pair and oriented such that a flow channel (86) is defined between each the pair of adjacent vanes, the flow channel extendingbetween an inlet opening and an outlet opening, the inlet surface defining an inlet plane (154) extending between the inlet opening andthe transition surface, the outlet surface defining an outlet plane (156) extending between the outlet opening and the transition surfacethat is not parallel to the inlet plane, and at least one supersonic compression ramp (110) positioned within the flow channel tofacilitate forming at least one compression wave (112) within the flow channel.No. of Pages : 39 No. of Claims : 12 PATENT OFFICE JOURNAL 02/03/2012 3546
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2301/DEL/2011 A(19) INDIA(22) Date of filing of Application :12/08/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : COMBUSTOR LINER CONCENTRIC SUPPORT AND METHOD(51) International classification :B41D (71)Name of Applicant :(31) Priority Document No :12/862,005 1)NUOVO PIGNONE S.P.A.(32) Priority Date :24/08/2010 Address of Applicant :VIA FELICE MATTEUCCI, 2, 50127(33) Name of priority country :U.S.A. FLORENCE, Italy(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)GHANIME GEORGE HANNA(87) International Publication No :NA(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :Systems and methods provide for reducing motion which causes wear in a combustor. The method includes attaching a first end of acombustor liner (404) to a retainer (402) which encircles the first end of the combustor liner (404); attaching the retainer (402) to acombustor casing (406), wherein the retainer (402) acts as a spring between the combustor liner (404) and the combustor casing (406);reducing a relative motion between the combustor casing (406) and the combustor liner (404) along a longitudinal axis and acircumferential axis of the combustor liner (404) by the retainer (402); and locating the combustor liner (404) substantiallyconcentrically within the combustor casing (406).No. of Pages : 28 No. of Claims : 18 PATENT OFFICE JOURNAL 02/03/2012 3547
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2302/DEL/2011 A(19) INDIA(22) Date of filing of Application :12/08/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : METHOD AND SYSTEM FOR VEHICLE THERMAL MANAGEMENT(51) International classification :B31C (71)Name of Applicant :(31) Priority Document No :12/870,947 1)GE AVIATION SYSTEMS LLC(32) Priority Date :30/08/2010 Address of Applicant :3290 PATTERSON AVENUE, NE(33) Name of priority country :U.S.A. GRAND RAPIDS, MICHIGAN 49512-1991, USA .(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)WEBER KENT I.(87) International Publication No :NA 2)KYRIAZOPOULOS ATHANASIOS(61) Patent of Addition to Application Number :NA 3)HIGHTOWER PETER C. Filing Date :NA 4)MILLER LANCE F.(62) Divisional to Application Number :NA 5)SOAVE RONALD J. Filing Date :NA(57) Abstract :A thermal management system (TMS) (200) includes an engine heat exchanger (304) configured to transfer waste heat from apropulsive engine (20) to a pumped heat transfer fluid, an engine exhaust heat exchanger (206) coupled in flow communication withthe engine heat exchanger, the engine exhaust heat exchanger configured to transfer heat from an exhaust of the propulsive engine tothe pumped heat transfer fluid, a bypass valve (208) coupled in parallel with the engine exhaust heat exchanger, the bypass valveselectable to modulate a flow of the pumped heat transfer fluid through the engine exhaust heat exchanger, and a plurality of accessoryheat exchangers for each of a plurality of heat loads of a vehicle coupled in flow communication with at least one of the engine heatexchanger and the engine exhaust heat exchanger, each the plurality of accessory heat exchangers flow controllable using amodulating valve.No. of Pages : 15 No. of Claims : 12 PATENT OFFICE JOURNAL 02/03/2012 3548
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2318/DEL/2011 A(19) INDIA(22) Date of filing of Application :16/08/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : IMAGING APPARATUS(51) International classification :B65G (71)Name of Applicant : :P2010- 1)SONY CORPORATION(31) Priority Document No 186572 Address of Applicant :1-7-1 KONAN, MINATO-KU,(32) Priority Date :23/08/2010 TOKYO, Japan(33) Name of priority country :Japan (72)Name of Inventor :(86) International Application No :NA 1)MASAYUKI YOSHII Filing Date :NA 2)TAKUYA HARA(87) International Publication No :NA 3)NOBUHISA KOIKE(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :An imaging apparatus includes an apparatus body having an outer casing, at least a shutter mechanism and an imaging device placedinside the outer casing, an opening formed in the outer casing, and a storage space and a placement space defined inside the outercasing and communicating with the opening and the storage space, respectively, a strobe unit having a lid part and a light-emitting partand connected to the apparatus body so as to be movable between close and open positions, a sensor unit placed in the placementspace and having an autofocus sensor and a sensor adjusting part having plural adjusting screws, and a mirror placed inside the outercasing to reflect part of incident light toward the autofocus sensor. When the strobe unit is moved to the open position, the storagespace is defined as an adjustment space into which an adjustment jig can be inserted.No. of Pages : 42 No. of Claims : 6 PATENT OFFICE JOURNAL 02/03/2012 3549
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2328/DEL/2011 A(19) INDIA(22) Date of filing of Application :16/08/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : PRINT HEAD, PRINTER AND CONTROL METHOD OF PRINTER(51) International classification :B41B (71)Name of Applicant : :2010- 1)SEIKO EPSON CORPORATION(31) Priority Document No 182125 Address of Applicant :4-1, NISHISHINJUKU 2 - CHOME,(32) Priority Date :17/08/2010 SHINJUKU-KU, TOKYO 163 - 0811, Japan(33) Name of priority country :Japan (72)Name of Inventor :(86) International Application No :NA 1)YAMADA, RIKUO Filing Date :NA(87) International Publication No :NA(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A printer is provided. A platen roller is configured to transport a recording medium. A print head has a head body portion having aprinting portion which performs printing on a recording medium and facing the platen roller. An urging unit urges the print headtoward the platen roller. A supporting mechanism supports the print head, presses the print head against the platen roller and allowsthe platen roller to move the head body portion in such a direction that a contact position of the head body portion with respect to theplaten roller is shifted while maintaining the head body portion pressed against the platen roller.No. of Pages : 23 No. of Claims : 8 PATENT OFFICE JOURNAL 02/03/2012 3550
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2341/DEL/2011 A(19) INDIA(22) Date of filing of Application :17/08/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : SWITCH OPERATING DEVICE AND CLOSURE SPRING ADJUSTMENT METHOD THEREOF(51) International classification :B41D (71)Name of Applicant : :2010- 1)KABUSHIKI KAISHA TOSHIBA(31) Priority Document No 186235 Address of Applicant :1-1, SHIBAURA 1-CHOME,(32) Priority Date :23/08/2010 MINATO-KU, TOKYO, Japan(33) Name of priority country :Japan (72)Name of Inventor :(86) International Application No :NA 1)OHDA YOSHIAKI Filing Date :NA 2)KOBAYASHI YOSHIKATA(87) International Publication No :NA 3)SHIMIZU MASAHARU(61) Patent of Addition to Application Number :NA 4)MARUSHIMA SATOSHI Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The spring seat supporting body (3) is arranged at the rear face of the spring seat (5) that is arranged at the end face of a closure spring(4). A jack bolt screw hole is provided through this spring seat supporting body (3). By screwing a jack bolt (10) into this screw hole,the spring seat (5) and closure spring (4) are pressed down and a gap (16) is created between the spring seat supporting body (3) andthe spring seat (5) . A spring force adjustment spacer (7) is inserted into this gap (16), thereby changing the used height of the springand thus adjusting the spring force.No. of Pages : 29 No. of Claims : 6 PATENT OFFICE JOURNAL 02/03/2012 3551
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2339/DEL/2011 A(19) INDIA(22) Date of filing of Application :17/08/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : TURBOMACHINE ACTUATION SYSTEM AND METHOD(51) International classification :B41C (71)Name of Applicant :(31) Priority Document No :CO2010A000050 1)NUOVO PIGNONE S.p.A.(32) Priority Date :31/08/2010 Address of Applicant :VIA FELICE MATTEUCCI, 2, 50127(33) Name of priority country :Italy FLORENCE, Italy(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)SARRI FRANCO(87) International Publication No :NA 2)PELELLA MARCO(61) Patent of Addition to Application Number :NA 3)IURISCI GIUSEPPE Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :An actuation system includes a driving ring configured to rotate and having a groove on an internal face facing a central point of thedriving ring; at least a linkage attached with a first end to an inside of the groove; and at least a lever arm attached to a second end ofthe at least a linkage. At least a portion of the at least a linkage stays inside the groove when the driving ring rotates.No. of Pages : 28 No. of Claims : 13 PATENT OFFICE JOURNAL 02/03/2012 3552
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2342/DEL/2011 A(19) INDIA(22) Date of filing of Application :17/08/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : SEGMENTED STATOR ASSEMBLY(51) International classification :B41C (71)Name of Applicant :(31) Priority Document No :12/871,351 1)GENERAL ELECTRIC COMPANY(32) Priority Date :30/08/2010 Address of Applicant :1 RIVER ROAD, SCHENECTADY,(33) Name of priority country :U.S.A. NEW YORK 12345 USA. .(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)LOKHANDWALLA MURTUZA(87) International Publication No :NA 2)ZIRIN ROBERT MICHAEL(61) Patent of Addition to Application Number :NA 3)DAWSON RICHARD NILS Filing Date :NA 4)HARAN KIRUBA SIVASUBRAMANIAM(62) Divisional to Application Number :NA 5)DeBLOCK MARK JOHN Filing Date :NA 6)LONGTIN RANDY SCOTT(57) Abstract :An electric machine and a stator assembly include a segmented stator having stator portions. Each stator portion includes end platesarranged axially on opposing sides of the stator portion, support plates arranged interior to the end plates, stator laminations arrangedbetween the support plates, and stabilizing elements coupling the end plates and the support plates together. Each of the stabilizingelements has a dovetail portion coupled to the end plates and to the support plates. Connectors are provided to connect the statorportions of the segmented stator together.No. of Pages : 30 No. of Claims : 9 PATENT OFFICE JOURNAL 02/03/2012 3553
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2343/DEL/2011 A(19) INDIA(22) Date of filing of Application :17/08/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : SEGMENTED STATOR ASSEMBLY (71)Name of Applicant :(51) International classification :B41D 1)GENERAL ELECTRIC COMPANY(31) Priority Document No :12/871,276 Address of Applicant :1 RIVER ROAD, SCHENECTADY,(32) Priority Date :30/08/2010 NEW YORK 12345 U.S.A.(33) Name of priority country :U.S.A. (72)Name of Inventor :(86) International Application No :NA 1)HARAN KIRUBA SIVASUBRAMANIAM Filing Date :NA 2)ALEXANDER JAMES PELLEGRINO(87) International Publication No :NA 3)CAO JAY ZHIQIANG(61) Patent of Addition to Application Number :NA 4)LASKARIS EVANGELOS TRIFON Filing Date :NA 5)VAN DAM JEREMY DANIEL(62) Divisional to Application Number :NA 6)LOKHANDWALLA MURTUZA Filing Date :NA 7)ZIRIN ROBERT MICHAEL(57) Abstract :An electric machine and stator assembly includes a segmented stator having stator portions. Each stator portion includes statorlaminations, end plates arranged axially on opposing sides of the stator portion, and structural plates arranged interior to the endplates. Each of the support plates has a portion with notch-like structures that is embedded within the stator laminations. Stabilizingcouple the end plates and the structural plates together. Connectors are provided to connect the stator portions together.No. of Pages : 29 No. of Claims : 11 PATENT OFFICE JOURNAL 02/03/2012 3554
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2349/DEL/2011 A(19) INDIA(22) Date of filing of Application :18/08/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : SYSTEMS AND METHODS FOR RAPID UPDATING OF EMBEDDED TEXT IN RADAR PICTUREDATA(51) International classification :G01B (71)Name of Applicant :(31) Priority Document No :12/862586 1)HONEYWELL INTERNATIONAL INC.(32) Priority Date :24/08/2010 Address of Applicant :101 COLUMBIA ROAD, P. O. BOX(33) Name of priority country :U.S.A. 2245, MORRISTOWN, NEW JERSEY 07962-2245, UNITED(86) International Application No :NA STATES OF AMERICA Filing Date :NA (72)Name of Inventor :(87) International Publication No :NA 1)BRIAN P. BUNCH(61) Patent of Addition to Application Number :NA 2)RODNEY ROWEN Filing Date :NA 3)BRENNAN KILTY(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :Systems and methods for efficiently updating text or symbol annunciations outputted by an avionics system (42) on legacy displays(44). Instead of using a set sweeping pattern to update the display, a smart updating concept is used. The smart updating conceptsenses when the pilot is adjusting the selected altitude control (or other user interface device (48) that will alter displayedannunciations), then gives priority to updating the radial lines on the display that contain the annunciation field. Once the annunciationfield has been updated, the display returns to normal operation.No. of Pages : 23 No. of Claims : 9 PATENT OFFICE JOURNAL 02/03/2012 3555
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2344/DEL/2011 A(19) INDIA(22) Date of filing of Application :17/08/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : LIGHTNING PROTECTION FOR WIND TURBINES(51) International classification :B26B (71)Name of Applicant :(31) Priority Document No :12/872,198 1)GENERAL ELECTRIC COMPANY(32) Priority Date :31/08/2010 Address of Applicant :1 RIVER ROAD, SCHENECTADY,(33) Name of priority country :U.S.A. NEW YORK 12345 U.S.A.(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)HARDISON RICHARD ALLEN(87) International Publication No :NA 2)OLSON STEVEN HAINES(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A rotor blade (28) for a wind turbine (100) is provided. The rotor blade (28) includes a rotor blade body (28), at least one receptor(410) adapted to be a location for lightning impact, and at least one down conductor (300) connected to the receptor and located withinthe rotor blade body. The down conductor (300) includes a first conductor (310) connected to the receptor and a ground connection ofthe wind turbine, and a second insulated conductor (320) connected to the receptor and a non-grounded location of the wind turbine. Apath is formed from the ground connection of the first conductor to the non-grounded location of the second insulated conductor. Thispath facilitates a continuity test used to evaluate a condition of the lightning protection system.No. of Pages : 26 No. of Claims : 13 PATENT OFFICE JOURNAL 02/03/2012 3556
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2350/DEL/2011 A(19) INDIA(22) Date of filing of Application :18/08/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : INFORMATION PROCESSING APPARATUS, INFORMATION PROCESSING METHOD, ANDCOMPUTER PROGRAM PRODUCT(51) International classification :G06C (71)Name of Applicant : :P2010- 1)SONY CORPORATION(31) Priority Document No 188126 Address of Applicant :1-7-1 KONAN, MINATO-KU,(32) Priority Date :25/08/2010 TOKYO, Japan(33) Name of priority country :Japan (72)Name of Inventor :(86) International Application No :NA 1)YUSUKE MIYAZAWA Filing Date :NA 2)IKUO YAMANO(87) International Publication No :NA(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :An information processing apparatus detects an interaction area of a position detection surface specified by a manipulation object. Afocused target extraction unit that extracts at least some of a plurality of focused targets on the basis of the interaction area. A selectioncandidate extraction unit extracts a selection candidate from the plurality of focused targets, and a display displays at least some of theplurality of focused targets, and emphasizes the selection candidate. Furthermore, a method and non-transitory computer readablestorage device cooperate to provide a corresponding process.No. of Pages : 50 No. of Claims : 20 PATENT OFFICE JOURNAL 02/03/2012 3557
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2345/DEL/2011 A(19) INDIA(22) Date of filing of Application :17/08/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : SEGMENTED STATOR ASSEMBLY(51) International classification :B41C (71)Name of Applicant :(31) Priority Document No :12/871,276 1)GENERAL ELECTRIC COMPANY(32) Priority Date :30/08/2010 Address of Applicant :1 RIVER ROAD, SCHENECTADY,(33) Name of priority country :U.S.A. NEW YORK, 12345 U.S.A.(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)ZIRIN ROBERT MICHAEL(87) International Publication No :NA 2)LOKHANDWALLA MURTUZA(61) Patent of Addition to Application Number :NA 3)HARAN KIRUBA SIVASUBRAMANIAM Filing Date :NA 4)DAWSON RICHARD NILS(62) Divisional to Application Number :NA 5)DEBLOCK MARK JOHN Filing Date :NA(57) Abstract :A stator assembly (114) includes a segmented stator having stator portions (116). Each stator portion (116) includes a supportstructure (507) and dovetails (504), each coupled to the support structure (507) by adjustable elements (506). The stator portion (116)also includes stator laminations (234), where each of the laminations (234) has openings (235) to engage with the dovetails (504).Connectors (505) are provided to connect the stator portions (116) of the segmented stator together.No. of Pages : 44 No. of Claims : 10 PATENT OFFICE JOURNAL 02/03/2012 3558
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2346/DEL/2011 A(19) INDIA(22) Date of filing of Application :17/08/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : BLOW MOLD(51) International classification :B41D (71)Name of Applicant : :10 2010 1)KRONES AG(31) Priority Document No 039 803.9 Address of Applicant :BOHMERWALDSTRASSE 5, 93073(32) Priority Date :26/08/2010 NEUTRAUBLING, GERMANY(33) Name of priority country :Germany (72)Name of Inventor :(86) International Application No :NA 1)STOIBER, CHRISTIAN Filing Date :NA(87) International Publication No :NA(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :In a blow mold (F) with a stationary mold half (1) and another mold half (2) movable relative to the stationary mold half (1) betweenclosed and open positions, a bottom mold (7) comprising a bottom mold axis (X) essentially perpendicular to the moving direction ofthe other mold half (2) which can be moved relative to the mold halves (1, 2) between an engaged position and a removal position, andwhich can be at least positively locked with the mold halves (1, 2) in the engaged position and the closed position of the other moldhalf (2) by at least one collar-like engaging element (E) at the bottom mold (7), and a ring groove-like counterengagement structure(G) in the mold halves (1, 2), the engaging element (E) and at least the counterengagement structure (G) form a bayonet catch (B) inthe stationary mold half (1) which can be actuated by relative rotary motions of the engaging element (E) about the bottom mold axis(X) and only linear relative movements in the direction of the bottom mold axis (X).No. of Pages : 18 No. of Claims : 10 PATENT OFFICE JOURNAL 02/03/2012 3559
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2368/DEL/2011 A(19) INDIA(22) Date of filing of Application :19/08/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : AIR CONDITIONING SYSTEM(51) International classification :B60F (71)Name of Applicant : :2010- 1)HITACHI APPLIANCES, INC.(31) Priority Document No 188477 Address of Applicant :16-1, KAIGAN 1-CHOME, MINATO-(32) Priority Date :25/08/2010 KU, TOKYO, Japan(33) Name of priority country :Japan (72)Name of Inventor :(86) International Application No :NA 1)NAGAMATSU SHINICHIRO Filing Date :NA 2)TEZUKA JUNICHIRO(87) International Publication No :NA 3)KAWAGUCHI HIROYUKI(61) Patent of Addition to Application Number :NA 4)IWASHINA YOSHINORI Filing Date :NA 5)WATANABE MASAYOSHI(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :An air conditioning system (100) has a heat source side unit (12), multiple use side units (16), a high pressure gas pipe (28), a lowpressure gas pipe (29), a liquid pipe (30), and a controller (36) to connect the heat source side unit (12) and the use side unit (16) via atransmission line and control them. In the controller (36), a control program A in the case where the use side unit (16) is connected,and a control program B in the case where a hot water supply unit (27) is connected in addition to the use side unit (16) arestored. The hot water supply unit (27) is connected to the liquid pipe (30) and the high pressure gas pipe (28) to connect the heatsource side unit (12) and the use side unit (16), and the hot water supply unit (27) is connected to the transmission line. As a result,the controller (36) recognizes the connection to the hot water supply unit (27), and controls the heat source side unit (12), the use sideunit (16), and the hot water supply unit (27) according to the control program B.No. of Pages : 34 No. of Claims : 9 PATENT OFFICE JOURNAL 02/03/2012 3560
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2379/DEL/2011 A(19) INDIA(22) Date of filing of Application :23/08/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : RECIPROCATING COMPRESSOR CRANKSHAFT ADAPTER AND METHOD(51) International classification :B41B (71)Name of Applicant :(31) Priority Document No :12/872,194 1)NUOVO PIGNONE S.p.A.(32) Priority Date :31/08/2010 Address of Applicant :VIA FELICE MATTEUCCI, 2, 50127(33) Name of priority country :U.S.A. FLORENCE, Italy(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)DO VINH(87) International Publication No :NA 2)RAYNAL JEFFREY(61) Patent of Addition to Application Number :NA 3)HELTON JASON ANDREW Filing Date :NA 4)TREVINO CARLOS ALFREDO(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :Method and device for lubricating a connection. A housing (80) is configured to house a crankshaft adapter (48) that connects an oilpump (32) to a compressor (30). The housing (80) includes a shell (91) forming a round cavity (86) configured to receive thecrankshaft adapter (48); an oil feed conduit (82) configured to enter through the shell (91) into the round cavity (86) and to deliver oil;a first drain conduit (88), opposite to the oil feed conduit, and configured to enter through the shell (91) into the round cavity (86) andto drain the oil from the round cavity (86); a plug (90) provided in the first drain conduit (88) to reduce an amount of oil drained awayfrom the round cavity (86); and a second drain conduit (96) configured to enter through the shell (91) into the round cavity (86) and todrain away oil from the round cavity (86). The second drain conduit (96) is located between the oil feed conduit (82) and the firstdrain conduit (88), substantially between 50 and 130 degrees relative to the first drain conduit (88) on a periphery of the shell (91).No. of Pages : 27 No. of Claims : 17 PATENT OFFICE JOURNAL 02/03/2012 3561
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2380/DEL/2011 A(19) INDIA(22) Date of filing of Application :23/08/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : SEMICONDUCTOR DEVICE AND METHOD OF DRIVING SEMICONDUCTOR DEVICE(51) International classification :G01B (71)Name of Applicant : :2010- 1)SEMICONDUCTOR ENERGY LABORATORY CO.,(31) Priority Document No 190591 LTD.(32) Priority Date :27/08/2010 Address of Applicant :398 HASE, ATSUGI-SHI,(33) Name of priority country :Japan KANAGAWA-KEN 243-0036 JAPAN.(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)TAKEWAKI YOSHIYA(87) International Publication No :NA 2)SHIONOIRI YUTAKA(61) Patent of Addition to Application Number :NA 3)KAMATA KOICHIRO Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :An object of the invention is to reduce the power consumption of a semiconductor device that requires a plurality of referencepotentials and a method of driving the semiconductor device. Disclosed is a semiconductor device having a potential divider circuit inwhich a potential supplied to a power supply line is resistively divided by resistors connected in series to the power supply line so thata desired potential is output through a switch transistor electrically connected to the power supply line. A drain terminal of the switchtransistor is electrically connected to a gate terminal of a transistor provided in a circuit on the output side (or to one terminal of acapacitor) to form a node. The switch transistor has an off current low enough to hold the desired voltage in the node even when thepotential is no more supplied to the power supply line.No. of Pages : 85 No. of Claims : 27 PATENT OFFICE JOURNAL 02/03/2012 3562
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2382/DEL/2011 A(19) INDIA(22) Date of filing of Application :23/08/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : TURBOMACHINE WITH MIXED-FLOW STAGE AND METHOD(51) International classification :A61C (71)Name of Applicant :(31) Priority Document No :CO2010A000047 1)NUOVO PIGNONE S.p.A.(32) Priority Date :31/08/2010 Address of Applicant :VIA FELICE MATTEUCCI 2, 50127(33) Name of priority country :Italy FLORENCE, ITALY.(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)LORENZO BERGAMINI(87) International Publication No :NA 2)VITTORIO MICHELASSI(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :Method and turbomachine for imparting energy to a multiphase fluid. The turbomachine includes a casing having an inlet and anoutlet; an axial stage part including at least one axial stage; a mixed-flow stage part including at least one mixed-flow stage fluidlyconnected to the axial stage part; and a centrifugal stage part including at least one centrifugal stage fluidly connected to the mixed-flow stage part. The axial stage is defined by an angle between an axial impeller outlet flow and an axis parallel to a rotational axis ofthe shaft having a value between 0° and 5°, the mixed-flow stage by an angle having a value between 5° and 80°, and the centrifugalstage by an angle having a value between 80° and 90°. Fig.8No. of Pages : 26 No. of Claims : 12 PATENT OFFICE JOURNAL 02/03/2012 3563
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2383/DEL/2011 A(19) INDIA(22) Date of filing of Application :23/08/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : ELECTRONIC DEVICE, MANUFACTURING METHOD OF ELECTRONIC DEVICE, ANDSPUTTERING TARGET(51) International classification :A61N (71)Name of Applicant : :2010- 1)SEMICONDUCTOR ENERGY LABORATORY CO.,(31) Priority Document No 187873 LTD.(32) Priority Date :25/08/2010 Address of Applicant :398 HASE, ATSUGI-SHI,(33) Name of priority country :Japan KANAGAWA-KEN 243-0036 JAPAN.(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)YAMAZAKI SHUNPEI(87) International Publication No :NA(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A film formation is performed using a target in which a material which is volatilized more easily than gallium when heated at 400 °Cto 700 °C, such as zinc, is added to gallium oxide by a sputtering method with high mass-productivity which can be applied to a large-area substrate, such as a DC sputtering method or a pulsed DC sputtering method. This film is heated at 400 °C to 700 °C, wherebythe added material is segregated in the vicinity of a surface of the film. Another portion of the film has a decreased concentration ofthe added material and a sufficiently high insulating property; therefore, it can be used for a gate insulator of a semiconductor device,or the like.No. of Pages : 60 No. of Claims : 37 PATENT OFFICE JOURNAL 02/03/2012 3564
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2387/DEL/2011 A(19) INDIA(22) Date of filing of Application :23/08/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : ZOOM LENS, OPTICAL APPARATUS AND ZOOM LENS MANUFACTURING METHOD(51) International classification :G01K (71)Name of Applicant : :2010- 1)NIKON CORPORATION(31) Priority Document No 194998 Address of Applicant :12-1, YURAKUCHO 1-CHOME(32) Priority Date :31/08/2010 CHIYODA-KU, TOKYO 100-8331 Japan(33) Name of priority country :Japan (72)Name of Inventor :(86) International Application No :NA 1)MASUGI, SABURO Filing Date :NA(87) International Publication No :NA(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A zoom lens includes, in order front an object, a first lens group G1 having negative refractive power; a second lens group G2 havingpositive refractive power; and a third lens group G3 having positive refractive power. The first lens group G1 comprises only onenegative spherical lens (lens L11) and one plastic positive lens (lens L12) separated by an air gap. The second lens group G2comprises three or fewer lenses, including a positive lens component (cemented lens comprising a lens L21 and a lens L22) , and oneplastic negative lens (lens L23) . The following conditional expressions are satisfied: 0.50 < f1PL/(-f2PL) < 2.50 and 0.80 < (-f 1)/f2 <1.35, where f1PL is a focal length of the plastic positive lens forming the first lens group G1, f2PL is the focal length of the plasticnegative lens forming the second lens group G2, f 1 is the focal length of the first lens group G1, and f2 is the focal length of thesecond lens group G2.No. of Pages : 60 No. of Claims : 18 PATENT OFFICE JOURNAL 02/03/2012 3565
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2396/DEL/2011 A(19) INDIA(22) Date of filing of Application :24/08/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : IMAGE ADJUSTMENT(51) International classification :G01B (71)Name of Applicant :(31) Priority Document No :1014409.5 1)SONY CORPORATION(32) Priority Date :31/08/2010 Address of Applicant :1-7-1 KONAN, MINATO-KU 108-(33) Name of priority country :U.K. 0075, TOKYO, Japan(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)KATSUAKIRA MORIWAKE(87) International Publication No :NA(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :An image adjustment apparatus for processing images output by two image capturing devices arranged with respect to one another soas to capture images representing different respective views of a scene comprises a noise combiner for combining a noise signal withone or both of a pair of corresponding images captured by the two image capturing devices; a difference detector for detectingdifferences in colour properties between the pair of corresponding images output by the noise combiner; and a colour property adjusterfor adjusting colour properties of images from at least one of the image capturing devices on the basis of the differences detected bythe difference detector, so as to reduce the differences in colour properties between corresponding images captured by the two imagecapturing devices. (Figure 2)No. of Pages : 20 No. of Claims : 19 PATENT OFFICE JOURNAL 02/03/2012 3566
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2398/DEL/2011 A(19) INDIA(22) Date of filing of Application :24/08/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : ROLLING CONTROL APPARATUS, ROLLING CONTROL METHOD AND ROLLING CONTROLPROGRAM(51) International classification :B60G (71)Name of Applicant : :2010- 1)HITACHI, LTD.(31) Priority Document No 188622 Address of Applicant :6-6, MARUNOUCHI 1-CHOME,(32) Priority Date :25/08/2010 CHIYODA-KU, TOKYO Japan(33) Name of priority country :Japan (72)Name of Inventor :(86) International Application No :NA 1)SUZUKI KAZUFUMI Filing Date :NA 2)FUKUCHI YUTAKA(87) International Publication No :NA 3)HATTORI SATOSHI(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A rolling control apparatus for controlling rolling mills (2, 3) which roll material to be rolled, includes a control actuator changepattern storage unit (102) for storing time-sequential change patterns previously generated in order to change the roll gaps and rollspeeds of the rolling mills (2, 3) in accordance with the non-linear changes in rolling conditions; and an optimal control actuator time-sequential change pattern setting unit (103) for recognizing that the rolling conditions change non-linearly, acquiring time-sequentialchange patterns corresponding to the non-linear changes in the thus recognized rolling conditions, and outputting the thus acquiredtime-sequential change patterns to control parameters for the rolling conditions.No. of Pages : 55 No. of Claims : 19 PATENT OFFICE JOURNAL 02/03/2012 3567
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1229/MUMNP/2011 A(19) INDIA(22) Date of filing of Application :15/06/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : METHOD FOR REGULATING THE TEMPERATURE OF A HOT ISOSTATIC PRESS AND A HOTISOSTATIC PRESS(51) International classification :B30B 11/00 (71)Name of Applicant :(31) Priority Document No :10 2008 058 329.4 1)DIEFFENBACHER GMBH + CO. KG(32) Priority Date :23/11/2008 Address of Applicant :Heilbronner Strae 20 75031 Eppingen(33) Name of priority country :Germany Germany(86) International Application No :PCT/EP2009/008331 (72)Name of Inventor : Filing Date :23/11/2009 1)GRAF Matthias(87) International Publication No :WO/2010/057670(61) Patent of Addition to Application :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The invention relates to a method for regulating the temperature of a hot isostatic press and to a hot isostatic press, comprising apressure container (1) having an interior horizontal loading space (19) and insulation (8) arranged in between, wherein heatingelements (4) and a loading space (19) having a load (18) are arranged inside the insulation (8), wherein at least one rotational flow(23) is developed actively or passively inside the pressure container (1), in addition to at least one existing natural or activatedconvection flow for heating or cooling or for maintaining a temperature level. An independent hot isostatic press or one suitable forsaid method is characterized in that active and/or passive means for developing a rotational flow (23), occurring substantially at anangle to the convection flow, are arranged in the pressure container (1).No. of Pages : 26 No. of Claims : 13 PATENT OFFICE JOURNAL 02/03/2012 3568
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1226/MUMNP/2011 A(19) INDIA(22) Date of filing of Application :15/06/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : METHOD FOR REGULATING THE TEMPERATURE OF A HOT ISOSTATIC PRESS, AND HOTISOSTATIC PRESS :B30B 11/02,F27B (71)Name of Applicant :(51) International classification 5/16 1)DIEFFENBACHER GMBH + CO. KG(31) Priority Document No :10 2008 058 330.8 Address of Applicant :Heilbronner Strae 20 75031 Eppingen(32) Priority Date :23/11/2008 Germany(33) Name of priority country :Germany (72)Name of Inventor :(86) International Application No :PCT/EP2009/008329 1)GRAF Matthias Filing Date :23/11/2009(87) International Publication No :WO/2010/057668(61) Patent of Addition to Application :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The invention relates to a method for regulating the temperature of a hot isostatic press and to a hot isostatic press, consisting of apressure vessel (1) having an interior loading space (19) and insulation (8) arranged in between, wherein heating elements (4) and aloading space (19) having a load (18) are arranged inside the insulation (8), wherein at least the loading space (19) is surrounded by aconvection sleeve (27) to form a convection gap (28). Fluid is sprayed through at least one nozzle (13) in the interior of the pressurevessel (1) and/or the loading space (19) to generate a rotational flow (23) so that said fluid mixes with the fluid held therein, and saidfluid simultaneously forms a circulation (29) around the convection sleeve (27) and enters the loading space (19) via the convectiongap (28).No. of Pages : 22 No. of Claims : 16 PATENT OFFICE JOURNAL 02/03/2012 3569
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1316/MUMNP/2011 A(19) INDIA(22) Date of filing of Application :24/06/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : AN ARRANGEMENT ADAPTED TO BE USED WITH CONVENTIONAL BILLIARD TABLES FORGREATER UTILISATION,VERSATILITY AND/OR APPLICATION OF SAID TABLES :A63D 15/00 ,G06F (71)Name of Applicant :(51) International classification 19/00 1)PENNA , THOMAS , DAVID(31) Priority Document No :2008906432 Address of Applicant :28 LEWORTHY STREET ,VICTOR(32) Priority Date :30/01/2009 HARBOR,S.A.5211, AUSTRALIA(33) Name of priority country :Australia 2)GRANT , STEPHEN , JOHN(86) International Application No :PCT/AU2009/001640 (72)Name of Inventor : Filing Date :16/12/2009 1)PENNA , THOMAS , DAVID(87) International Publication No :WO/2010/068989 2)GRANT , STEPHEN , JOHN(61) Patent of Addition to Application :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :An arrangement adapted to be used with conventional billiard tables for greater utilisation, versatility and/or application of said tables,said arrangement including, a multiplicity of billiard tables located at a variety of separate locations, a means to register and allow forcommunication between a plurality of players, such that said players need not necessarily play upon the same table nor be located atthe one location, said players intended to compete against other registered players, or approve upon personal individual skill level, atimer such that competition between players or improvement of personal standings of an individual is based upon timing of pocketinga set of balls or part thereof upon the respective billiard table by said timer, a means for having time results of the or each playertransferred to a central database wherein individual players times and standings may then be acknowledged.No. of Pages : 37 No. of Claims : 25 PATENT OFFICE JOURNAL 02/03/2012 3570
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1366/MUMNP/2011 A(19) INDIA(22) Date of filing of Application :30/06/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : MOBILE STUDIIO :G03B 15/00,A63J (71)Name of Applicant :(51) International classification 5/02 1)MUSION IP LIMITED(31) Priority Document No :0821996.6 Address of Applicant :WESTCOTT HOUSE 35 PORTLAND(32) Priority Date :02/12/2008 PLACE LONDON GREAT BRITAIN(33) Name of priority country :GB (72)Name of Inventor :(86) International Application No :PCT/GB2009/051625 1)OCONNELL, IAN, CHRISTOPHER Filing Date :01/12/2009(87) International Publication No :WO/2010/064033(61) Patent of Addition to Application :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A mobile studio for producing video and audio content, the mobile studio comprising :a vehicle comprising a body mounted on achassis, said body having a studio chamber enclosure formed by a floor, a ceiling, spaced opposite outer side walls and spaced outerfront and rear walls, wherein the floor of the studio chamber comprises a stage area;at least one LED lighting assembly located in thestudio chamber suitable for providing sufficient illumination for image capture such that the captured image is suitable for projectionas a Peppers Ghost image;at least one camera to capture the image of a subject on the stage area; and a communications device totransmit the captured image.No. of Pages : 32 No. of Claims : 24 PATENT OFFICE JOURNAL 02/03/2012 3571
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1448/MUMNP/2011 A(19) INDIA(22) Date of filing of Application :11/07/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : SYSTEM AND METHOD FOR TRAPEZIUM BONE REPLACEMENT(51) International classification :A61F 2/42 (71)Name of Applicant :(31) Priority Document No :12/319,438 1)Extremity Medical LLC(32) Priority Date :07/01/2009 Address of Applicant :300 Interpace Parkway Suite 410(33) Name of priority country :U.S.A. Parsippany NJ 07054 UNITED STATES OF AMERICA(86) International Application No :PCT/US2010/000052 (72)Name of Inventor : Filing Date :07/01/2010 1)GANNOE Jamy(87) International Publication No :WO/2010/080714 2)ARELLANO Luis(61) Patent of Addition to Application :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A carpometacarpal joint replacement system for replacing the trapezium bone in the hand is provided. The system includes a trapezialimplant for the carpometacarpal joint resulting in replacement of the carpal trapezium bone with a prosthesis having the sameanatomical configuration as the trapezium bone. The implant device comprises a plurality of concave surfaces, with the plurality ofconcave surfaces articulating with the carpal and metacarpal bones.No. of Pages : 59 No. of Claims : 18 PATENT OFFICE JOURNAL 02/03/2012 3572
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1470/MUMNP/2011 A(19) INDIA(22) Date of filing of Application :13/07/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : SYSTEM AND METHOD FOR IDENTIFYING MULTIPLE TYPES OF ELECTRONIC MONEY, ANDAPPARATUS APPLIED THERETO(51) International classification :G06Q 20/00 (71)Name of Applicant :(31) Priority Document No :10-2009-0050673 1)SK TELECOM CO. LTD.(32) riority Date :08/06/2009 Address of Applicant :11 Euljiro 2-ga Jung-gu Seoul 100-(33) Name of priority country :Republic of Korea 844 Republic of Korea(86) International Application No :PCT/KR2010/003126 (72)Name of Inventor : Filing Date :18/05/2010 1)KIM Jong Ho(87) International Publication No :WO/2010/143822(61) Patent of Addition to Application :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The present disclosure relates to a system and method for identifying multiple types of electronic money, and an apparatus employingthe same. The system for identifying multiple types of electronic money includes an electronic money terminal apparatus capable ofidentifying various types of electronic money and providing an electronic money service, including charging, payment, and transfer ofelectronic money.No. of Pages : 38 No. of Claims : 19 PATENT OFFICE JOURNAL 02/03/2012 3573
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1469/MUMNP/2011 A(19) INDIA(22) Date of filing of Application :13/07/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : ELECTRONIC MONEY PAYMENT SYSTEM AND ELECTRONIC MONEY PAYMENT METHOD(51) International classification :G06Q 20/00 (71)Name of Applicant :(31) Priority Document No :10-2009-0050956 1)SK TELECOM CO. LTD.(32) Priority Date :09/06/2009 Address of Applicant :11 Euljiro 2-ga Jung-gu Seoul 100-(33) Name of priority country :Republic of Korea 844 Republic of Korea(86) International Application No :PCT/KR2010/003127 (72)Name of Inventor : Filing Da e :18/05/2010 1)Kim JongHo(87) International Publication No :WO/2010/143823(61) Patent of Addition to Application :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The present disclosure relates to electronic money payment system and method which allows payment to be processed not only with apayment amount according to the currency of a user™s electronic money but also with a payment amount according to any currencyadvantageous for payment among various payment amounts according to various types of currencies which are different from that ofthe user™s electronic money, in consideration of the exchange rates.No. of Pages : 54 No. of Claims : 18 PATENT OFFICE JOURNAL 02/03/2012 3574
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1471/MUMNP/2011 A(19) INDIA(22) Date of filing of Application :13/07/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : SYSTEM FOR SENDING ELECTRONIC MONEY AND METHOD FOR SENDING ELECTRONICMONEY(51) International classification :G06Q 40/00 (71)Name of Applicant :(31) Priority Document No :10-2009-0049372 1)SK TELECOM CO. LTD.(32) Priority Date :04/06/2009 Address of Applicant :11 Euljiro 2-ga Jung-gu Seoul 100-(33) Name of priority country :Republic of Korea 844 Republic of Korea(86) International Application No :PCT/KR2010/003125 (72)Name of Inventor : Filing Date :18/05/2010 1)KIM Jong Ho(87) International Publication No :WO/2010/140782(61) Patent of Addition to Application :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :Disclosed is a system for remitting electronic money and a method for remitting electronic money, by which subscriber identificationinformation of each user can be used as a virtual electronic money account and electronic money can be convenientlyexchanged/remitted between different countries by using the subscriber identification information. The system is configured such thata service server provides a remittance request signal according to a remittance request when receiving the remittance request includingsubscriber identification information of a remittee from a predetermined terminal apparatus, an electronic money server, whichmanages an electronic money account corresponding to the subscriber identification information of each user, requests a relay serverfor confirmation of the remittee and currency exchange/remittance according to the remittance request signal when receiving theremittance request signal, and the relay server identifies a country of the remittee based .No. of Pages : 62 No. of Claims : 21 PATENT OFFICE JOURNAL 02/03/2012 3575
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1974/MUM/2009 A(19) INDIA(22) Date of filing of Application :28/08/2009 (43) Publication Date : 02/03/2012(54) Title of the invention : SYSTEMS FOR DECODING LOW DENSITY PARITY CHECK CODES USING PERFECTDIFFERENCE NETWORKS (PDNS) (71)Name of Applicant :(51) International classification :H04W80/00 1)TATA CONSULTANCY SERVICES LIMITED(31) Priority Document No :NA Address of Applicant :NIRMAL BUILDING, 9TH FLOOR,(32) Priority Date :NA NARIMAN POINT, MUMBAI-400 021, MAHRASHTRA,(33) Name of priority country :NA INDIA(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)BALAJI JANAKIRAM(87) International Publication No :N/A 2)DR. M. GIRISH CHANDRA(61) Patent of Addition to Application Number :NA 3)DR. B S ADIGA Filing Date :NA 4)HARIHARA SUBRAMANYAM G.(62) Divisional to Application Number :NA 5)BALAMURALIDHAR P. Filing Date :NA 6)N/A(57) Abstract :A system for sending messages and for clash free decoding of Lower Density Parity Check (LDPC) codes, between a set of variablenode elements and a set of check node elements, for a set of interconnected processing node elements with a fixed interconnectarchitecture, said system comprising: - code generation means adapted to provide LDPC codes; - Perfect Difference Network (PDN)building means adapted to build Perfect Difference Networks in order to provide said fixed interconnect architecture; - first mappingmeans adapted to map said LDPC code on a built PDN having node elements of pre-fixed size; - second mapping means adapted tomap factor graph based signal processing algorithms on said built PDN for facilitating reusability of said interconnected processingnode elements; and - sum-product algorithm based iterative decoding means adapted to iteratively decode said messages by1providing a soft decision message passing algorithm means to accept the probability of each received bit as input.No. of Pages : 38 No. of Claims : 7 PATENT OFFICE JOURNAL 02/03/2012 3576
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1979/MUM/2009 A(19) INDIA(22) Date of filing of Application :31/08/2009 (43) Publication Date : 02/03/2012(54) Title of the invention : PASSIVE COLLISION SENSING AND PROTECTION SYSTEM(51) International classification :B60R19/00 (71)Name of Applicant :(31) Priority Document No :NA 1)TATA CONSULTANCY SERVICES LIMITED(32) Priority Date :NA Address of Applicant :NIRMAL BUILDING, 9TH FLOOR,(33) Name of priority country :NA NARIMAN POINT, MUMBAI-400021, MAHARASHTRA,(86) International Application No :NA INDIA Filing Date :NA (72)Name of Inventor :(87) International Publication No :N/A 1)ANJAN KUMAR N.(61) Patent of Addition to Application Number :NA 2)GURUPRASAD D. Filing Date :NA 3)RAJIV DIXIT(62) Divisional to Application Number :NA 4)ARVIND N. S. Filing Date :NA(57) Abstract :A passive collision sensing and safety system for a vehicle is disclosed. The system includes a bumper fitted to at least a front end ofthe vehicle, wherein the bumper includes a front face and a rear face. A first and a second frangible elongate element are respectivelyfixed to the front and rear face of the bumper. The system further includes a first and a second electrical circuit co-operating with thefirst and the second frangible elongate element respectively to sense breakage thereof due to a collision. The collision sensing andsafety system also includes an ECU that co-operates with the first and the second electrical circuit to determine severity of thecollision based on time-delay between breakage of the first and second frangible elongate elements. The ECU deploys an occupantsafety device based on severity of the collision and other variables.No. of Pages : 40 No. of Claims : 27 PATENT OFFICE JOURNAL 02/03/2012 3577
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2036/MUM/2009 A(19) INDIA(22) Date of filing of Application :07/09/2009 (43) Publication Date : 02/03/2012(54) Title of the invention : SYSTEM FOR OBTAINING INFORMATION ABOUT TV BROADCASTS VIA A PLURALITY OFCHANNELS(51) International classification :H04N21/00 (71)Name of Applicant :(31) Priority Document No :NA 1)TATA CONSULTANCY SERVICES LIMITED(32) Priority Date :NA Address of Applicant :NIRMAL BUILDING, 9TH FLOOR(33) Name of priority country :NA NARIMAN POINT, MUMBAI - 21, MAHARASHTRA, INDIA(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)CHATTOPADHYAY TANUSHYAM(87) International Publication No :N/A 2)PAL ARPAN(61) Patent of Addition to Application Number :NA 3)SINHA ANIRUDDHA Filing Date :NA 4)AGNURU CHANDRA SEKHAR(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A system and method for displaying an Electronic Program Guide (EPG) data for a television channel of a viewers choice along withsimultaneous access to a plurality of applications while watching the television channel have been disclosed. The system of the presentinvention recognizes the logo of the currently viewed channel and based on the same establishes a communication link with thewebsite of that channel, downloads and hyperlinks the EPG data and blends the data over a portion of the channel video content. Thus,viewers do not have to browse through the entire programme guide to view the programme details of a channel of their choice.Moreover, the hyper-linking enables viewers to access the website of that channel for additional information.No. of Pages : 32 No. of Claims : 9 PATENT OFFICE JOURNAL 02/03/2012 3578
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2078/MUM/2009 A(19) INDIA(22) Date of filing of Application :10/09/2009 (43) Publication Date : 02/03/2012(54) Title of the invention : IMPROVED FUPD SUPPORT STRUCTURE(51) International classification :B60R19/00 (71)Name of Applicant :(31) Priority Document No :NA 1)TATA MOTORS LIMITED(32) Priority Date :NA Address of Applicant :BOMBAY HOUSE, 24 HOMI MODY(33) Name of priority country :NA STREET, HUTATMA CHOWK, MUMBAI 400 001,(86) International Application No :NA MAHARASHTRA, INDIA Filing Date :NA (72)Name of Inventor :(87) International Publication No :N/A 1)R GANESHKUMAR(61) Patent of Addition to Application Number :NA 2)SUJIT CHALIPAT Filing Date :NA 3)SARANG KAVISHWAR(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The embodiments herein provide a front under run protection device (FUPD) with support structure for commercial vehicles. Thesupport structure comprises a chassis frame with long members and cross members. A pair of mounting brackets is provided forfastening with chassis frame cross member. A pair of reinforcement brackets is fastened at the junction of said long member and crossmember. A pair of support brackets is provided for connecting said mounting brackets with said chassis frame long members. Thesupport brackets react to the impact forces during under-run of vehicles to reduce the force generated on the cross member and toprovide adequate strength to the FUPD.No. of Pages : 14 No. of Claims : 7 PATENT OFFICE JOURNAL 02/03/2012 3579
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2092/MUM/2009 A(19) INDIA(22) Date of filing of Application :14/09/2009 (43) Publication Date : 02/03/2012(54) Title of the invention : TV NEWS ANALYSIS SYSTEM FOR MULTILINGUAL BROADCAST CHANNELS(51) International classification :H04N7/173 (71)Name of Applicant :(31) Priority Document No :NA 1)TATA CONSULTANCY SERVICES LTD.(32) Priority Date :NA Address of Applicant :NIRMAL BUILDING, 9TH FLOOR,(33) Name of priority country :NA NARIMAN POINT, MUMBAI 400 021, MAHARASHTRA,(86) International Application No :NA INDIA Filing Date :NA (72)Name of Inventor :(87) International Publication No :N/A 1)DR. GHOSH HIRANMAY(61) Patent of Addition to Application Number :NA 2)DR. KOPPARAPU Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A system for identification, classification, storage, and analysis of news-programs, containing an audio channel, video channel, andmetadata relating to it, broadcasted/relayed on a television (TV) channel by means of a plurality of TV broadcast streams, said systemcomprising: - acquisition module adapted to capture said TV broadcast streams; - recording module adapted to record said capturedstreams on a physical storage; - news program identification module adapted to identify news programs in said stored broadcaststreams; - news program clipping module adapted to separate said identified news programs from other programs; - advertisementidentification module for identification of advertisements from said identified news programs; - advertisement clipping moduleadapted for removal of said identified advertisements; - seam detection module adapted to detect and identify seams of said newsprograms in order to demark individual stories in a news program; - keyword generation module adapted to generate a list ofkeywords; - text-keyword identification module adapted to identify said created keywords from visual text of identified said newsprograms; - speech-keyword identification module adapted to identify the created keywords from the speech of said identified newsprograms; - repeat-identification module adapted to identify similar/repeat news programs from said plurality of TV broadcaststreams; - clustering module adapted to cluster said repeat news programs into one news programs, in order to avoid duplication ormultiplication; - removal module adapted to remove said repeat-identified news programs; - repository adapted to store said newsprograms and metadata embedded in -said news programs; and - logical interconnection module adapted to logically interconnectingeach of said modules for determining the sequence of steps for a multilingual news video analysis system.No. of Pages : 37 No. of Claims : 17 PATENT OFFICE JOURNAL 02/03/2012 3580
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2093/MUM/2009 A(19) INDIA(22) Date of filing of Application :14/09/2009 (43) Publication Date : 02/03/2012(54) Title of the invention : SYSTEM FOR SMS VALUE ADDED SERVICE FOR ACTIVE TELEVISION SHOWS ON A SETTOP BOX(51) International classification :H04N5/765 (71)Name of Applicant :(31) Priority Document No :NA 1)TATA CONSULTANCY SERVICES LIMITED(32) Priority Date :NA Address of Applicant :NIRMAL BUILDING, 9TH FLOOR,(33) Name of priority country :NA NARIMAN POINT, MUMBAI 400 021, MAHARASHTRA,(86) International Application No :NA INDIA Filing Date :NA (72)Name of Inventor :(87) International Publication No :N/A 1)CHATTOPADHYAY TANUSHYAM(61) Patent of Addition to Application Number :NA 2)CHAKI AYAN Filing Date :NA 3)SINHA ANIRUDDHA(62) Divisional to Application Number :NA 4)PAL ARPAN Filing Date :NA(57) Abstract :An interactive device interfaced between a set top box and at least one display device, said device comprising: blending means co-operating with said set top box to receive video content, said blending means adapted to blend pre determined textual content with saidvideo content to form blended content; graphical interface cooperating with blending means to receive said blended content, saidgraphical interface further adapted to output the received blended content on to said display device; a user interface adapted to enablea user to interact with said interactive device; a machine vision unit cooperating with blending means to receive said blended content,said machine vision unit adapted to detect the coordinates of a frame of an active page containing said blended content; storage meansadapted to store the coordinates of said frame of an active page; pre processing means adapted to recognize the active page displayedon said display device, said pre processing means cooperating with storage means to receive the coordinates of said frame of the activepage, said preprocessing means adapted to separate the background image and foreground image of said frame and enhance saidforeground image; character recognition means cooperating with preprocessing means to receive said enhanced foreground image,said character recognition means further adapted to extract the alpha numeric character set embedded in said enhanced foregroundimage; communication means cooperating with character recognition means, said communication means further adapted to formulatethe message text and address and transmit the text message to said address over a computer network; receiving means cooperatingwith user interface to receive the signals.No. of Pages : 34 No. of Claims : 20 PATENT OFFICE JOURNAL 02/03/2012 3581
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2091/MUM/2009 A(19) INDIA(22) Date of filing of Application :14/09/2009 (43) Publication Date : 02/03/2012(54) Title of the invention : DONATION DRIVEN SYSTEM FOR PROVIDING PLATFORMS FOR ADVERTISEMENT(51) International classification :G06F17/00 (71)Name of Applicant :(31) Priority Document No :NA 1)GANGAR RAJESH(32) Priority Date :NA Address of Applicant :B 126, UDYOG BHAWAN(33) Name of priority country :NA GOREGAON (E) MUMBAI 400 059 MAHARASHTRA, INDIA(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)GANGAR RAJESH(87) International Publication No :N/A(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A system for providing an advertisement and recognition platform in conjunction with a donation/fund-raising mechanismcommensurate with said donation in accordance with pre-defined parameters on a pre-defined pedestal, said system comprising: -registration means adapted to provide a verifiable registration mechanism for allowing an individual/Company/Group to use saidsystem; - advertisement platform selection means adapted to provide a selection range for providing a user with choices for selectingthe platform upon which the user may advertise; - auctioning/tender mechanism adapted to place a bid on said selected advertisementplatform in accordance with pre-defined parameters; - network of auctioning mechanisms, with an auctioning mechanism per user,adapted to receive multiple bids per platform; - central computation engine adapted to collate various bids from various auctioningmechanisms; - comparative means adapted to compare collated various bids in order to find the highest bidder; - notification meansadapted to notify said highest bidder, based on predefined parameters of the computation engine; - allotment means adapted to allotselected advertisement platform to said highest bidder; - name displaying means adapted to display name of said highest bidder onsaid advertisement platform; - central repository for storing payable money by said highest bidder; and - money collection means andnetwork for ease of transfer of money from the bidder to the central repository.No. of Pages : 15 No. of Claims : 6 PATENT OFFICE JOURNAL 02/03/2012 3582
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2122/MUM/2009 A(19) INDIA(22) Date of filing of Application :16/09/2009 (43) Publication Date : 02/03/2012(54) Title of the invention : FILTER-CLOG MONITORING DEVICE :F01M (71)Name of Applicant :(51) International classification 1/00,B01D27/00, 1)MAHINDRA & MAHINDRA LTD.(31) Priority Document No :NA Address of Applicant :GATEWAY BUILDING, APOLLO(32) Priority Date :NA BUNDER, MUMBAI - 400001. Maharashtra India(33) Name of priority country :NA (72)Name of Inventor :(86) International Application No :NA 1)MR. GURUSAMY SURESHKUMAR Filing Date :NA(87) International Publication No :N/A(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The present invention relates to indication of filter clogging, by measuring differential pressure across filter, that helps the equipmentoperator to monitor condition of the filter and provides useful early signals for deciding on changing of the filter before it chokescompletely. It relates to a low cost filter-clog indicating device having simple construction and using a diaphragm that deflects as perpressure differential based on clog-condition of the filter and accordingly passes on the signal to a visual indication device.No. of Pages : 21 No. of Claims : 10 PATENT OFFICE JOURNAL 02/03/2012 3583
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2126/MUM/2009 A(19) INDIA(22) Date of filing of Application :17/09/2009 (43) Publication Date : 02/03/2012(54) Title of the invention : A WATER PURIFICATION DEVICE (71)Name of Applicant :(51) International classification :C02F1/00 1)HINDUSTAN UNILEVER LIMITED(31) Priority Document No :NA Address of Applicant :165/166 BACKBAY(32) Priority Date :NA RECLAMATION, MUMBAI - 400020, MAHARASHTRA,(33) Name of priority country :NA INDIA(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)CHATTERJEE JAIDEEP(87) International Publication No :N/A 2)GUPTA SANTOSH KUMAR(61) Patent of Addition to Application Number :NA 3)RAMACHANDRA RAJEESH KUMAR Filing Date :NA 4)PRATAP SHAILENDRA(62) Divisional to Application Number :NA 5)WASKAR MORRIS Filing Date :NA 6)KUSHWAHA PRIYANKA(57) Abstract :The invention relates to a water purification device and a process for water purification and in particular relates to a water purificationdevice that may be used as a gravity fed system or adapted to be connected to the main water supply. It is a single chamber waterpurification device which is capable of dosing a controlled level of a biocide to the water and has a filtration unit that functions as afilter-cum-scavenger. This water purification device provides several advantages over the prior art especially in terms of reducing thecomplexity of the device thus making it economical and reducing the number of replaceable parts without affecting the performance interms of microbial safety or flow rate. Another advantage of the system is that it can be adapted for use with solid and liquid biocidesNo. of Pages : 23 No. of Claims : 10 PATENT OFFICE JOURNAL 02/03/2012 3584
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2156/MUM/2009 A(19) INDIA(22) Date of filing of Application :17/09/2009 (43) Publication Date : 02/03/2012(54) Title of the invention : SUSTAINABLE CHEMICAL PROCESS FOR GREEN REDUCTION OF NITRO COMPOUNDS (R-NO2) OR NITROSO COMPOUNDS (R-NO) INTO CORRESPONDING AMINO COMPOUNDS (R-NH2) WHERE SEPARATIONOF PRODUCT IS BY STEAM DISTILLATION WITH INHERENT RECYCLE OF ALL LIQUID STREAMS GENERATED INSYNTHESIS. (71)Name of Applicant :(51) International classification :C05G3/00 1)NEWREKA GREENSYNTH TECHNOLOGIES(31) Priority Document No :NA PRIVATE LIMITED(32) Priority Date :NA Address of Applicant :RANG ASHISH, 2 DREAMLAND,(33) Name of priority country :NA CHS, OPP DIAMOND GARDEN, CHEMBUR, MUMBAI 400(86) International Application No :NA 071, MAHARASHTRA STATE, INDIA Filing Date :NA 2)BHADRESH K PADIA(87) International Publication No : NA 3)NITESH H MEHTA(61) Patent of Addition to Application Number :NA (72)Name of Inventor : Filing Date :NA 1)BHADRESH K PADIA(62) Divisional to Application Number :NA 2)NITESH H MEHTA Filing Date :NA 3)DR. KOMAL MAHESHWARI 4)MR. RAJESH MOHALKAR(57) Abstract :The present invention relates to a sustainable chemical process of green reduction of R-NO2 or R-NO into corresponding R-NH2 thatproduces greener R-NH2 in good yields and selectivity with large number of recycle of mother liquor. The process creates sustainableand closed loop of water allowing inherent recycles of all liquid streams generated in the process. Proprietary chemical agents are usedin a novel manner which makes the process of the invention feasible. The liquid streams generated during the process of the inventionare inherently recycled completely, making the process of the present invention a zero liquid discharge process which is green andsustainable.No. of Pages : 76 No. of Claims : 15 PATENT OFFICE JOURNAL 02/03/2012 3585
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2153/MUM/2009 A(19) INDIA(22) Date of filing of Application :17/09/2009 (43) Publication Date : 02/03/2012(54) Title of the invention : METHOD AND SYSTEM FOR GENERATING RANDOM SEQUENCES FOR AUTHENTICATIONPROTOCOLS(51) International classification :H04L9/32 (71)Name of Applicant :(31) Priority Document No :NA 1)TATA CONSULTANCY SERVICES LTD.(32) Priority Date :NA Address of Applicant :NIRMAL BUILDING, 9TH FLOOR,(33) Name of priority country :NA NARIMAN POINT, MUMBAI 400 021, MAHARASHTRA,(86) International Application No :NA INDIA Filing Date :NA (72)Name of Inventor :(87) International Publication No :N/A 1)NATARAJAN VIJAYARANGAN(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A system and method for authentication of a peer node using random sequences have been disclosed. An authenticator node 160 isdeployed to authenticate a peer node 165 which selects a random prime number, transmits the selected prime number to the peer node165 and generates random sequences for matching. The peer node 165 receives the prime number and generates random sequencesusing the received prime number as upper bound, these random sequences are either sent as is to the authenticator node 160 forauthentication or are used to encrypt the data to be sent to the authenticator node 160 for authentication. Further, the authenticatornode matches the received random sequences generated at the peer node 160 with the locally generated random sequences and in caseof a match authenticates the peer node 165.No. of Pages : 35 No. of Claims : 21 PATENT OFFICE JOURNAL 02/03/2012 3586
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2155/MUM/2009 A(19) INDIA(22) Date of filing of Application :17/09/2009 (43) Publication Date : 02/03/2012(54) Title of the invention : HIGH PURITY CONCENTRATES OF POLYUNSATURATED FATTY ACID AND ESTER BYCOPPER COMPLEXATION(51) International classification :B01D15/38 (71)Name of Applicant :(31) Priority Document No :NA 1)V. B. MEDICARE PVT. LTD.(32) Priority Date :NA Address of Applicant :141 WALCHAND HIRACHAND(33) Name of priority country :NA MARG, MUMBAI - 400 001, MAHARASHTRA. INDIA.(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)RAKESH RATNAM(87) International Publication No : NA 2)SHREERAM JOSHI(61) Patent of Addition to Application Number :NA 3)TRUPTI TERSE Filing Date :NA 4)P. SURESH(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :This invention discloses a process of preparing improved purity concentrate of at least one polyunsaturated fatty acid or its ester froma mixture of the said polyunsaturated fatty acid or ester and at least one more other fatty acid or its ester having unsaturation or lessunsaturation, the said process comprising use of copper ions impregnated on stationary support for preferential or selective adsorptionof the said polyunsaturated fatty acids in predominantly non-polar solvents and desorption in polar solvents. The mixture of the saidpolyunsaturated fatty acid or ester and at least one more other fatty acid or its ester having unsaturation or less unsaturation may bederived from a marine oil, which may be, including without limitation, fish oil, an oil extracted from a marine algae selcted for itsability of a heterotropic growth in a medium haing less salinity than sea water. Such a Thraustochytriale may be a Thraustochytrium orSchizochytrium.No. of Pages : 18 No. of Claims : 9 PATENT OFFICE JOURNAL 02/03/2012 3587
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2172/MUM/2009 A(19) INDIA(22) Date of filing of Application :18/09/2009 (43) Publication Date : 02/03/2012(54) Title of the invention : PROCESS FOR PRODUCTION OF BIODIESEL FROM ACID OIL(51) International classification :C10L1/02 (71)Name of Applicant :(31) Priority Document No :NA 1)LELE & ASSOCIATES, CONSULTANTS AND(32) Priority Date :NA ENGINEERS PVT. LTD(33) Name of priority country :NA Address of Applicant :B-101, OM SAI NIWAS CO-OP. HSG(86) International Application No :NA SOCIETY LTD., SUBHASH ROAD, VILE PARLE (EAST), Filing Date :NA MUMBAI-400057, MAHARASHTRA, INDIA(87) International Publication No :N/A (72)Name of Inventor :(61) Patent of Addition to Application Number :NA 1)GAIKAR VILAS GAJANAN Filing Date :NA 2)PANDIT ANIRUDDHA BHALCHANDRA(62) Divisional to Application Number :NA 3)LELE PRAKASH BHASKAR Filing Date :NA(57) Abstract :Process for production of biodiesel from acid oil is disclosed wherein acid oil is contacted with an alcohol in countercurrent manner inthe presence of an acid catalyst for esterification. Esterification is followed by saponification and thereafter transesterification oftriglycerides, by an alcohol in the presence of an alkaline catalyst. In the overall process Fatty acid from acid oil is contacted withalcohol in multiple countercurrent steps wherein between two steps, organic and aqueous acid phases are separated by phaseseparation. Esterification of the fatty acids in the acid oil with alcohol in countercurrent manner and intensified by hydrodynamicscavitation has increased the efficiency of process to such extent that ratio of alcohol to free fatty acid of acid oil has considerably beenreduced.No. of Pages : 27 No. of Claims : 35 PATENT OFFICE JOURNAL 02/03/2012 3588
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2178/MUM/2009 A(19) INDIA(22) Date of filing of Application :18/09/2009 (43) Publication Date : 02/03/2012(54) Title of the invention : TRIP DEVICE FOR AIR CIRCUIT BREAKERS(51) International classification :H01H33/00 (71)Name of Applicant :(31) Priority Document No :NA 1)LARSEN & TOUBRO LIMITED(32) Priority Date :NA Address of Applicant :L&T HOUSE, BALLARD ESTATE, P.(33) Name of priority country :NA O. BOX NO. 278, MUMBAI, 400 001, MAHARASHTRA,(86) International Application No :NA INDIA Filing Date :NA (72)Name of Inventor :(87) International Publication No :N/A 1)LEENA ASHWIN SHIMPI(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The various embodiments of the present invention provide a trip device comprising electrically saturated current transformer for aircircuit breakers. According to one embodiment of the present invention, a trip device for an air circuit breaker has a current sensor anda processor unit connected to the current sensor. At least one transformer is connected to the processor unit. A metering and protectioncircuit is connected to the current sensor. The transformer is added with reverse turns in at least one limb in the core to add impedanceto saturate the current passed through the transformer to limit the current supplied to the processor unit and to ensure the early poweron the processor unit, when a high current is passed through the primary turns of the transformer.No. of Pages : 36 No. of Claims : 9 PATENT OFFICE JOURNAL 02/03/2012 3589
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2202/MUM/2009 A(19) INDIA(22) Date of filing of Application :22/09/2009 (43) Publication Date : 02/03/2012(54) Title of the invention : STABLE DOSAGE FORMULATION OF PARACETAMOL(51) International classification :A61K31/00 (71)Name of Applicant :(31) Priority Document No :NA 1)J. B. CHEMICALS AND PHARMACEUTICALS LTD.(32) Priority Date :NA Address of Applicant :NEELAM CENTRE, B WING, 4TH(33) Name of priority country :NA FLOOR, HIND CYCLE ROAD, WORLI, MUMBAI 400 030,(86) International Application No :NA MAHARASHTRA, INDIA Filing Date :NA (72)Name of Inventor :(87) International Publication No :N/A 1)MR. BHARAT PRAVINCHANDRA MEHTA(61) Patent of Addition to Application Number :NA 2)DR. MANOJ KANTILAL PATEL Filing Date :NA 3)DR. RAJEN DHIRUBHAI SHAH(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :Described herein are pharmaceutical formulations for intravenous administration of analgesic and antipyretic drug paracetamol.No. of Pages : 7 No. of Claims : 4 PATENT OFFICE JOURNAL 02/03/2012 3590
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2194/MUM/2009 A(19) INDIA(22) Date of filing of Application :22/09/2009 (43) Publication Date : 02/03/2012(54) Title of the invention : A WORKPIECE MEASURING DEVICE FOR ROBOTIC APPLICATIONS(51) International classification :G01B5/00 (71)Name of Applicant :(31) Priority Document No :NA 1)HUGHEN GERRARD THOMAS(32) Priority Date :NA Address of Applicant :EL-55, M.I.D.C. BHOSARI, PUNE-(33) Name of priority country :NA 411 026, MAHARASHTRA, INDIA(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)HUGHEN GERRARD THOMAS(87) International Publication No :N/A(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A measuring carriage for facilitating robotic operation on a work-piece moving on a conveyor in synchronization with a tool held by arobot. The measuring carriage includes sliding means and at least one sensor. The sliding means is adapted to facilitate sliding of themeasuring carriage on a slide. The measuring carriage includes at least one sensor disposed on the measuring carriage, wherein thesensor is adapted to sense position of the work-piece on the conveyor.No. of Pages : 23 No. of Claims : 5 PATENT OFFICE JOURNAL 02/03/2012 3591
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2195/MUM/2009 A(19) INDIA(22) Date of filing of Application :22/09/2009 (43) Publication Date : 02/03/2012(54) Title of the invention : A WORK ZONE SPECIFIC ENCLOSURE(51) International classification :F16P1/00 (71)Name of Applicant :(31) Priority Document No :NA 1)HUGHEN GERRARD THOMAS(32) Priority Date :NA Address of Applicant :EL-55, M.I.D.C. BHOSARI, PUNE-(33) Name of priority country :NA 411 026. MAHARASHTRA, INDIA(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)HUGHEN GERRARD THOMAS(87) International Publication No : NA(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A protective barrier enclosure against emissions from an apparatus defined by at least one working zone and a system componentszone. The working zone includes at least one operating tool operating on at least one work piece and a work-piece and the systemcomponents zone includes system components. The emissions are emanating from the working zone and the system components zoneis disposed outside said working zone. The protective barrier enclosure includes a hollow operative housing defined by walls. Thewalls of the housing encloses the working zone, wherein at least a portion of at least one of said walls is displaceable complementaryto movement of an arm operating the operating tool on the work piece in the working zone.No. of Pages : 40 No. of Claims : 17 PATENT OFFICE JOURNAL 02/03/2012 3592
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2208/MUM/2009 A(19) INDIA(22) Date of filing of Application :23/09/2009 (43) Publication Date : 02/03/2012(54) Title of the invention : PHARMACEUTICAL COMPOSITION COMPRISING PRASUGREL(51) International classification :A61K31/00 (71)Name of Applicant :(31) Priority Document No :NA 1)GLENMARK PHARMACEUTICALS LIMITED(32) Priority Date :NA Address of Applicant :GLENMARK HOUSE, HDO -(33) Name of priority country :NA CORPORATE BLDG, WING-A, B. D. SAWANT MARG,(86) International Application No :NA CHAKALA, ANDHERI(EAST), MUMBAI - 400 099, Filing Date :NA MAHARASHTRA, INDIA(87) International Publication No :N/A (72)Name of Inventor :(61) Patent of Addition to Application Number :NA 1)PATOLE PRASHANT Filing Date :NA 2)CHAUDHARI SUNIL(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The present invention relates to pharmaceutical composition for oral administration comprising prasugrel or its salt and triflusal, aswell as to a process for preparation of such composition, and use of such composition for treating a platelet aggregation disorder in asubject.No. of Pages : 26 No. of Claims : 10 PATENT OFFICE JOURNAL 02/03/2012 3593
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2196/MUM/2009 A(19) INDIA(22) Date of filing of Application :22/09/2009 (43) Publication Date : 02/03/2012(54) Title of the invention : TIME ZONE ALERT SYSTEM APPLICATION FOR MOBILE COMMUNICATION DEVICES(51) International classification :H04W24/00 (71)Name of Applicant :(31) Priority Document No :NA 1)GOKHALE SATISH(32) Priority Date :NA Address of Applicant :RAJEEV, 828 SHIVAJINAGAR, V. G.(33) Name of priority country :NA KALE ROAD, PUNE-411 004, MAHARASHTRA, INDIA(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)GOKHALE SATISH(87) International Publication No :N/A(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A system and method is provided for notifying a calling party about the current local time and the current geographic location of thecalled party, to aid the calling party in deciding on continuing the call or otherwise. A calling party is notified about the geographiclocation and the current local time associated with the geographic location of the called party. Based on the received notification thecalling party can decide whether to continue with the call or abandon the call. If the call is considered urgent, the calling party canelect to continue with the call despite receiving the notification indicating the geographic location and current local time of calledparty. The calling party will be notified about the geographic location of called party and the corresponding current lcal time only ifcalled party has activated the system.No. of Pages : 34 No. of Claims : 13 PATENT OFFICE JOURNAL 02/03/2012 3594
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2220/MUM/2009 A(19) INDIA(22) Date of filing of Application :24/09/2009 (43) Publication Date : 02/03/2012(54) Title of the invention : AN ANTIMICROBIAL COMPOSITION(51) International classification :A61K31/00 (71)Name of Applicant :(31) Priority Document No :NA 1)HINDUSTAN UNILEVER LIMITED(32) Priority Date :NA Address of Applicant :165/166 BACKBAY(33) Name of priority country :NA RECLAMATION, MUMBAI - 400020, MAHARASHTRA,(86) International Application No :NA INDIA Filing Date :NA (72)Name of Inventor :(87) International Publication No :N/A 1)MEDEPALLI SRILAXMI VENKATA(61) Patent of Addition to Application Number :NA 2)CHAKRABORTTY AMIT Filing Date :NA 3)CHEVITI BHARAT(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The present invention relates to a method of disinfecting a surface and to antimicrobial composition, particularly for personal cleaning,oral care, or hard surface cleaning. It is an object of the present invention to provide for an antimicrobial composition that hasrelatively fast antimicrobial action. The inventors have found that use of small amounts of eugenol in combination with thymol andterpineol enables this fast kinetics at much lower amount of thymol and terpineol than without eugenol.No. of Pages : 24 No. of Claims : 15 PATENT OFFICE JOURNAL 02/03/2012 3595
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2221/MUM/2009 A(19) INDIA(22) Date of filing of Application :24/09/2009 (43) Publication Date : 02/03/2012(54) Title of the invention : A PARTICULATE FLUORESCER AND A PROCESS FOR PREPARING THE SAME(51) International classification :A61K8/26 (71)Name of Applicant :(31) Priority Document No :NA 1)HINDUSTAN UNILEVER LIMITED(32) Priority Date :NA Address of Applicant :165/166 BACKBAY(33) Name of priority country :NA RECLAMATION, MUMBAI - 400020, MAHARASHTRA,(86) International Application No :NA INDIA Filing Date :NA (72)Name of Inventor :(87) International Publication No : NA 1)JAYARAMAN SURESH SAMBAMURTHY(61) Patent of Addition to Application Number :NA 2)GHOSH DASTIDAR SUDIPTA Filing Date :NA 3)PANCHANATHAN ANANDH(62) Divisional to Application Number :NA 4)RAJAGOPAL RAMASUBRAMANIAM Filing Date :NA 5)PALANISAMY BHARATH(57) Abstract :This invention relates to a particulate fluorescer and a process for preparing the same. More particularly the present invention relatesto a bipolar particulate fluorescer for use in laundry detergent composition, fabric conditioner and cosmetic compositions and aprocess for making the same. In view of the foregoing, it is an object of the present invention to provide a fluorescer with improvedretention to the fabric so that larger amounts of fluorescer will be available even after rinsing. It is yet a further object of the inventionto provide a fluorescer with improved stability when formulated in cosmetic compositions. Surprisingly it has been found thatfluorescer molecules tagged by surface reaction on to naturally occurring asymmetric clay surfaces, act as a fluorescer particle withimproved retention properties, low fabric specificaly,higher stability in cosmetic formulations and/or yielding improved brightness tosubstrate (skin/fabric) on use and meets at least one of the above mentioned objects.No. of Pages : 27 No. of Claims : 15 PATENT OFFICE JOURNAL 02/03/2012 3596
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2222/MUM/2009 A(19) INDIA(22) Date of filing of Application :24/09/2009 (43) Publication Date : 02/03/2012(54) Title of the invention : AN ANTIMICROBIAL PARTICLE AND A PROCESS FOR PREPARING THE SAME(51) International classification :A01N25/00 (71)Name of Applicant :(31) Priority Document No :NA 1)HINDUSTAN UNILEVER LIMITED(32) Priority Date :NA Address of Applicant :165/166 BACKBAY(33) Name of priority country :NA RECLAMATION, MUMBAI - 400020, MAHARASHTRA,(86) International Application No :NA INDIA Filing Date :NA (72)Name of Inventor :(87) International Publication No : NA 1)BHATTACHARYA ARPITA(61) Patent of Addition to Application Number :NA 2)GHOSH DASTIDAR SUDIPTA Filing Date :NA 3)IYER VIDULA(62) Divisional to Application Number :NA 4)JAYARAMAN SURESH SAMBAMURTHY Filing Date :NA(57) Abstract :This invention relates to an antimicrobial particle and a process for preparing the same. These bipolar antimicrobial particles may beused in laundry detergent compositions, fabric conditioners, personal care and cosmetic compositions. In view of the foregoing, it isan object of the present invention to provide a stabile antimicrobial agent immobilised on a carrier particle. It is a further objective toprovide an antimicrobial particle with improved retention to the fabric so that larger amounts of antimicrobial will be available evenafter rinsing. Surprisingly it has been found that antimicrobial molecules tagged by surface reaction onto naturally occurringasymmetric clay surfaces, act as an antimicrobial particle with improved retention properties with improved stability.No. of Pages : 28 No. of Claims : 14 PATENT OFFICE JOURNAL 02/03/2012 3597
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2224/MUM/2009 A(19) INDIA(22) Date of filing of Application :24/09/2009 (43) Publication Date : 02/03/2012(54) Title of the invention : FIBER DISTRIBUTION MANAGEMENT SYSTEM :H04Q1/00, (71)Name of Applicant :(51) International classification G02B6/00 1)RAYCHEM RPG LIMITED(31) Priority Document No :NA Address of Applicant :INFOCOM SBU, 463, CEAT MAHAL(32) Priority Date :NA ANNEXE, DR. ANNIE BESANT ROAD, WORLI, MUMBAI -(33) Name of priority country :NA 400 030, MAHARASHTRA, INDIA(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)ATUL NARANIA(87) International Publication No :N/A 2)BIPPAN BHAT(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The present invention provides a fiber distribution management system including an enclosure, comprising a patching sectionincluding a first access door pivotably attached to the enclosure, wherein the patching section comprising a patching area havingatleast three bend control drum arranged equidistant from each other, a swing type patch panel adapted with patch plates havingapertures, wherein the swing type patch plates are configured to accommodate atleast one adaptor, a splicing section including asecond access door pivotably attached to the enclosure, wherein the splicing section comprising a splicing area having atleast onestorage basket for buffer storage, splicing fiber organizing trays and foldable plate panel with locking means and a routing channelaccompanying both the patching area and the splicing area for routing the fiber optic cable from one area to the other; wherein thepatching section and the splicing section are independently accessible with respect to each other thereby reducing the damage of theenclosure, increasing the security and ease to access.No. of Pages : 19 No. of Claims : 10 PATENT OFFICE JOURNAL 02/03/2012 3598
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2239/MUM/2009 A(19) INDIA(22) Date of filing of Application :25/09/2009 (43) Publication Date : 02/03/2012(54) Title of the invention : INORGANIC ANTIMICROBIAL NANOCOMPOSITE POWDER AND A METHOD OFMANUFACTURING THE SAME(51) International classification :A01N25/00 (71)Name of Applicant :(31) Priority Document No :NA 1)H. & R. JOHNSON (INDIA) LTD.(32) Priority Date :NA Address of Applicant :WINDSOR 7TH FLOOR, KALINA,(33) Name of priority country :NA C.S.T. ROAD, SANTACRUZ-E, MUMBAI - 400054.(86) International Application No :NA MAHARASHTRA, INDIA Filing Date :NA (72)Name of Inventor :(87) International Publication No : NA 1)SANTOSH KUMAR(61) Patent of Addition to Application Number :NA 2)SACHI DULAL MAJUMDAR Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The present invention relates to an inorganic antimicrobial agent comprising of nano silver particles bonded on a carrier havingaverage particle size of 20 nm to 400 nm and method of manufacturing the said inorganic antimicrobial agent by dissolving silvercontaining compound in distilled or demineralised or ionised water followed by addition of the carrier: Stirring the above mixturecontinuously for 15 to 40 minutes; Drying the above mixture; and calcining the dried mixture under reducing atmosphere between450°C and 700°C and for a period of 60 to 180 minutes.No. of Pages : 17 No. of Claims : 15 PATENT OFFICE JOURNAL 02/03/2012 3599
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2249/MUM/2009 A(19) INDIA(22) Date of filing of Application :25/09/2009 (43) Publication Date : 02/03/2012(54) Title of the invention : METHOD AND SYSTEM TO SPLIT DATA ACROSS MULTIPLE THREADS(51) International classification :G06F15/00 (71)Name of Applicant :(31) Priority Document No :NA 1)TATA CONSULTANCY SERVICES LIMITED(32) Priority Date :NA Address of Applicant :NIRMAL BUILDING, 9TH FLOOR,(33) Name of priority country :NA NARIMAN POINT MUMBAI - 21, MAHARASHTRA, INDIA(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)SAHOO PRABIN RANJAN(87) International Publication No : NA(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A system for providing a muticore object framework for multicore processor architecture, said system comprising: - reading means toread an input file; - first determining means adapted to determine size of said read file; - second determining means adapted todetermine number of cores on said multicore processor; - splitting means adapted to split said read file into multiple sub-files, therebyproducing multicore objects in accordance with said determined file size and said determined number of cores; - mapping meansadapted to map each of said multiple multicore objects correspondingly over each of said cores; - computation means for computingeach of said mapped multicore objects individually and parallely to obtain individually processed data; - local variable elementdefining means adapted to define local variable elements for use by the multicore objects to facilitate temporary storage forcomputation; - transfer means adapted to transfer data from said local variable elements to said multicore objects after saidcomputation; and - joining means adapted to join said individually processed data to obtain cumulative processed data for said readinput file.No. of Pages : 33 No. of Claims : 7 PATENT OFFICE JOURNAL 02/03/2012 3600
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2595/MUM/2009 A(19) INDIA(22) Date of filing of Application :10/12/2009 (43) Publication Date : 02/03/2012(54) Title of the invention : VACUUM STORAGE SYSTEM IN A REFRIGERATOR(51) International classification :F25D17/00,A47J43/00 (71)Name of Applicant :(31) Priority Document No :NA 1)WHIRLPOOL OF INDIA LTD.(32) Priority Date :NA Address of Applicant :Plot no. 40 Sector- 44 Gurgaon -(33) Name f priority country :NA 122002 Haryana India(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)Pawan Manusukhlal Gandhi(87) International Publication No : NA 2)Rahul Arun Wadke(61) Patent of Addition to Application 3)Sant Ranjan :NANumber 4)Sunil Jhadav :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The present invention relates to a refrigerator with a vacuum food storage system for food storage and preservation. In oneembodiment of the present invention, the system draws air which results in reduction in oxygen molecules and also retains thehumidity, thereby maintaining the freshness of the food along with refrigeration. The food is stored in a vacuum bin (1). Preservationof stored food is achieved by using a vacuum pump (6) connected to vacuum bin (1). The vacuum bin (1) can be placed inside oroutside the refrigerator.No. of Pages : 31 No. of Claims : 18 PATENT OFFICE JOURNAL 02/03/2012 3601
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2941/MUM/2009 A(19) INDIA(22) Date of filing of Application :21/12/2009 (43) Publication Date : 02/03/2012(54) Title of the invention : THE MOBILE PHONE CONDUCTING FOUNTAIN(51) International classification :H03M13/00 (71)Name of Applicant :(31) Priority Document No :NA 1)SHRI JAYANTIBHAI BHAGWANJIBHAI PATEL(32) Priority Date :NA Address of Applicant :SWAGAT CHAMBERS, OLD GHUT(33) Name of priority country :NA ROAD, TRAJPAR CROSS ROAD, MORBI - 2, Gujarat India(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)SHRI JAYANTIBHAI BHAGWANJIBHAI PATEL(87) International Publication No :N/A(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The mobile phone is conducting fountain to start water flow. We operate this operation any place of the world through mobile phoneand any human been can absolute control of electronics component around home, office & farms. We also open the gate, start Fan,Light, TV, Computer & CD. We consumption of water, electricity & time of Human been of sustainable Way.No. of Pages : 7 No. of Claims : 5 PATENT OFFICE JOURNAL 02/03/2012 3602
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.3041/MUM/2009 A(19) INDIA(22) Date of filing of Application :31/12/2009 (43) Publication Date : 02/03/2012(54) Title of the invention : APPARATUS AND SYSTEM FOR VERTEBRAE STABILIZATION AND CURVATURECORRECTION, AND METHODS OF MAKING AND USING SAME(51) International classification :A61B17/70 (71)Name of Applicant :(31) Priority Document No :61288273 1)JAMES H. ALDRIDGE(32) Priority Date :19/12/2009 Address of Applicant :16603 M-69, AUGUSTA, MICHIGAN(33) Name of priority country :U.S.A. 49012, U.S.A.(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)JAMES H. ALDRIDGE(87) International Publication No :N/A(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :An apparatus and system useful as stabilization or correction system for a spinal column. A threaded rod is used that can be straight,rigid, bent or flexible depending on the vertebrae condition to be addressed.. The rod may be bent or flexible to achieve varyingdegrees of lord sis (backward curvature) or kyphosis (forward curvature) before being affixed to the anchoring means and apparatus.The straightness, curvature, bent, or flexibility of rod depends upon the location along the spinal column. Once installed to thevertebrae, the rod provides the proper, desired curvature and stabilization for the spinal column. Sharp edges and corners of theapparatus are eliminated by rounding the edges and corners.No. of Pages : 16 No. of Claims : 10 PATENT OFFICE JOURNAL 02/03/2012 3603
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.328/MUM/2010 A(19) INDIA(22) Date of filing of Application :08/02/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : IMS APPLICATION SERVER, NETWORK, METHOD, AND COMPUTER PROGRAM PRODUCTFOR EXECUTING SERVICES, PARTICULARLY IP CONTACT CENTER SERVICES(51) International classification :H04M3/50 (71)Name of Applicant : :09 425 1)ACCENTURE GLOBAL SERVICES LIMITED(31) Priority Document No 146.9 Address of Applicant :3 GRAND CANAL PLAZA, GRAND(32) Priority Date :20/04/2009 CANAL STREET UPPER, DUBLIN 4 IRELAND(33) Name o priority country :EPO (72)Name of Inventor :(86) International Application No :NA 1)Silvia Tenenti Filing Date :NA 2)Mabel PECORONE(87) International Publication No : NA(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The present description is directed to an IMS application Server, an IMS network, a computer-implemented method, and a computerprogram product for executing services, such as IP Contact Center services, accessible over a plurality of diffrent access channels. TheIMS application server for executing services accessible over a plurality of different access channels.No. of Pages : 55 No. of Claims : 15 PATENT OFFICE JOURNAL 02/03/2012 3604
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.347/MUM/2010 A(19) INDIA(22) Date of filing of Application :09/02/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : NOVEL WHEEL RIM TO PREVENT THE TUBE & TYRE SLIPPAGE(51) International classification :B60C27/00 (71)Name of Applicant :(31) Priority Document No :NA 1)TATA MOTORS LIMITED(32) Priority Date :NA Address of Applicant :BOMBAY HOUSE, 24 HOMI MODY(33) Name of priority country :NA STREET, HUTATMA CHOWK, MUMBAI 400 001,(86) International Application No :NA MAHARASHTRA, INDIA Filing Date :NA (72)Name of Inventor :(87) International Publication No :N/A 1)MR. SIDDHARTH GUPTA(61) Patent of Addition to Application Number :NA 2)MR. PRAFUL BONDE Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :This invention relates to Novel wheel rim to prevent the tube and tyre slippage and method of manufacturing thereof more particularlyto the modification done on the surface of bead seating periphery of metallic rim resulting in prevention of the slippage of the tyreover the rim when the automobile is subjected to severe braking and acceleration.No. of Pages : 6 No. of Claims : 0 PATENT OFFICE JOURNAL 02/03/2012 3605
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.363/MUM/2010 A(19) INDIA(22) Date of filing of Application :10/02/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : SERVICE DELIVERY PLATFORM DOCKING STATION(51) International classification :H04M3/42 (71)Name of Applicant :(31) Priority Document No :09425064.4 1)ACCENTURE GLOBAL SERVICES LIMITED(32) Priority Date :16/02/2009 Address of Applicant :3 GRAND CANAL PLAZA, GRAND(33) Name of priority country :EPO CANAL STREET UPPER, DUBLIN 4 IRELAND(86) Internati nal Application No :NA (72)Name of Inventor : Filing Date :NA 1)Raoul Vandenbulcke(87) International Publication No : NA 2)Alessandra Macchietti(61) Patent of Addition to Application Number :NA 3)Roberto Privitera Filing Date :NA 4)Dario Di Bella(62) Divisional to Application Number :NA 5)Paolo Filetti Filing Date :NA(57) Abstract :a services delivery platform (SDP) docking station (DS) is partn of a multiple layer service delivery platform implementation. TheSDP DS adds a second SDP layer between the end user and the Core SDP. The Core SDP implements the process flows that enable,provision, and execute telecommunications products and services, The SDP DS provides a customizable Front end to the Core SDP toproide local Services provider customization, flexible local selection and activation of products and services, and other features.No. of Pages : 31 No. of Claims : 11 PATENT OFFICE JOURNAL 02/03/2012 3606
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.407/MUM/2010 A(19) INDIA(22) Date of filing of Application :15/02/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : CROSS COMMUNITY INVITATION AND MULTIPLE PROVIDER PRODUCT INFORMATIONPROCESSING SYSTEM(51) International classification :G06F17/30 (71)Name of Applicant :(31) Priority Document No :09425065.1 1)ACCENTURE GLOBAL SERVICES LIMITED(32) Priority Date :16/02/2009 Address of Applicant :3 GRAND CANAL PLAZA, GRAND(33) Name of priority country :EPO CANAL STREET UPPER, DUBLIN 4 IRELAND(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)Alessandra Macchietti(87) International Publication No : NA 2)Roberto Privitera(61) Patent of Addition to Application Number :NA 3)Antonio Racioppoli Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A telecommunications system implements a cross platform invitation mechanism. The system receives a search query from asubscriber, retrieves location information of the subscriber, and retrieves a search result from multiple information sources based onthe search query. The system returns the search result to the subscriber, receives a search result selection from the search result fromthe subscriber, and builds a contact information list from community data associated to the subscriber and obtained from multiplecontact sources. The contact information list may include, for example, friends or other contacts for the subscriber. The system returnsthe contact information list to the subscriber, receives a contact selection from the contact information list from the subscriber; andtransmits an invitation message based on the contact selection to recipients corresponding to the contact selection. The recipients mayreturn an accept or deny response to the system, which notifies the subscriber accordingly.No. of Pages : 72 No. of Claims : 11 PATENT OFFICE JOURNAL 02/03/2012 3607
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.509/MUM/2010 A(19) INDIA(22) Date of filing of Application :25/02/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : REAR FLOOR STRUCTURE IN VEHICLE BODY REAR PART(51) International classification :B62D43/06 (71)Name of Applicant : :2009- 1)SUZUKI MOTOR CORPORATION(31) Priority Document No 051753 Address of Applicant :300, TAKATSUKA-CHO, MINAMI-(32) Priority Date :05/03/2009 KU, HAMAMATSU-SHI, SHIZUOKA-KEN, JAPAN(33) Name of priority country :Japan (72)Name of Inventor :(86) International Application No :NA 1)KODAI TANEDA Filing Date :NA(87) International Publication No :N/A(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A rear floor structure in a vehicle body rear part has a spare tire placing panel having an inclined surface inclined downward towardthe vehicle front provided above a rear floor, and a spare tire tiltingly mounted on the spare tire placing panel. In the rear floorstructure, in an intermediate portion in the front and rear direction of the spare tire placing panel, a convex part directed upward isprovided so as to extend along the vehicle width direction; between the rear floor and the spare tire placing panel in the verticaldirection, a space for disposing a jack, being a rigid member, is formed; and on the vehicle front side of the axis center of the jack onthe rear floor, a projecting part extending in the vehicle width direction is provided.No. of Pages : 20 No. of Claims : 7 PATENT OFFICE JOURNAL 02/03/2012 3608
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.510/MUM/2010 A(19) INDIA(22) Date of filing of Application :25/02/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : SPRING SEAT AND MOUNTING STRUCTURE FOR SPRING SEAT(51) International classification :B60G11/16 (71)Name of Applicant : :2009- 1)SUZUKI MOTOR CORPORATION(31) Priority Document No 081566 Address of Applicant :300, TAKATSUKA-CHO, MINAMI-(32) Priority Date :30/03/2009 KU, HAMAMATSU-SHI, SHIZUOKA-KEN, JAPAN(33) Name of priority country :Japan (72)Name of Inventor :(86) International Application No :NA 1)KENICHI ONDA Filing Date :NA(87) International Publication No :N/A(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A spring seat is mounted to a suspension arm to receive a coil spring of a suspension, a spring seat body is provided with a receivingpart for receiving the coil spring and a locking protrusion, which projects from the spring seat body to the side opposite to thereceiving part so as to be locked in a locking hole formed in the suspension arm, are formed integrally using an elastic member, and acore material harder than the elastic member is incorporated in the spring seat body and the locking protrusion.No. of Pages : 29 No. of Claims : 8 PATENT OFFICE JOURNAL 02/03/2012 3609
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.511/MUM/2010 A(19) INDIA(22) Date of filing of Application :25/02/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : SIMPLE, LIGHT REAR-VIEW MIRROR(51) International classification :B60R1/078 (71)Name of Applicant :(31) Priority Document No :EP09154893.3 1)SMR PATENTS S. A. R. L.(32) Priority Date :11/03/2009 Address of Applicant :LE DOME, 2-8 AVENUE, CHARLES(33) Name of priority country :EPO DE GAULLE, L-1653 LUXEMBOURG(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)LIESENER, ALF(87) International Publication No :N/A(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A mirror design is being suggested which encompasses a one-piece construction of a mirror with a mounting element. The height ofthe mounting element is thereby adjusted to the vehicles mirror triangle.No. of Pages : 17 No. of Claims : 6 PATENT OFFICE JOURNAL 02/03/2012 3610
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.513/MUM/2010 A(19) INDIA(22) Date of filing of Application :25/02/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : SCRAPPING PLATE FOR A COTTON PICKER(51) International classification :A01D46/18 (71)Name of Applicant :(31) Priority Document No :12/395,855 1)DEERE & COMPANY(32) Priority Date :02/03/2009 Address of Applicant :ONE JOHN DEERE PLACE,(33) Name of priority country :U.S.A. MOLINE, LLLINOIS, 61265, US U.S.A.(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)CHARLES FREDERICK OSTERMEIER(87) International Publication No : NA 2)KEVIN JACOB GOERING(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A scrapping plate includes alternating channels or pockets offset in the fore-and-aft direction relative each other to accommodate thedifferent spindle paths associated with spindie bars having spindles which are non-aligned or offset at an angle relative to each other.The offset pockets provide optimal spacing between the different spindle paths and the plate to ensure maximum contact between thespindle picking ends and the cotton bolls to maximize overall picking efficiency. In one embodiment, the pockets are identical butoffset in the spindle travel direction from each other and include leading and trailing ends which are angled or curved for conformingclosely to the different spindle paths.No. of Pages : 16 No. of Claims : 17 PATENT OFFICE JOURNAL 02/03/2012 3611
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.568/MUM/2009 A(19) INDIA(22) Date of filing of Application :17/09/2009 (43) Publication Date : 02/03/2012(54) Title of the invention : METHOD FOR AUTOMATIC DISINFECTION OF RAILWAY TRACK AT STATION :E01H (71)Name of Applicant :(51) International classification 8/00 1)LADKAT R. V.(31) Priority Document No :NA Address of Applicant :396, KASBA PETH, PUNE.(32) Priority Date :NA Maharashtra India(33) Name of priority country :NA (72)Name of Inventor :(86) International Application No :NA 1)LADKAT RAJENDRA VITHAL Filing Date :NA(87) International Publication No :N/A(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The rail track at station disinfecting system consist of the water sprinklers of jet nozzles are placed between rail sleepers controlled byelectronically operated control system, signaling train arrival and departure by a sensor fitted at both end of platform. Simultaneouslydisinfectant chemical foggers placed at side of track are operated by same control unit.No. of Pages : 10 No. of Claims : 10 PATENT OFFICE JOURNAL 02/03/2012 3612
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.656/MUM/2009 A(19) INDIA(22) Date of filing of Application :20/09/2009 (43) Publication Date : 02/03/2012(54) Title of the invention : AN IMPROVED FOOT VALVE :F04B (71)Name of Applicant :(51) International classification 53/10 1)VASANTRAO BAPURAO PATIL(31) Priority Document No :NA Address of Applicant :VASANTRAO BAPURAO PATIL(32) Priority Date :NA A/P-TOP, TAL - HATKANGALE, DIST-KOLHAPUR(33) Name of priority country :NA Maharashtra India(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)VASANTRAO BAPURAO PATIL(87) International Publication No : NA(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :An improved foot valve comprising an upper spherical metal body attached to taper shaped lower metal net with clamping in flange,lower metal body provided with inlet vertical ribs, flap weight is provided inside the body and middle hole of water hammercontrolling plate. The foot valve is immersed in the liquid and liquid enters through inlet ribs of net part of foot valve ,comes in to theupper chamber ,then due to water pressure flap weight goes upward and water flow through this gaps in to suction pipe .when there isno suction ,the liquid of the suction pipe fall on water hammer controlling plate ,mean while through gaps of this water hammercontrolling plate water fall on flap weight &flap weight goes down & fit through taper wall of body part and rubber flap of flapweight, thus preventing any reverse flow of the liquid from upper part to lower part of foot valve and holds liquid column above thewater hammer controlling plate.No. of Pages : 23 No. of Claims : 10 PATENT OFFICE JOURNAL 02/03/2012 3613
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.659/MUM/2010 A(19) INDIA(22) Date of filing of Application :12/03/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : A SUPPORT STRUCTURE FOR WINDOW WINDING ASSEMBLY(51) International classification :B65H75/00,B60J1/00 (71)Name of Applicant :(31) Priority Document No :NA 1)TATA MOTORS LIMITED(32) Priority Date :NA Address of Applicant :BOMBAY HOUSE, 24 HOMI MODY(33) Name of priority country :NA STREET, HUTATMA, CHOWK, MUMBAI 400 001,(86) International Application No :NA MAHARASHTRA, INDIA Filing Date :NA (72)Name of Inventor :(87) International Publication No :N/A 1)MR. VIJAY VEER SINGH(61) Patent of Addition to Application 2)MR. PRASHANT SAKHARAM ADARKAR :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :This invention related to a provision of window-winding handle at the protrusion of the arm-rest via. a secondary bearing-systemassembly to support the shaft of the window winding for smooth rotation of the shaft and hence reduced efforts. (Fig 2)No. of Pages : 9 No. of Claims : 9 PATENT OFFICE JOURNAL 02/03/2012 3614
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.660/MUM/2010 A(19) INDIA(22) Date of filing of Application :12/03/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : AN INTEGRATED TEST RIG FOR IN CAB MIRROR CONTROLLER.(51) International classification :G01M13/00 (71)Name of Applicant :(31) Priority Document No :NA 1)TATA MOTORS LIMITED(32) Priority Date :NA Address of Applicant :BOMBAY HOUSE, 24 HOMI, MODY(33) Name of priority country :NA STREET, HUTATMA CHOWK, MUMBAI 400 001,(86) International Application No :NA MAHARASHTRA, INDIA Filing Date :NA (72)Name of Inventor :(87) International Publication No :N/A 1)MS. SHILPA KALE(61) Patent of Addition to Application Number :NA 2)MR. SUDHIR SUTAR Filing Date :NA 3)MR. BAPU KHOMANE(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The present invention relates to an integrated test rig used for testing in-cab mirror controller and more particularly it relates to testingthe various functions in one cycle time. The object of this invention is to provide a tool for increasing product/component life undercustomer usage point of view. The test rig comprises a drive arrangement, a cam arrangement which driven by the drive arrangement,and the cam arrangement pushes vertical elements in sequence to activate switches of in-cab mirror controller located below thevertical elements. The selection switch in the controller is adjusted by an actuator. The different modes of selection are achieved bycontrolling the drive arrangement and actuator. The drive arrangement is supported on a frame and the actuator is placed on tablelocated near to the frame.No. of Pages : 21 No. of Claims : 10 PATENT OFFICE JOURNAL 02/03/2012 3615
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.673/MUM/2010 A(19) INDIA(22) Date of filing of Application :15/03/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : AN ECO-FRIENDLY PROCESS OF MANUFACTURING SUGAR WITHOUT USING ELECTRICITYAND CHEMICALS(51) International classification :C13B10/00 (71)Name of Applicant :(31) Priority Document No :NA 1)VISHWAS MADHAVRAO MARE(32) Priority Date :NA Address of Applicant :BANK STREET,PIMPALGAON(33) Name of priority country :NA BASWANT, TAL-NIPHED,DIST-NASHIK, MAHARASHTRA-(86) International Application No :NA 422209, MAHARASHTRA, INDIA Filing Date :NA (72)Name of Inventor :(87) International Publication No :N/A 1)VISHWAS MADHAVRAO MARE(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The present invention provides a process for producing sugar from sugarcane juice. The process includes steps of crushing sugarcaneto extract sugarcane juice. The extracted sugarcane juice is boiled and thereafter an extract of Hibiscus Ficulneus is added to the boiledsugarcane juice to remove molasses from the sugarcane juice. Further, the sugarcane juice is boiled at a temperature higher andthereafter the boiled sugarcane juice is cooled in a cooling tank. The cooled sugarcane juice is poured in to a baked earthen clayvessel, stirred and covered to remove separated crystals therefrom.No. of Pages : 12 No. of Claims : 6 PATENT OFFICE JOURNAL 02/03/2012 3616
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.676/MUM/2010 A(19) INDIA(22) Date of filing of Application :15/03/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : AN IMPROVED PROCESS FOR PREPARING SUBSTANTIALLY PURE SIMVASTATIN (71)Name of Applicant : 1)STRELING BIOTECH RESEARCH CENTER A CORPORATE RESEARCH CENTER OF STERLING(51) International classification :C07D309/00 BIOTECH LIMITED(31) Priority Document No :NA Address of Applicant :STRELING BIOTECH RESEARCH(32) Priority Date :NA CENTER, A CORPORATE RESEARCH CENTER OF(33) Name of priority country :NA STERLING BIOTECH LIMITED, JAMBUSAR STATE(86) International Application No :NA HIGHWAY, VILLAGE MASAR-391421, Filing Date :NA TA.:PADRA,DIST.:VADODARA, GUJARAT,INDIA(87) International Publication No :N/A (72)Name of Inventor :(61) Patent of Addition to Application Number :NA 1)SUGATA CHATTERJEE Filing Date :NA 2)AJAY SINGH RAWAT(62) Divisional to Application Number :NA 3)NEERAJ KUMAR Filing Date :NA 4)JETTI RAJANIKANTH 5)P.VENKATESWARULU 6)KUNDAN SINGH SHEKHAWAT 7)JIGAR H SHAH(57) Abstract :This invention relates to an improved process for preparing substantially pure simvastatin (I), chemically known as (1S, 3R,7S,8S,8aR)-8-[2-[(2R,4R)-4-hydroxy-6-oxotetrahydro-2-H-pyran-2-yl]ethyI]-3,7-dimeth-yl-K23,7,8,8a-Hexahyclronaphthalen-l-yl2;2-dimethyl butanoate, which comprises of: a) treating lovastatin (II) with an alkali metal hydroxide in a chosen suitable alcoholicsolvent followed by relactonization to obtain the diol lactone intermediate (III) in a single vessel. b) selective silylation of 4-hydroxygroup of diol lactone intermediate (III) with a chosen suitable silylating reagent to obtain mono silylated intermediate diol lactone(IV). c) acylation of the mono silylated intermediate (IV) to form silylated simvastatin (V) Or optionally, preparing silylatedsimvastatin (V) starting from Lovastatin (II) without isolating diol lactone (III) and monosilylated diol lactone (IV) and d) finally,removal of the silyl protecting group on silylated simvastatin (V) followed by purification to provide substantially pure simvastatin (I).No. of Pages : 25 No. of Claims : 15 PATENT OFFICE JOURNAL 02/03/2012 3617
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.674/MUM/2010 A(19) INDIA(22) Date of filing of Application :15/03/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : AN ARRANGEMENT FOR MOUNTING FUEL CYLINDERS IN A VEHICLE :B60K (71)Name of Applicant :(51) International classification 15/00 1)TATA MOTORS LIMITED(31) Priority Document No :NA Address of Applicant :BOMBAY HOUSE, 24 HOMI MODY(32) Priority Date :NA STREET, HUTATMA CHOWK, MUMBAI 400 001,(33) Name of priority country :NA MAHARASHTRA, INDIA(86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)PRIYADARSHI SINGH(87) International Publication No :N/A 2)GHNV DURGA PRASAD(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A fuel cylinder mounting structure in a motorcar wherein fuel cylinder can be attached securely under body using efficiently the spaceavailable below Rear seat and forward to the spare wheel and rear suspension. The fuel cylinder mounting structure comprise fuelcylinder for storing compressed fuel gas, support structure to facilitate the mounting of another cylinder with the tubular cradle andstrap arrangement to support/hold the additional cylinder optimally utilizing the space available to ensure maximum fuel packaging.No. of Pages : 18 No. of Claims : 14 PATENT OFFICE JOURNAL 02/03/2012 3618
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.680/MUM/2010 A(19) INDIA(22) Date of filing of Application :15/03/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : SHIPPER CUM SHELF AND DISPLAY BOX(51) International classification :B65D5/00 (71)Name of Applicant :(31) Priority Document No :NA 1)MR . HARESH MEHTA(32) Priority Date :NA Address of Applicant :JAYANT HOUSE,BAIL BAZAR,(33) Name of priority country :NA ANDHERI-KURLA ROAD KURLA, MUMBAI 400 070(86) International Application No :NA MAHARASHTRA,INDIA. Filing Date :NA (72)Name of Inventor :(87) International Publication No :N/A 1)MR . HARESH MEHTA(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The invention is for a shipper cum display box made from foldable, creasable sheet blank that is die creased to form common edgesand die cut to be folded into a six sided box. The box is defined by oppositely placed front and back panels connected by a pair ofadjacent side panels, and a top and bottom panel, each of which is comprised of a pair of upper and lower closure flaps. The box hasatleast one pair of asymmetrical upper closure flaps, the larger of which has a die creased line running parallel to the common edge ofthe top and front panel. The lower closure flap of the top panel has a corresponding die creased line. The front panel is further dieperforated to form a line extending between the common edge of the side panel and front panel. This die perforated line extendsupwardly onto both the side panels up to the die creased line defining the lower closure flap, such that when the perforations arereleased, the front panel opens partially hinging upon the pair of die creased lines. The closure flaps of the top panels rest over oneanother to form a display shelf. The released section of the front panel, now perpendicular to the shelf, forms the display back.No. of Pages : 22 No. of Claims : 10 PATENT OFFICE JOURNAL 02/03/2012 3619
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.685/MUM/2010 A(19) INDIA(22) Date of filing of Application :15/03/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : SUSTAINED RELEASE PELLETS COMPRISING NSAID(51) International classification :A61K31/00 (71)Name of Applicant :(31) Priority Document No :NA 1)INVENTIA HEALTHCARE PRIVATE LIMITED(32) Priority Date :NA Address of Applicant :UNIT NO. S-4, KHIRA INDUSTRIAL(33) Name of priority country :NA ESTATE, B.M BHARGAVA ROAD, SANTACRUZ WEST,(86) International Application No :NA MUMBAI 400054, MAHARASHTRA, INDIA Filing Date :NA (72)Name of Inventor :(87) International Publication No :N/A 1)JAISWAL SUNIL BEHARILAL(61) Patent of Addition to Application Number :NA 2)SHAH ANKUR JANAK Filing Date :NA 3)JAIN JAYESH MANAKCHAND(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The present invention provides non-coated sustained release pharmaceutical compositions comprising non-steroidal anti-inflammatorydrug and a process for it preparation thereof. These non-coated sustained release pharmaceutical compositions are preferably in theform of pellets or tablets and exhibits desired in-vitro release characteristics.No. of Pages : 21 No. of Claims : 10 PATENT OFFICE JOURNAL 02/03/2012 3620
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.689/MUM/2010 A(19) INDIA(22) Date of filing of Application :15/03/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : NATURAL BLUE PIGMENT AND PROCESS FOR PRODUCING THE SAME (71)Name of Applicant : 1)NORTH MAHARASHTRA UNIVERSITY(51) International classification :C09B67/00 Address of Applicant :SCHOOL OF LIFE SCIENCES(31) Priority Document No :NA NORTH MAHARASHTRA UNIVERSITY PB(32) Priority Date :NA 80,UMAVINAGAR JALGAON,425001,MS Maharashtra India(33) Name of priority country :NA (72)Name of Inventor :(86) International Application No :NA 1)DR . PRAVIN RAMCHANDRA PURANIK Filing Date :NA 2)MR . DEVENDRA VINAYKUMAR DESHMUKH(87) International Publication No :N/A 3)MR . PARAG VISHWANATH PANDAV(61) Patent of Addition to Application Number :NA 4)MR . VIJAY EKNATH PATEL Filing Date :NA 5)DR . SUNIL TRIMBAK PAWAR(62) Divisional to Application Number :NA 6)DR .(MRS.) KANAN PRAVIN PURANIK Filing Date :NA 7)N/A 8)N/A(57) Abstract :Phycocyanin pigment gives cyanobacteria their bluish color and it is because of these pigments that cyanobacteria are also known asblue-green algae. Phycocyanin is water soluble, strongly fluorescent and has antioxidant properties. The present invention relates to anatural blue pigment and a process for producing the same. More specifically, the invention relates to a natural blue pigment fromcyanobacteria and a process for production of the said pigment, wherein mass cultivation of the cyanobacteria Spirulina is carried outand the natural pigment is further extracted from the said Spirulina biomass.No. of Pages : 12 No. of Claims : 9 PATENT OFFICE JOURNAL 02/03/2012 3621
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.696/MUM/2010 A(19) INDIA(22) Date of filing of Application :17/03/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : DISTRIBUTED CURRENT SENSING SYSTEM FOR AC AND DC SYSTEMS(51) International classification :G01R11/00 (71)Name of Applicant :(31) Priority Document No :NA 1)LARSEN & TOUBRO LIMITED(32) Priority Date :NA Address of Applicant :L & T HOUSE,BALLARD ESTATE,(33) Name of priority country :NA P.O.BOX NO.278, MUMBAI,400 001,(86) International Application No :NA MAHARASHTRA,INDIA. Filing Date :NA (72)Name of Inventor :(87) International Publication No :N/A 1)RUDRA PRASAD GHOSAL(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The various embodiments of the present invention provide a technique for dynamic sensing of the current flow in a single phase or athree phase electrical conductor system by measuring the magnetic field strength around the conductor. The current sensor assemblycomprises a conductor and a plurality of Hall Effect sensors arranged radially away from the conductor. The plurality of Hall Effectsensors produces output signals representative of the strength of the magnetic field passing through the conductor. A signal processingsystem measures a weighted average of the output from the plurality of Hall Effect sensors to measure the magnitude of currentflowing through the conductor.No. of Pages : 28 No. of Claims : 8 PATENT OFFICE JOURNAL 02/03/2012 3622
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.697/MUM/2010 A(19) INDIA(22) Date of filing of Application :17/03/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : CONTACT LOCKING SYSTEM FOR CIRCUIT BREAKERS(51) International classification :H01H73/00 (71)Name of Applicant :(31) Priority Document No :NA 1)LARSEN & TOUBRO LIMITED(32) Priority Date :NA Address of Applicant :L & T HOUSE,BALLARD ESTATE,(33) Name of priority country :NA P.O.BOX NO.278, MUMBAI,400 001,(86) International Application No :NA MAHARASHTRA,INDIA. Filing Date :NA (72)Name of Inventor :(87) International Publication No :N/A 1)NAYAN B DEGDA(61) Patent of Addition to Application Number :NA 2)NILEAH K SAWAI Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The various embodiments of the present invention provide an improved moving contact locking system in a circuit breaker. Thecontact locking system for moving contact comprises a driveshaft, a moving contact attached to the driveshaft, a contact pin fastenedto the moving contact, a roller assembled to the drive shaft, a roller pin inserted and mounted on the roller. At least two contact springshinged between the roller pin and the drive shaft. The contacts springs exerts a force on the moving contact to generate a torque on themoving contact about the axis of rotation to provide a contact force to lock the moving contact.No. of Pages : 19 No. of Claims : 7 PATENT OFFICE JOURNAL 02/03/2012 3623
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.700/MUM/2010 A(19) INDIA(22) Date of filing of Application :17/03/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : AN IMPROVED FORMULATION OF NONSTEROIDAL ANTIINFLAMMATORY DRUG (NSAID)(51) International classification :A61K31/00 (71)Name of Applicant :(31) Priority Document No :NA 1)BA REASERCH INDIA LIMITED(32) Priority Date :NA Address of Applicant :BA RESEARCH HOUSE, OPPOSITE(33) Name of priority country :NA PUSHPARAJ TOWER, NR.JUDGES BUNGLOWS,(86) International Application No :NA BODAKDEV, AHMEDABAD-380054, GUJARAT, INDIA Filing Date :NA (72)Name of Inventor :(87) International Publication No :N/A 1)SHARMA , NAVEEN(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The present invention discloses a composition for use in a method of alleviating pain which comprises administering to a mammalexhibiting pain (a) an analgesia-inducing amount of a non-narcotic analgesic such as an NSAID coxibs and (b) an analgesia enhancingamount of at least one analgesia enhancer. Furthermore, the therapeutic composition is applicable to the treatment of all varieties ofpain and not just those associated with inflammation, pain as in the prior art.No. of Pages : 22 No. of Claims : 10 PATENT OFFICE JOURNAL 02/03/2012 3624
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.702/MUM/2010 A(19) INDIA(22) Date of filing of Application :17/03/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : A PROCESS FOR THE PREPARATION OF POLYSTER RESIN EMPLOYING A CATALYSTCOMPRISING OF ANTIMONY AND INORGANIC TIN COMPOUNDS (71)Name of Applicant :(51) International classification :C08G63/00 1)RELIANCE INDUSTRIES LIMITED(31) Priority Document No :NA Address of Applicant :RELIANCE TECHNOLOGY GROUP,(32) Priority Date :NA RELIANCE CORPORATE PARK, 7B GROUND(33) Name of priority country :NA FLOOR,THANE-BELAPUR ROAD, GHANSOLI, NAVI(86) International Application No :NA MUMBAI-400 701, MAHARASHTRA, INDIA Filing Date :NA (72)Name of Inventor :(87) International Publication No :N/A 1)AYODHYA , SRINIVASCHARYA , RAMACHARYA(61) Patent of Addition to Application Number :NA 2)LIMAYE, CHETAN VIJAY Filing Date :NA 3)PUSHAP , SUDAN(62) Divisional to Application Number :NA 4)JADIMATH , SHIVAMURTHY PADADAYYA Filing Date :NA 5)PAWASHE, NANDKUMAR, GOPAL 6)BHANGALE , VIKAS KADU(57) Abstract :The present invention relates to a process for preparation of polyester resin in the presence of a novel catalyst system comprising anantimony compound and inorganic tin compound. The present invention also relates to a catalyst system for the preparation ofpolyester comprising an antimony compound and inorganic tin compound which reduces the polymerization time at all stages ofpolyester synthesis and reduces the generation of degradation product. This invention further relates to polyester resin with improvedL color having significant importance in end-use applications.No. of Pages : 18 No. of Claims : 19 PATENT OFFICE JOURNAL 02/03/2012 3625
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.718/MUM/2010 A(19) INDIA(22) Date of filing of Application :18/03/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : A HIGH EFFICIENCY DOUBLE EFFECT CHILLER HEATER APPARATUS(51) International classification :F25B17/02 (71)Name of Applicant :(31) Priority Document No :NA 1)THERMAX LIMITED(32) Priority Date :NA Address of Applicant :D-13, MIDC INDUSTRIAL AREA,(33) Name of priority country :NA R.D. AGA ROAD, CHINCHWAD, PUNE - 411 019,(86) International Application No :NA MAHARASHTRA, INDIA Filing Date :NA (72)Name of Inventor :(87) International Publication No :N/A 1)BALU RADHAKRISHNAN(61) Patent of Addition to Application Number :NA 2)BABU P. Filing Date :NA 3)SWAPNA KULKARNI(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The absorption chiller-heater apparatus of present invention utilizes a portion of direct heat, used to heat water, for providing therefrigeration effect. The external heat input required for providing refrigeration is minimal; hence, the efficiency of the apparatus isincreased by 30 - 40 % over the conventional systems. Further, as the quantum of the external heat source required for a new cycle isreduced, the size of the high temperature generator required, is smaller, which results in lower capital costs. The apparatus provideschilled water which can be used for various industrial purposes. The absorption chiller-heater reduces CO2 emissions and utilizes asingle arrangement to produce both heating and refrigeration effect. Thus, additional electrical and heat input or separate componentsare not required.No. of Pages : 45 No. of Claims : 14 PATENT OFFICE JOURNAL 02/03/2012 3626
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.719/MUM/2010 A(19) INDIA(22) Date of filing of Application :18/03/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : A SYSTEM FOR DETERMINATION OF PULSE STRENGTH (71)Name of Applicant :(51) International classification :A61B5/00 1)SECERETARY, DEAPARTMENT OF INFORMATION(31) Priority Document No :NA TECHNOLOGY(DIT)(32) Priority Date :NA Address of Applicant :MINISTRY OF COMMUNICATIONS(33) Name of priority country :NA AND INFORMATION TECHNOLOGY, GOVERNMENTS OF(86) International Application No :NA INDIA, 6, CGO COMPLEX, LODHI ROAD, NEW DELHI Filing Date :NA 110003, INDIA(87) International Publication No :N/A 2)CENTRE FOR DEVELOPMENT OF ADVANCED(61) Patent of Addition to Application Number :NA COMPUTING(C-DAC) Filing Date :NA (72)Name of Inventor :(62) Divisional to Application Number :NA 1)DHURANDHAR, MEDHA SANJEEV Filing Date :NA 2)TILLU GIRISH SHRIKRISHNA(57) Abstract :A system and method for determination of strength of pulse at the radial artery of a subject has been disclosed. The system includespulse sensing means to sense pulse in the radial artery and generate signals corresponding to rate of change of impedance. Thesesignals are de-noised provided to deriving means which derives an impedance waveform from the de-noised signals. This impedancewaveform includes three sub waves and processing means is used to identify at least six major deflection points corresponding to thesub waves. Further, ratio computing means is used to compute predetermined ratios based on co-ordinates of the deflection points.This ratio are matched with rules containing reference ratios pre-stored in a rule repository and the strength of pulse corresponding tothe matched ratio is extracted using extraction means and is notified using notification means.No. of Pages : 25 No. of Claims : 11 PATENT OFFICE JOURNAL 02/03/2012 3627
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.731/MUM/2010 A(19) INDIA(22) Date of filing of Application :19/03/2010 (43) Publication Date : 02/03/2012(54) Title of the invention : PROCESS FOR PREPARATION OF DISTRONTIUM5-[BIS(2-OXIDO-2-OXOETHYI)AMINO]-4-CYANO-3-(2-OXIDO-2-OXOETHYI) THIOPHENE-2-CARBOXYLATE(51) International classification :C07D333/38 (71)Name of Applicant :(31) Priority Document No :NA 1)ENALTEC LABS PRIVATE LIMITED.(32) Priority Date :NA Address of Applicant :B-501, GREAT EASTERN SUMMIT,(33) Name of priority country :NA PLOT NO.-66, SECTOR-15, CBD BELAPUR, NAVI MUMBAI-(86) International Application No :NA 400 614, Maharashtra India Filing Date :NA (72)Name of Inventor :(87) International Publication No :N/A 1)SIVA KUMAR VENKATA BOBBA(61) Patent of Addition to Application Number :NA 2)ESWARA RAO KODALI Filing Date :NA 3)GIRISH BANSILAL PATEL(62) Divisional to Application Number :NA 4)SANJAY DASHRATH VAIDYA Filing Date :NA 5)ALOK PRAMOD TRIPATHI(57) Abstract :The present invention provides a process for producing distrontium 5-[bis (2-oxido-2- oxoethyl) amino]-4-cyano-3-(2-oxido-2-oxoethyl) thiophene-2-carboxylate comprising reacting a compound of formula V with strontium hydroxide. Formula V wherein R5,R6, R7 and R8, which may be the same or different, each represent independently a -NR9R10 or -OR12 with the proviso that at leastone of the R5, R6, R7 and R8 is -NR9R10. R9. R10 and R12 are independently hydrogen, linear or branched C1-C6 alkyl group or asubstituted or unsubstituted C3-C12 cyclic group.No. of Pages : 17 No. of Claims : 10 PATENT OFFICE JOURNAL 02/03/2012 3628
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.796/MUMNP/2011 A(19) INDIA(22) Date of filing of Application :21/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : WIRELESS COMMUNICATION TERMINAL APPARATUS, WIRELESS COMMUNICATION BASESTATION APPARATUS, AND CLUSTER CONSTELLATION SETTING METHOD(51) International classification :H04J 99/00 (71)Name of Applicant :(31) Priority Document No :2008-292653 1)PANASONIC CORPORATION(32) Priority Date :14/11/2008 Address of Applicant :1006, OAZA KADOMA, KADOMA-(33) Name of priority country :Japan SHI, OSAKA 5718501, JAPAN(86) International Application No :PCT/JP2009/006086 (72)Name of Inventor : Filing Date :13/11/2009 1)TAKAOKA, SHINSUKE(87) International Publication No :WO/2010/055676 2)NAKAO, SEIGO(61) Patent of Addition to Application 3)IMAMURA, DAICHI :NANumber 4)HOSHINO, MASAYUKI :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A wireless communication terminal apparatus wherein even when a SC-FDMA signal is divided into a plurality of clusters and theplurality of clusters are then mapped to respective discontinuous frequency bands (when C-SC-FDMA is used), the improvementeffect of system throughput can be maintained, while the user throughput can be improved. In the apparatus, a DFT unit (210) subjectsa symbol sequence of time domain to a DFT process, thereby generating signals of frequency domain. A setting unit (211) divides thesignals input from the DFT unit (210) into a plurality of clusters according to a cluster pattern that is in accordance with an MCS set,an encoding size, or the number of Ranks occurring during MIMO transmissions, which is indicated in those signals input, and thenmaps the plurality of clusters to the respective ones of a plurality of discontinuous frequency resources, thereby setting a constellationof the plurality of clusters in the frequency domain.No. of Pages : 121 No. of Claims : 21 PATENT OFFICE JOURNAL 02/03/2012 3629
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.1989/CHE/2008 A(19) INDIA(22) Date of filing of Application :18/08/2008 (43) Publication Date : 02/03/2012(54) Title of the invention : A METHOD TO PROVIDE AN OPTION TO THE CUSTOMER RELATION MANAGEMENT (CRM)USER TO SELECT FROM A LIST OF SHORT MESSAGE SERVICE (SMS) GATEWAYS FROM THE GRAPHICAL USERINTERFACE (GUI) BEFORE SENDING OUT AN MESSAGE(51) International classification :H04W (71)Name of Applicant :(31) Priority Document No :NA 1)TALISMA CORPORATION PRIVATE LTD.(32) Priority Date :NA Address of Applicant :214/6, RAMANAMAHARISHI(33) Name of priority country :NA ROAD, SADAHIVANAGAR, BANGALORE- 560 080(86) International Application No :NA Karnataka India Filing Date :NA (72)Name of Inventor :(87) International Publication No : NA 1)BHATNAGAR ANEESH(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A method and system to transmit SMS message to an SMS Gateway (belonging to selected Service Provider) selected from a list onthe GUI component of the CRM application, depending upon the geographical location of the Customer is disclosed. The GUIcomponent provides a list of configured Service Providers that may be selected before sending outbound SMS message to a recipient.A unique Service Provider identifier is assigned to each of the configured Service Provider belonging to Customer’s network/country.Depending upon the geographical location of the Customer, the Service Provider is selected from the list on the GUI component andthe SMS message is transmitted to the customer wherein the method identifies the SMS Gateway to which it has to connect, andtransmits the SMS message. The method internally fetches the details of SMS Gateway based on Service Provider ID and uses it tocommunicate with the appropriate SMS Gateway.No. of Pages : 31 No. of Claims : 13 PATENT OFFICE JOURNAL 02/03/2012 3630
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2191/CHENP/2005 A(19) INDIA(22) Date of filing of Application :08/09/2005 (43) Publication Date : 02/03/2012(54) Title of the invention : CONTENT EXCHANGE BETWEEN PORTABLE DEVICE AND NETWORK(51) International classification :G06F 12/00 (71)Name of Applicant :(31) Priority Document No :03100587.9 1)KONINKLIJKE PHILIPS ELECTORNICS N.V.(32) Priority Date :10/03/2003 Address of Applicant :GROENEWOUDSEWEG 1, NL-5621 :EUROPEAN BA EINDHOVEN. Netherlands(33) Name of priority country UNION (72)Name of Inventor :(86) International Application No :PCT/IB04/50173 1)VAN DE SLUIS, BARTEL M. Filing Date :01/03/2004 2)DIEDERIKS, ELMO. M.,A., :WO 2004(87) International Publication No /081793(61) Patent of Addition to Application Number :NA Filing Date :NA(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A service is provided to a user of a mobile CE device with an onboard memory for storing content information. Upon acommunication path being established to the device, the device is caused to conditionally overwrite the stored content informationwith new content information so as to keep the memory substantially filled. The user is enabled to control the conditions foroverwriting.No. of Pages : 14 No. of Claims : 19 PATENT OFFICE JOURNAL 02/03/2012 3631
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2234/CHENP/2011 A(19) INDIA(22) Date of filing of Application :01/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : PHARMACEUTICAL FORMULATIONS COMPRISING PEMETREXED :A61K9/20, (71)Name of Applicant :(51) International classification A61K31/519 1)Dr. Reddy™s Laboratories Limited(31) Priority Document No :2207/CHE/2008 Address of Applicant :Dr. Reddy™s Laboratories Limited 7-(32) Priority Date :11/09/2008 1-27 Ameerpet Hyderabad Andhra Pradesh India.(33) Name of priority country :India 2)Dr.Reddy™s Laboratories Inc.(86) International Application No :PCT/US2009/056211 (72)Name of Inventor : Filing Date :08/09/2009 1)Chandrasekhar Kocherlakota(87) International Publication No : NA 2)Raghuveera Hathibelagal Goruva(61) Patent of Addition to Application 3)Krishnam Raju Kovoru :NANumber 4)Nagaraju Banda :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :Pharmaceutical formulations comprising amorphous pemetrexed or its salts, and processes to prepare the formulations.No. of Pages : 33 No. of Claims : 10 PATENT OFFICE JOURNAL 02/03/2012 3632
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2233/CHENP/2011 A(19) INDIA(22) Date of filing of Application :01/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : NETWORK TOPOLOGY FOR MONITORING AND CONTROLLING A SOLAR PANEL ARRAY :F24J2/40, (71)Name of Applicant :(51) International classification H01L31/042 1)PACECO CORP.(31) Priority Document No :12/243,890 Address of Applicant :25503 Whitesell Street Hayward CA(32) Priority Date :01/10/2008 94545 United States of America(33) Name of priority country :U.S.A. (72)Name of Inventor :(86) International Application No :PCT/US2009/002684 1)TAKEHARA Toru Filing Date :30/04/2009 2)TAKADA Shinichi(87) International Publication No : NA(61) Patent of Addition to Application :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :Embodiments of a network topology for monitoring and controlling an array of solar panels include an intelligent node adapted tosend and receive data and commands by at least two redundant means of communication. An intelligent node includes a solar panel, anode controller, a photovoltaic module, a bypass relay, a bypass bus, PLC and wireless communication interfaces for redundant meansof communication, and sensor and actuator interfaces for monitoring and controlling the intelligent node. A PV module in theintelligent node may selectively be bypassed without interrupting network communications. Some embodiments include a plurality ofintelligent nodes electrically connected serially into a chain of nodes and further connected to a gateway. Other embodiments include aplurality of chains of nodes connected to an inverter and a transformer, thereby defining an area.No. of Pages : 29 No. of Claims : 29 PATENT OFFICE JOURNAL 02/03/2012 3633
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2235/CHENP/2011 A(19) INDIA(22) Date of filing of Application :01/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : SHORT MESSAGE ALERT (SMA)(51) International classification :G06Q10/00 (71)Name of Applicant :(31) Priority Document No :NA 1)Accenture Global Services Limited(32) Priority Date :NA Address of Applicant :3 Grand Canal Plaza Grand Canal(33) Name of priority country :NA Street Upper Dublin 4 Ireland(86) International Application No :PCT/EP2008/009553 (72)Name of Inventor : Filing Date :12/11/2008 1)BAKIR Huzefa Yusuf(87) International Publication No : NA(61) Patent of Addition to Application :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The present description refers in particular, to a method, a system, and a computer program product for processing messages in anOutsourcing (BPO) Environment. The method may comprise installing and executing one or more computer programs. The methodmay also comprise obtaining messages from a shared folder using a network interface. The method may further comprise displayingmessages using a display interface. In addition, the method may comprise providing access control, including controlling access tomessages and dissemination of messages. The BPO environment may comprise at least one user computer. The network interface andthe display interface may be executed separately on the user computer.No. of Pages : 41 No. of Claims : 15 PATENT OFFICE JOURNAL 02/03/2012 3634
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2258/CHENP/2011 A(19) INDIA(22) Date of filing of Application :02/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : ACKNOWLEDGMENT BASED ON SHORT CELL RADIO NETWORK TEMPORARY IDENTIFIER :H04W72/14, (71)Name of Applicant :(51) International classification H04L1/12 1)QUALCOMM Incorporated(31) Priority Document No :61/108,302 Address of Applicant :Attn: International IP Administration(32) Priority Date :24/10/2008 5775 Morehouse Drive San Diego California 92121-1714(33) Name of priority country :U.S.A. UNITED STATES OF AMERICA(86) International Application No :PCT/US2009/061837 (72)Name of Inventor : Filing Date :23/10/2009 1)PALANKI Ravi(87) International Publication No : NA 2)GOROKHOV Alexei Y.(61) Patent of Addition to Application :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :Systems and methodologies are described that facilitate identifying resources upon which an acknowledgment can be sent or receivedin a wireless communication environment that leverages coordinated multi-point (CoMP). The resources can be identified based upona criterion that can be identifiable to a non-anchor cell base station (as well as an anchor cell base station, a mobile device, etc.). Thecriterion can be an identifier corresponding to a mobile device, where the identifier maps to a predetermined set of resources.Examples of the identifier can include a media access control identifier (MACID), a cell radio network temporary identifier (C-RNTI),a short C-RNTI, etc. Further, the criterion can be physical resources corresponding to a transmission, where the acknowledgment isresponsive to the transmission. Moreover, the acknowledgment can be sent or received in connection with a cooperation technique(e.g., joint transmission via inter-site packet sharing, cooperative beamforming, cooperative silence, ).No. of Pages : 59 No. of Claims : 50 PATENT OFFICE JOURNAL 02/03/2012 3635
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2261/CHENP/2011 A(19) INDIA(22) Date of filing of Application :02/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : METHOD AND APPARATUS FOR UPLINK NETWORK MIMO IN A WIRELESSCOMMUNICATION SYSTEM :H04L5/00, (71)Name of Applicant :(51) International classification H04L1/00 1)QUALCOMM Incorporated(31) Priority Document No :61/108,294 Address of Applicant :Attn: International IP Administration(32) Priority Date :24/10/2008 5775 Morehouse Drive San Diego California 92121-1714(33) Name of priority country :U.S.A. UNITED STATES OF AMERICA(86) International Application No :PCT/US2009/061850 (72)Name of Inventor : Filing Date :23/10/2009 1)GOROKHOV Alexei Y.(87) International Publication No : NA 2)PALANKI Ravi(61) Patent of Addition to Application :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :Systems and methodologies are described herein that facilitate generation and processing of control signaling to support uplinknetwork multiple-in-multiple-out (N-MIMO) communication in a wireless communication system. As described herein, respectivenetwork nodes associated with an uplink N-MIMO framework can generate channel state information (CSI) corresponding to anuplink channel from a designated network user to the respective nodes. Generated CSI can subsequently be communicated to anuplink anchor node for the network user in order to facilitate rate assignment, scheduling, and/or other operations with respect to thenetwork user. As described herein, CSI generated and reported by respective cells can include channel profiles, carrier/interferenceprofiles, estimated supported uplink rates, or the like. As additionally described herein, supplemental information such as observedinterference levels, demodulation indicators, or the like can be communicated to an anchor node and utilized in rate assignment and/orscheduling.No. of Pages : 50 No. of Claims : 50 PATENT OFFICE JOURNAL 02/03/2012 3636
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2259/CHENP/2011 A(19) INDIA(22) Date of filing of Application :02/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : REDUCED SIZE MULTI-PIN FEMALE RECEPTACLE CONNECTOR :H01R13/658, (71)Name of Applicant :(51) International classification H01R12/16 1)Apple Inc.(31) Priority Document No :61/101,151 Address of Applicant :1 Infinite Loop M/S 40-PAT(32) Priority Date :30/09/2008 Cupertino CA 95014 UNITED STATES OF AMERICA(33) Name of priority country :U.S.A. (72)Name of Inventor :(86) International Application No :PCT/US2009/058811 1)SLOEY Jason Filing Date :29/09/2009 2)LYNCH S. Brian(87) International Publication No : NA 3)ZADESKY Stephen Paul(61) Patent of Addition to Application :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :Receptacle connectors and male plug connectors having a reduced size in at least one direction can be provided. One example reducesheight by not including a center contact tab or tongue, but instead places contacts on an insulator that is adjacent to a bottom portion ofthe receptacle. Another example may reduce width by reducing contact pitch, and may use a particular shape of contact to achieve godsignal quality. Receptacle connectors and male plug connectors can also provide support for one or more new high-speedcommunication standards, such as USB 3.0 and DisplayPort. Methods can provide one or more standardized connector components tospeed connector design and manufacture of new electronic devices such as media players, thus reducing their time to market.No. of Pages : 52 No. of Claims : 27 PATENT OFFICE JOURNAL 02/03/2012 3637
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2262/CHENP/2011 A(19) INDIA(22) Date of filing of Application :02/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : REDUCED SIZE MULTI-PIN MALE PLUG CONNECTOR :H01R13/24, (71)Name of Applicant :(51) International classification H01R12/16 1)Apple Inc.(31) Priority Document No :61/101,151 Address of Applicant :1 Infinite Loop M/S 40-PAT(32) Priority Date :30/09/2008 Cupertino CA 95014 U.S.A.(33) Name of priority country :U.S.A. (72)Name of Inventor :(86) International Application No :PCT/US2009/058793 1)SLOEY Jason Filing Date :29/09/2009 2)LYNCH S. Brian(87) International Publication No : NA 3)ZADESKY Stephen Paul(61) Patent of Addition to Application :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :Receptacle connectors and male plug connectors having a reduced size in at least one direction can be provided. One example reducesheight by not including a center contact tab or tongue, but instead places contacts on an insulator that is adjacent to a bottom portion ofthe receptacle. Another example may reduce width by reducing contact pitch, and may use a particular shape of contact to achieve godsignal quality. Receptacle connectors and male plug connectors can also provide support for one or more new high-speedcommunication standards, such as USB 3.0 and DisplayPort. Methods can provide one or more standardized connector components tospeed connector design and manufacture of new electronic devices such as media players, thus reducing their time to market.No. of Pages : 51 No. of Claims : 23 PATENT OFFICE JOURNAL 02/03/2012 3638
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2260/CHENP/2011 A(19) INDIA(22) Date of filing of Application :02/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : METHOD AND APPARATUS OF COMMUNICATION(51) International classification :H04W24/00 (71)Name of Applicant :(31) Priority Document No :NA 1)Huawei Technologies Co. Ltd.(32) Priority Date :NA Address of Applicant :Huawei Administration Building(33) Name of priority country :NA Bantian Longgang District Shenzhen Guangdong 518129 P.R.(86) International Application No :PCT/CN2008/072543 China. Filing Date :26/09/2008 (72)Name of Inventor :(87) International Publication No : NA 1)OLOFSSON Henrik(61) Patent of Addition to Application 2)JOHANSSON Johan :NANumber 3)RUUSKA Tauno :NA Filing Date 4)TENGQVIST Per(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The invention pertains to wireless service provision comprising reception or transmission of wireless signals from/to acommunications system not available for public communications in an environment providing telecommunications services of anothercommunications system. An example embodiment of the invention explores and implements triggering of a user equipment to performtest or measurement of a target network from an originating network, whereas the user equipment triggers establishment of acommunications channel in the target network, the target network providing test signals to the user equipment.No. of Pages : 29 No. of Claims : 19 PATENT OFFICE JOURNAL 02/03/2012 3639
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2263/CHENP/2011 A(19) INDIA(22) Date of filing of Application :02/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : METHODS AND APPARATUS FOR SYSTEM SELECTION IN A MULTIMODE WIRELESSDEVICE (71)Name of Applicant :(51) International classification :H04W48/18 1)QUALCOMM Incorporated(31) Priority Document No :61/107,630 Address of Applicant :Attn: International IP Administration(32) Priority Date :22/10/2008 5775 Morehouse Drive San Diego California 92121-1714(33) Name of priority country :U.S.A. UNITED STATES OF AMERICA(86) International Application No :PCT/US2009/061721 (72)Name of Inventor : Filing Date :22/10/2009 1)BALASUBRAMANIAN Srinivasan(87) International Publication No : NA 2)DESHPANDE Manoj M.(61) Patent of Addition to Application :NA 3)KLINGENBRUNN ThomasNumber :NA 4)RAMACHANDRAN Shyamal Filing Date 5)SUBRAMANIAN Ramachandran(62) Divisional to Application Number :NA 6)SWAMINATHAN Arvind Filing Date :NA 7)YOON Young C.(57) Abstract :Devices and methods are provided for system selection from a plurality of wireless system access technologies, such as a first group(e.g., 3GPP2 technologies) and a second group (e.g., 3GPP technologies). In one embodiment, the method may involve storingidentification information pertaining to the first group in a database, wherein the database may concern the priority of ones of theaccess technologies pertaining to the second group. The method may also involve selecting a preferred access technology from one ofthe first and second groups based at least in part on the identification information stored in the database.No. of Pages : 69 No. of Claims : 52 PATENT OFFICE JOURNAL 02/03/2012 3640
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2267/CHENP/2011 A(19) INDIA(22) Date of filing of Application :02/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : ELECTRONIC SPHYGMOMANOMETER FOR ENHANCING RELIABILITY OF MEASUREMENTVALUE(51) International classification :A61B5/022 (71)Name of Applicant :(31) Priority Document No :2008-228627 1)OMRON HEALTHCARE Co. Ltd.(32) Priority Date :05/09/2008 Address of Applicant :24 Yamanouchi Yamanoshita-cho(33) Name of priority country :Japan Ukyo-ku Kyoto-shi Kyoto 615-0084 Japan(86) International Application No :PCT/JP2009/064426 (72)Name of Inventor : Filing Date :18/08/2009 1)Yukiya SAWANOI(87) International Publication No : NA 2)Hiroshi KISHIMOTO(61) Patent of Addition to Application 3)Masaki TOMIOKA :NANumber 4)Naomi MATSUMURA :NA Filing Date 5)Reiji FUJITA(62) Divisional to Application Number :NA 6)Yuuichiro TAMAKI Filing Date :NA 7)Shingo YAMASHITA(57) Abstract :An electronic sphygmomanometer includes a cuff (20) to be attached to a measurement site; a pressurization/depressurization unithaving a pump (51) and a valve (52) for adjusting a pressure to be applied to the cuff (20); a pressure detection unit having a firstpressure sensor (321) and a second pressure sensor (322) for detecting a cuff pressure in the cuff (20) at the time of blood pressuremeasurement; and a CPU (100) for calculating a blood pressure based on a change in the cuff pressure detected by the pressuredetection unit. The electronic sphygmomanometer measures the blood pressure and detects abnormality on the plurality of pressuresensors based on the cuff pressures detected in correspondence to the first pressure sensor (321) and the second pressure sensor (322).No. of Pages : 72 No. of Claims : 12 PATENT OFFICE JOURNAL 02/03/2012 3641
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2268/CHENP/2011 A(19) INDIA(22) Date of filing of Application :02/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : METHOD AND APPARATUS FOR PROVIDING RICH MEDIA SERVICE :H04H60/32, (71)Name of Applicant :(51) International classification H04H60/07 1)SAMSUNG ELECTRONICS CO. LTD.(31) Priority Document No :10-2008-0095230 Address of Applicant :416 Maetan-dong Yeongtong-gu(32) Priority Date :29/09/2008 Suwon-si Gyeonggi-do Republic of Korea.(33) Name of priority country :Republic of Korea (72)Name of Inventor :(86) International Application No :PCT/KR2009/005574 1)Seo Young HWANG Filing Date :29/09/2009 2)Jae Yeon SONG(87) International Publication No : NA 3)Gun Ill LEE(61) Patent of Addition to Application 4)Kook Heui LEE :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A method and apparatus for providing rich media service that is capable of serving rich media contents in adaptation to terminalcapability and condition using the information on the complexity of the content and the operation level and memory space required torender the content is provided. The rich media service provision method includes defining scene component elements composing arich media content and attributes of the scene component elements; calculating operation amount required to render the rich mediacontent; generating the rich media content composed of the scene component elements and attributes, the operation amount beingcontained one of the scene component elements and attributes; and encoding and transmitting the rich media content.No. of Pages : 43 No. of Claims : 25 PATENT OFFICE JOURNAL 02/03/2012 3642
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2264/CHENP/2011 A(19) INDIA(22) Date of filing of Application :02/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : UPLINK RESYNCHRONIZATION FOR USE IN COMMUNICATION SYSTEMS(51) International classification :H04W72/04 (71)Name of Applicant :(31) Priority Document No :61/100,778 1)Research In Motion Limited(32) Priority Date :29/09/2008 Address of Applicant :295 Phillip Street Waterloo Ontario(33) Name of priority country :U.S.A. N2L 3W8 Canada.(86) International Application No :PCT/US2009/058707 (72)Name of Inventor : Filing Date :29/09/2009 1)SUZUKI Takashi(87) International Publication No : NA 2)CAI Zhijun(61) Patent of Addition to Application 3)BURBIDGE Richard Charies :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A method and apparatus for reusing an uplink control channel configuration associated with an uplink control channel, the methodcomprising the steps of, at a user agent (1), receiving an uplink control channel resource configuration assigned by an access device(12), transmitting to the access device (12) using the control channel resources associated with the received uplink control channelresource configuration and, after a time alignment timer expires (123, 160), retaining (172) the uplink control channel resourceconfiguration.No. of Pages : 44 No. of Claims : 24 PATENT OFFICE JOURNAL 02/03/2012 3643
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2265/CHENP/2011 A(19) INDIA(22) Date of filing of Application :02/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : APPARATUS AND METHOD FOR NOTIFYING OF USER STATUS(51) International classification :G06F13/00 (71)Name of Applicant :(31) Priority Document No :2008-260325 1)International Business Machines Corporation(32) Priority Date :07/10/2008 Address of Applicant :New Orchard Road Armonk New(33) Name of priority country :Japan York 10504 UNITED STATES OF AMERICA(86) International Application No :PCT/JP2009/067485 (72)Name of Inventor : Filing Date :07/10/2009 1)SAITO Akira(87) International Publication No : NA 2)UENOHARA Hayato(61) Patent of Addition to Application 3)TAKEUCHI Shigeki :NANumber 4)KONNO Kazuhiro :NA Filing Date 5)ISHIKAWA Nobuyuki(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The status of a user related to software, which was started from other software for performing message exchange, is announced to theother party in the message exchange. A message processor (13) implemented by an instant messenger (IM) on a client (10) outputsstartup application information that relates to an application that has been started according to user operation received by an operationreceiver (12), and IM status information that indicates the message status in the IM, and a window monitor (16) monitors a windowdisplayed on a display unit (14) and outputs window status information that indicates the status of the window. Then, when theinformation meets the conditions in a rule definition stored in a rule memory (15), a rule interpreter (17) returns a status messagedefined for the conditions to the message processor (13), and notifies the other client via a communication unit (11).No. of Pages : 32 No. of Claims : 10 PATENT OFFICE JOURNAL 02/03/2012 3644
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2266/CHENP/2011 A(19) INDIA(22) Date of filing of Application :02/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : METHOD AND SYSTEM OF APPLYING ENVIRONMENTAL INCENTIVES :G06Q30/00, (71)Name of Applicant :(51) International classification G06Q50/00 1)Silver Spring Networks Inc.(31) Priority Document No :61/101,929 Address of Applicant :555 Broadway Street Redwood City(32) Priority Date :01/10/2008 California 94063 UNITED STATES OF AMERICA(33) Name of priority country :U.S.A. (72)Name of Inventor :(86) International Application No :PCT/US2009/005409 1)FITZGERALD Sean M. Filing Date :01/10/2009 2)VASWANI Raj(87) International Publication No : NA(61) Patent of Addition to Application :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :Information relating to electrical energy usage for a given account is associated with a time segment that corresponds to a period whenthe electrical energy was received from an electrical energy distribution system. Electrical energy generation carbon impactinformation is retrieved for the corresponding time segment specifying when the electrical energy was received from an electricalenergy distribution system. A carbon credit is calculated according to the retrieved electrical energy generation carbon impactinformation, and the retrieved electrical energy usage information associated with the time segment. The calculated carbon credit isthen used to update a display of carbon credit related information, such as account balance, rate of carbon credit usage, currentlyapplicable cost for carbon credit usage. Notifications can be provided to the consumer if any of this information crosses a thresholdvalue. In addition, or alternatively, the carbon credit related information can be used to automatically control the operation of devicesthat consume energy.No. of Pages : 60 No. of Claims : 57 PATENT OFFICE JOURNAL 02/03/2012 3645
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2288/CHENP/2011 A(19) INDIA(22) Date of filing of Application :04/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : TRANSGENIC PLANTS WITH INCREASED YIELD :A01H5/00, (71)Name of Applicant :(51) International classification A01H5/10 1)BASF PLANT SCIENCE GMBH(31) Priority Document No :61/099,224 Address of Applicant :67056 Ludwigshafen Germany.(32) Priority Date :23/09/2008 (72)Name of Inventor :(33) Name of priority country :U.S.A. 1)MCKERSIE Bryan D.(86) International Application No :PCT/EP2009/061931 2)BRUCE Wesley Filing Date :15/09/2009(87) International Publication No : NA(61) Patent of Addition to Application :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :Polynucleotides are disclosed which are capable of enhancing yield of a plant transformed to contain such polynucleotides. Alsoprovided are methods of using such polynucleotides and transgenic plants and agricultural products, including seeds, containing suchpolynucleotides as transgenes.No. of Pages : 83 No. of Claims : 9 PATENT OFFICE JOURNAL 02/03/2012 3646
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2289/CHENP/2011 A(19) INDIA(22) Date of filing of Application :05/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : DISTRIBUTED LIGHTING CONTROL SYSTEM(51) International classification :H05B37/02 (71)Name of Applicant :(31) Priority Document No :61/104,460 1)QUALCOMM MEMS Technologies Inc.(32) Priority Date :10/10/2008 Address of Applicant :5775 Morehouse Drive San Diego CA(33) Name of priority country :U.S.A. 92121 UNITED STATES OF AMERICA(86) International Application No :PCT/US2009/005559 (72)Name of Inventor : Filing Date :08/10/2009 1)SAMPSELL Jeffrey B(87) International Publication No : NA(61) Patent of Addition to Application :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The Distributed Lighting Control System (DLCS) is based upon a distributed lighting system, which imbeds luminaire devices instructural materials such as ceiling tiles and wallboard. Each luminaire device is attached to a power network, and each luminairedevice includes, or is directly associated with, an electronic circuit component that controls the activation and operation of theluminaire. In normal operation the power network is energized and the electronic circuit controls when and how the luminaire itself isenergized based on signals conveyed to the circuit through wireless means or through signals imposed upon the power grid. Saidsignals are generated by the DLCS-controller, which is resident within the structure that contains the DLCS.No. of Pages : 37 No. of Claims : 23 PATENT OFFICE JOURNAL 02/03/2012 3647
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2290/CHENP/2011 A(19) INDIA(22) Date of filing of Application :05/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : INCREMENTAL REDUNDANCY RELAYS FOR BROADCAST TRANSMISSION :H04L1/18, (71)Name of Applicant :(51) International classification H04L1/00 1)QUALCOMM Incorporated(31) Priority Document No :12/262,573 Address of Applicant :Attn: International IP Administration(32) Priority Date :31/10/2008 5775 Morehouse Drive San Diego California 92121-1714(33) Name of priority country :U.S.A. UNITED STATES OF AMERICA(86) International Application No :PCT/US2008/088323 (72)Name of Inventor : Filing Date :24/12/2008 1)PALANKI Ravi(87) International Publication No : NA 2)AGRAWAL Avneesh(61) Patent of Addition to Application :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :Techniques for relaying a broadcast transmission in a wireless network are described. In one design, a relay may receive at least onetransmission of a packet from a transmitter (e.g., a broadcast station) and may process the at least one transmission to decode thepacket. The relay may generate at least one remaining transmission of the packet after correctly decoding the packet. The transmittermay broadcast multiple transmissions of the packet to receivers. The at least one transmission may be at least one of the multipletransmissions, and the at least one remaining transmission may be remaining ones of the multiple transmissions. The relay may sendthe at least one remaining transmission of the packet at the same time and on the same resources used by the transmitter. The multipletransmissions may be HARQ transmissions containing different redundancy information for the packet.No. of Pages : 38 No. of Claims : 42 PATENT OFFICE JOURNAL 02/03/2012 3648
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2293/CHENP/2011 A(19) INDIA(22) Date of filing of Application :05/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : DATA CENTRE AND APPARATUS AND METHOD FOR DATA CENTRE COOLING :F24F11/00, (71)Name of Applicant :(51) International classification F24F11/02 1)HEWLETT-PACKARD DEVELOPMENT COMPANY(31) Priority Document No :0822213.5 L.P.(32) Priority Date :05/12/2008 Address of Applicant :11445 Compaq Center Drive West(33) Name of priority country :U.K. Houston TX 77070 U.S.A.(86) International Application No :PCT/EP2009/065171 (72)Name of Inventor : Filing Date :12/11/2009 1)Robert TOZER(87) International Publication No : NA 2)Luke NEVILLE(61) Patent of Addition to Application :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :According to one embodiment of the present invention, there is provided an apparatus for cooling a data centre. The apparatuscomprises an air conditioning unit for supplying cooled air to a cold portion of a data centre, an airflow measurement device formeasuring a rate of bypass airflow through a segregation between the cold portion and hot portion of the data centre, and outputting abypass airflow signal indicative of the rate of bypass airflow between the cold portion and the hot portion, and a control unit arrangedto receive the bypass airflow signal from the airflow measurement device and to output a control signal to a means for controlling arate of the bypass airflow to maintain a predetermined rate of bypass airflow.No. of Pages : 35 No. of Claims : 15 PATENT OFFICE JOURNAL 02/03/2012 3649
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2328/CHENP/2011 A(19) INDIA(22) Date of filing of Application :05/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : SYSTEM, DEVICE AND METHOD FOR EMERGENCY PRESENCE DETECTION :G01S15/04, (71)Name of Applicant :(51) International classification G01S15/02 1)KONINKLIJKE PHILIPS ELECTRONICS N.V.(31) Priority Document No :61/095685 Address of Applicant :GROENEWOUDSEWEG 1(32) Priority Date :10/09/2008 EINDHOVEN 5621 BA NETHERLANDS(33) Name of priority country :U.S.A. (72)Name of Inventor :(86) International Application No :PCT/IB2009/053808 1)PASVEER Willem Franke Filing Date :01/09/2009 2)DELNOIJ Roger peter Anna(87) International Publication No : NA(61) Patent of Addition to Application :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A detection device and method includes a transducer array (20) located at a designated area and configured to perform an ultrasonicsweep of the area in response to a trigger event. The transducer array is capable of determining a presence of a live being (16) in thearea in accordance with the ultrasonic sweep. A power supply (21) is coupled to the transducer array to provide power to thetransducer array and to enable the ultrasonic sweep in a power failure. A transmitter (23) is configured to transmit a result of theultrasonic sweep to provide a determination of the presence of a live being and the live being™s location in the area to personnelresponding to an event.No. of Pages : 23 No. of Claims : 24 PATENT OFFICE JOURNAL 02/03/2012 3650
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2325/CHENP/2011 A(19) INDIA(22) Date of filing of Application :05/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : METHOD AND SYSTEM FOR LOCATING A SOUND SOURCE :A61B7/02, (71)Name of Applicant :(51) International classification A61B7/04 1)KONINKLIJKE PHILIPS ELECTRONICS N.V.(31) Priority Document No :200810212856.X Address of Applicant :GROENEWOUDSEWEG 1(32) Priority Date :10/09/2008 EINDHOVEN 5621 BA NETHERLANDS(33) Name of priority country :China (72)Name of Inventor :(86) International Application No :PCT/IB2009/053819 1)DONG Liang Filing Date :02/09/2009 2)BRAND Maarten Leonardus Christian(87) International Publication No : NA 3)MEI Zhongtao(61) Patent of Addition to Application :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The invention relates to a method and system for locating a sound source. The system comprises: - a receiving unit (311) for receivingnavigating sound signals from at least two navigating sound sensors (21, 22, 23), and receiving a selection instruction comprising asignal segment type corresponding to the sound source, wherein the at least two navigating sound sensors are received in a chest-piece(20), - a selecting unit (312) for selecting a segment from each navigating sound signal according to the signal segment type, - acalculating unit (313) for calculating a difference between the segments selected from the navigating sound signal, and - a generatingunit (314) for generating a moving indication signal for guiding moving the chest-piece (20) to the sound source according to thedifference.No. of Pages : 27 No. of Claims : 15 PATENT OFFICE JOURNAL 02/03/2012 3651
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2329/CHENP/2011 A(19) INDIA(22) Date of filing of Application :05/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : METHOD AND SYSTEM FOR MAGNETIC INDUCTION TOMOGRAPHY(51) International classification :G01V3/10 (71)Name of Applicant :(31) Priority Document No :200810215357.6 1)KONINKLIJKE PHILIPS ELECTRONICS N.V.(32) Priority Date :11/09/2008 Address of Applicant :GROENEWOUDSEWEG 1(33) Name of priority country :China EINDHOVEN 5621 BA NETHERLANDS(86) International Application No :PCT/IB2009/053817 (72)Name of Inventor : Filing Date :02/09/2009 1)YAN Ming(87) International Publication No : NA 2)CHEN Dayu(61) Patent of Addition to Application 3)JIN Hua :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The invention relates to a method and a system for magnetic induction tomography, the system comprising: at least one transmittingcoil for generating a primary magnetic field to be applied to the object of interest; and at least one measurement coil arrangement formeasuring electric signals induced by a secondary magnetic field which is generated by the object of interest in response to theprimary magnetic field, wherein the at least one measurement coil arrangement comprises a plurality of measurement coils which arepositioned in substantially the same plane.No. of Pages : 19 No. of Claims : 16 PATENT OFFICE JOURNAL 02/03/2012 3652
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2326/CHENP/2011 A(19) INDIA(22) Date of filing of Application :05/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : DRUG CARRIER PROVIDING MRI CONTRAST ENHANCEMENT :A61K49/06, (71)Name of Applicant :(51) International classification A61K49/18 1)KONINKLIJKE PHILIPS ELECTRONICS N.V.(31) Priority Document No :08164091.4 Address of Applicant :GROENEWOUDSEWEG 1(32) Priority Date :10/09/2008 EINDHOVEN 5621 BA NETHERLANDS(33) Name of priority country :EPO (72)Name of Inventor :(86) International Application No :PCT/IB2009/053836 1)LANGEREIS Sander Filing Date :03/09/2009 2)KEUPP Jochen(87) International Publication No : NA 3)GRUELL Holger(61) Patent of Addition to Application 4)BURDINSKI Dirk :NANumber 5)BEELEN Danielle :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :Described are drug carriers useful in magnetic resonance imaging (MRI)-guided drug release comprising a shell capable of releasingan enclosed biologically active agent as a result of a local stimulus, e.g. energy input, such as heat, wherein the shell encloses a 19FMR contrast agent. Preferably, the carrier also acts as a contrast enhancement agent for MRI based on the principle of ChemicalExchange-dependent Saturation Transfer (CEST). To this end the shell encloses a cavity that comprises a paramagnetic chemical shiftreagent, a pool of proton analytes, and the 19F contrast agent, and wherein the shell allows diffusion of the proton analytes.No. of Pages : 37 No. of Claims : 19 PATENT OFFICE JOURNAL 02/03/2012 3653
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2330/CHENP/2011 A(19) INDIA(22) Date of filing of Application :05/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : NAVIGATING IN GRAPHICAL USER INTERFACE ON HANDHELD DEVICES(51) International classification :G06F17/30 (71)Name of Applicant :(31) Priority Document No :08164254.8 1)KONINKLIJKE PHILIPS ELECTRONICS N.V.(32) Priority Date :12/09/2008 Address of Applicant :GROENEWOUDSEWEG 1(33) Name of priority country :EPO EINDHOVEN 5621 BA NETHERLANDS(86) International Application No :PCT/IB2009/053955 (72)Name of Inventor : Filing Date :10/09/2009 1)PRABHU Sudhir M.(87) International Publication No : NA(61) Patent of Addition to Application :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The invention relates to presenting and browsing in metadata on handheld display devices such as music/mp3 players, mobile phones,PDAs, digital cameras. A graphical user interface (GUI) accesses metadata arranged in different categories and determines ahierarchical order of this. A metadata category is shown in a menu of category entries in a separate pane on the GUI. Rotation of thedevice is detected by a rotation sensor, and upon rotation the pane with the menu being browsed before rotation is maintained in theGUI, and at least one pane a menu representing a hierarchical super- or sub-category of the category being browsed before rotation isadded or removed. This allows the user to expand or collapse metadata categories shown in the GUI by rotating the device.No. of Pages : 17 No. of Claims : 9 PATENT OFFICE JOURNAL 02/03/2012 3654
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2327/CHENP/2011 A(19) INDIA(22) Date of filing of Application :05/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : APPARATUS FOR STEAMING AND BLENDING FOOD PRODUCTS(51) International classification :A47J43/07 (71)Name of Applicant :(31) Priority Document No :08164077.3 1)KONINKLIJKE PHILIPS ELECTRONICS N.V.(32) Priority Date :10/09/2008 Address of Applicant :GROENEWOUDSEWEG 1(33) Name of priority country :EPO EINDHOVEN 5621 BA NETHERLANDS(86) International Application No :PCT/IB2009/053847 (72)Name of Inventor : Filing Date :03/09/2009 1)BJOERK Joel J.(87) International Publication No : NA 2)ZUKALE Volkhard W-D.(61) Patent of Addition to Application :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :An apparatus for steaming and blending food products comprises a container (2) for receiving the food products, the container havinga steam inlet (12) and a steam outlet passage (36). A blade assembly (16) is located in the container for blending the food products.The blade assembly (16) comprising a blade support member (18,22) having at least one blade (20) extending there from. The bladesupport member is located over an opening (14) in the container. The steam outlet passage (36) extends between the container and theblade support member such that steam can exit the container through the opening (14).No. of Pages : 14 No. of Claims : 15 PATENT OFFICE JOURNAL 02/03/2012 3655
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2331/CHENP/2011 A(19) INDIA(22) Date of filing of Application :05/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : A DEVICE PROVIDED WITH A GAP-LIKE SPACE :H05K7/20, (71)Name of Applicant :(51) International classification F21V29/02 1)KONINKLIJKE PHILIPS ELECTRONICS N.V.(31) Priority Document No :08164205.0 Address of Applicant :GROENEWOUDSEWEG 1(32) Priority Date :12/09/2008 EINDHOVEN 5621 BA NETHERLANDS(33) Name of priority country :EPO (72)Name of Inventor :(86) International Application No :PCT/IB2009/053888 1)KADIJK Simon E. Filing Date :07/09/2009 2)LUITEN Gwendolyn A.(87) International Publication No : NA 3)NICOLE Celine C. S.(61) Patent of Addition to Application 4)LASANCE Clemens J. M. :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A device (1) is provided with a configuration of two walls (3a; 5a) confining a substantially closed gap-like space (7) containing agaseous medium. For cooling purposes the device is further provided with a synthetic jet generator (9) for generating a gaseoussynthetic jet, wherein the generator is fluidically coupled to the gas-like space.No. of Pages : 17 No. of Claims : 10 PATENT OFFICE JOURNAL 02/03/2012 3656
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2335/CHENP/2011 A(19) INDIA(22) Date of filing of Application :06/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : DECOMPOSABLE BIOCOMPATIBLE HYDROGELS AND SYSTEM AND METHOD FOR USINGSAME(51) International classification :A61K9/10 (71)Name of Applicant :(31) Priority Document No :61/097,491 1)ENVISION TECHNOLOGIES INC.(32) Priority Date :16/09/2008 Address of Applicant :6245 E. Broadway Blvd. Suite 620(33) Name of priority country :U.S.A. Tucon Arizona 85711 United States of America(86) International Application No :PCT/US2009/057180 (72)Name of Inventor : Filing Date :16/09/2009 1)BRETON Louis(87) International Publication No : NA 2)KATZ Jeffrey(61) Patent of Addition to Application 3)BANISTER Mark :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :Biocompatible, triggerable degradation, polymerizable hydrogels, uses and delivery devices are disclosed. These hydrogels are at leastsubstantially water soluble macromers, having a variety of uses especially for ocular therapy. The macromers include at least onewater soluble region, at least one region which is degradable via a triggering event, usually by hydrolysis, and at least two free radical-polymerizable regions. The regions can, in some embodiments, be both water soluble and trigger able degradable. The macromers arepolymerized by exposure of the polymerizable regions to free radicals generated by photosensitive chemicals and dyes. An advantageof these polymer hydrogels is that they can be polymerized rapidly in an aqueous surrounding. Precisely conforming, semi-permeable,biodegradable films or membranes can thus be formed on tissue in situ to serve as biodegradable barriers, as carriers for living cells orother biologically active materials, and as surgical adhesives for the eye.No. of Pages : 25 No. of Claims : 21 PATENT OFFICE JOURNAL 02/03/2012 3657
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2336/CHENP/2011 A(19) INDIA(22) Date of filing of Application :06/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : METHOD, SYSTEM, AND APPARATUS FOR RANKING MEDIA SHARING CHANNELS(51) International classification :G06F17/30 (71)Name of Applicant :(31) Priority Document No :12/237,028 1)NOKIA CORPORATION(32) Priority Date :24/09/2008 Address of Applicant :Keilalahdentie 4 FIN-02150 Espoo(33) Name of priority country :U.S.A. Finland(86) International Application No :PCT/FI2009/050642 (72)Name of Inventor : Filing Date :30/07/2009 1)Davin Wong(87) International Publication No : NA(61) Patent of Addition to Application :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :Ranking media sharing channels involves determining content contributors to a channel. Activity metrics for other channels associatedwith the content contributors are determined. An initial ranking for the channel is provided based on the activity metrics for the otherchannels. The initial ranking is independent of activity metrics associated with the channel.No. of Pages : 26 No. of Claims : 12 PATENT OFFICE JOURNAL 02/03/2012 3658
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2334/CHENP/2011 A(19) INDIA(22) Date of filing of Application :05/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : PEPTIDE ANTAGONIST OF INTERLEUKIN-15 ACTIVITY :C07K7/06, (71)Name of Applicant :(51) International classification A61K38/08 1)CENTRO DE INGENIER A GEN‰TICA Y(31) Priority Document No :2008-0184 BIOTECNOLOG A(32) Priority Date :30/09/2008 Address of Applicant :Ave. 31 entre 158 y 190 Cubanac¡n(33) Name of priority country :Cuba Playa C. Habana 12100 Cuba.(86) International Application No :PCT/CU2009/000006 (72)Name of Inventor : Filing Date :30/09/2009 1)SANTOS SAVIO Alicia(87) International Publication No : NA 2)REYES ACOSTA Osvaldo(61) Patent of Addition to Application 3)GERONIMO PEREZ Haydee :NANumber 4)GARAY PEREZ Hilda Elisa :NA Filing Date 5)RODRIGUEZ ALVAREZ Yunier(62) Divisional to Application Number :NA 6)GUILLEN NIETO Gerardo Enrique Filing Date :NA(57) Abstract :The present invention relates to the field of molecular pharmacology, in particular to a peptide derived from the interleukin-15 (IL-15)sequence optimised to inhibit the biological activity of this molecule. The present invention shows that the peptide, on bonding to thealpha subunit of the receptor (IL-15Rα), inhibits the proliferation of T cells induced by IL-15, the induction of tumour necrosisfactor-α (TNF-α) by IL-15, and the expression of IL-8 and IL-6 by IL-15Rα. The invention relates furthermore to the use of thepeptide in the treatment of pathologies wherein the abnormal expression of IL-15 or IL-15Rα is related to the progression of thedisease, such as rheumatoid arthritis (RA) and prostrate cancer.No. of Pages : 17 No. of Claims : 19 PATENT OFFICE JOURNAL 02/03/2012 3659
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2353/CHENP/2011 A(19) INDIA(22) Date of filing of Application :06/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : HIDING A DEVICE IDENTITY(51) International classification :H04L29/08 (71)Name of Applicant :(31) Priority Document No :08105459.5 1)NOKIA CORPORATION(32) Priority Date :29/09/2008 Address of Applicant :Keilalahdentie 4 FIN-02150 Espoo(33) Name of priority country :EPO Finland(86) International Application No :PCT/FI2009/050708 (72)Name of Inventor : Filing Date :04/09/2009 1)Georg Mayer(87) International Publication No : NA 2)Peter Leis(61) Patent of Addition to Application 3)Gunter Horn :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The present invention relates to hiding a device identifier (IMEI) in a communication system. Identifying a device is done byindicating an international mobile equipment identity (IMEI) as an instance identifier of the device of a user. Generating agloballyroutable user agent uniform resource identifier (GRUU) for the user is done by encrypting the instance identifier so that the GRUUcomprises an identity of the user and the encrypted instance identifier.No. of Pages : 24 No. of Claims : 13 PATENT OFFICE JOURNAL 02/03/2012 3660
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2356/CHENP/2011 A(19) INDIA(22) Date of filing of Application :06/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : A METHOD FOR ALLOWING AND BLOCKING A USER PC WHICH CAN USE INTERNET ATTHE SAME TIME IN A PRIVATE NETWORK THEROF A METHOD FOR ANALYZING AND DETECTING A JUGEMENTABOUT WHETHER NAT(NETWORK ADDRESS TRANSLATION) CAN BE USED OR NOT USING A TRAFFIC DATA, ANDTHE NUMBER OF TERMINALS SHARING NAT(51) International classification :H04L12/24 (71)Name of Applicant :(31) Priority Document No :10-2008-0099860 1)PLUSTECH INC.(32) Priority Date :10/10/2008 Address of Applicant :3F. Hyundai Venture Ville 713 Suseo-(33) Name of priority country :Republic of Korea dong Kangnam-gu Seoul 135-539 Republic of Korea.(86) International Application No :PCT/KR2008/006350 (72)Name of Inventor : Filing Date :28/10/2008 1)PARK Hyoung-Bae(87) International Publication No : NA 2)LEE Yun-Seok(61) Patent of Addition to Application 3)CHOI Kyu-Min :NANumber 4)KONG Kyoung-Pil :NA Filing Date 5)YOU Pil-Sang(62) Divisional to Application Number :NA 6)KIM Sung-Goo Filing Date :NA(57) Abstract :The present invention provides a method consisting of a step for analyzing a traffic receiving mirroring, a step for judging whetherNAT (Network Address Translation) use of a client configuring and using a private network as well as a provided authorized IP (anInternet IP) is allowed or not, for analyzing and detecting the number of sharing terminals, a step for creating a database using data,and a step for formulating a policy by using information in database, so that when the users of a private network connect to Internet atthe same time, permission or blocking of Internet use can be executed selectively.No. of Pages : 22 No. of Claims : 6 PATENT OFFICE JOURNAL 02/03/2012 3661
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2354/CHENP/2011 A(19) INDIA(22) Date of filing of Application :06/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : PARTITION MAP(51) International classification :G03G15/00 (71)Name of Applicant :(31) Priority Document No :NA 1)HEWLETT-PACKARD DEVELOPMENT COMPANY(32) Priority Date :NA L.P.(33) Name of priority country :NA Address of Applicant :11445 Compaq Center Drive West(86) International Application No :PCT/US2008/080054 Houston TX 77070 U.S.A. Filing Date :15/10/2008 (72)Name of Inventor :(87) International Publication No : NA 1)Brian L. HELTERLINE(61) Patent of Addition to Application 2)Jefferson P. WARD :NANumber 3)Stephen D. PANSHIN :NA Filing Date 4)Joseph H. BAUMAN(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :An imaging material supply cartridge (24) uses a partition map (52) to identify access modes and encryption attributes.No. of Pages : 17 No. of Claims : 15 PATENT OFFICE JOURNAL 02/03/2012 3662
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2358/CHENP/2011 A(19) INDIA(22) Date of filing of Application :06/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : RADIOGRAPHIC DATA INTERPRETATION :G01N23/04, (71)Name of Applicant :(51) International classification G01V5/00 1)KROMEK LIMITED(31) Priority Document No :0817487.2 Address of Applicant :NetPark Incubator Thomas Wright(32) Priority Date :24/09/2008 Way Sedgefield Durham TS21 3FD United Kingdom(33) Name of priority country :U.K. (72)Name of Inventor :(86) International Application No :PCT/GB2009/051201 1)ROBINSON Max Filing Date :16/09/2009(87) International Publication No : NA(61) Patent of Addition to Application :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A method and apparatus are described for the collection and interpretation of radiographic data from an object scanned by a suitableradiation source. A radiation detector system is provided that is detecting and collecting spectroscopically resolved information. Anobject is scanned from a plurality of perspectives, and the resultant data from each perspective resolved into at least threespectroscopic energy bands. For each such resolved spectroscopic energy band an image analysis is performed to derive depth slicingto produce a series of output datasets each comprising a 2-D dataset of intensity information resolved to a single energy band anddepth slice.No. of Pages : 40 No. of Claims : 21 PATENT OFFICE JOURNAL 02/03/2012 3663
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2360/CHENP/2011 A(19) INDIA(22) Date of filing of Application :06/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : A METHOD FOR EVALUATING MEDICAL DATA OF A PERSON AND SYSTEM THEREOF(51) International classification :G06Q50/00 (71)Name of Applicant :(31) Priority Document No :61/104,497 1)CARDIOVASCULAR DECISION TECHNOLOGIES(32) Priority Date :10/10/2008 INC.(33) Name of priority country :U.S.A. Address of Applicant :102 South Broadway Suite 310(86) International Application No :PCT/US2009/060520 Rochester MN 55904 United States of America Filing Date :13/10/2009 (72)Name of Inventor :(87) International Publication No : NA 1)JAMES B. SEWARD(61) Patent of Addition to Application :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A knowledgebase comprising a plurality of feature-sets is created using complexity science. The knowledgebase is accessible througha network to a computer, a system, and a computer program code that receives and analyzes medical data to determine the existence ofa disease state. The medical data is input and correlated to features within the knowledgebase to identify feature-sets, each feature-setindicating a particular medical condition. After one or more feature-sets have been selected, associative algorithms consider themagnitudes or values of the medical data and, with the values of features in the feature-sets, assess the risk burden of the medicalcondition associated with the feature-set. An output is generated that may include diagnoses of one or more medical conditions, therisk burden of the medical condition(s), possible treatment options and prevention techniques.No. of Pages : 46 No. of Claims : 11 PATENT OFFICE JOURNAL 02/03/2012 3664
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2357/CHENP/2011 A(19) INDIA(22) Date of filing of Application :06/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : METHOD FOR DISTRIBUTING SECOND MULTI-MEDIA CONTENT ITEMS IN A LIST OF FIRSTMULTI-MEDIA CONTENT ITEMS(51) International classification :H04N5/44 (71)Name of Applicant :(31) Priority Document No :08164299.3 1)AXEL SPRINGER DIGITAL TV GUIDE GMBH(32) Priority Date :12/09/2008 Address of Applicant :Schiffbauerdamm 22 10117 Berlin(33) Name of priority country :EPO Germany.(86) International Application No :PCT/EP2009/061811 (72)Name of Inventor : Filing Date :11/09/2009 1)ROSENGART Frank(87) International Publication No : NA 2)MLLER-LOEFFELHOLZ Georg(61) Patent of Addition to Application 3)ZIER Thomas :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A method of distributing second multi-media content items into a list having at least one first multi-media content item is provided.The list of the first multi-media content item is to be reproduced on a personal TV system. A playlist of first multi-media content itemsis selected from a plurality of first multi-media content items available on different TV channels. Potential second multi-media contentitems from a plurality of available second multi-media content items are determined by matching information from the first andsecond multi-media content items. At least one of the determined second multi-media content items are selected based on a userprofile, metadata of the first and second multi- media content items and/or a distribution scheme for distributing the second multi-media content items into the playlist of the first multi-media content items.No. of Pages : 24 No. of Claims : 7 PATENT OFFICE JOURNAL 02/03/2012 3665
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2355/CHENP/2011 A(19) INDIA(22) Date of filing of Application :06/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : METHOD AND APPARATUS FOR INTERFERENCE REPORTING IN A N-MIMOCOMMUNICATION SYSTEM :H04L1/00, (71)Name of Applicant :(51) International classification H04B7/06 1)QUALCOMM Incorporated(31) Priority Document No :61/108,278 Address of Applicant :Attn: International IP Administration(32) Priority Date :24/10/2008 5775 Morehouse Drive San Diego California 92121-1714(33) Name of priority country :U.S.A. UNITED STATES OF AMERICA(86) International Application No :PCT/US2009/061723 (72)Name of Inventor : Filing Date :22/10/2009 1)PALANKI Ravi(87) International Publication No : NA 2)GOROKHOV Alexei Y.(61) Patent of Addition to Application 3)BHUSHAN Naga :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :Systems and methodologies are described herein that facilitate interference measurement and reporting in a network multiple-in-multiple-out (N-MIMO) communication system. As described herein, a network device can measure and report interferencecorresponding to network nodes outside a designated set of nodes that can cooperatively serve the device. Respective interferencereports can additionally identify dominant interfering nodes, correlation between transmit antennas of respective nodes, or the like.Subsequently, respective interference reports can be combined with per-node channel information to manage coordination andscheduling across respective network nodes. As further described herein, interference from a network node can be measured byobserving reference and/or synchronization signals from the network node. To aid such observation, respective non-interferingnetwork nodes can define null pilot intervals in which transmission is silenced or otherwise reduced. As additionally described herein,loading information broadcasted by respective interfering network nodes can be identified and utilized in connection with interferencecalculation.No. of Pages : 55 No. of Claims : 55 PATENT OFFICE JOURNAL 02/03/2012 3666
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2359/CHENP/2011 A(19) INDIA(22) Date of filing of Application :06/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : BLENDED FLUOROPOLYMER COATINGS FOR RIGID SUBSTRATES :C08L27/18, (71)Name of Applicant :(51) International classification C09D127/18 1)WHITFORD CORPORATION(31) Priority Document No :61/100,311 Address of Applicant :47 Park Avenue Elverson(32) Priority Date :26/09/2008 Pennsylvania 19520 United States of America(33) Name of priority country :U.S.A. (72)Name of Inventor :(86) International Application No :PCT/US2009/058407 1)HARVEY Leonard W. Filing Date :25/09/2009 2)LEECH Lawrence D.(87) International Publication No : NA(61) Patent of Addition to Application :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A fluoropolymer coating composition that may be applied over a primer and/or at least one midcoat in a non-stick coating system. Thecoating composition may be prepared and applied in the form of a liquid dispersion, and includes at least one fluoropolymer basecomponent, such as polytetrafluoroethylene (PTFE) and, in particular, at least one high molecular weight PTFE (HPTFE). The coatingcomposition additionally includes a blended fluoropolymer composition. The blended fluoropolymer composition is a blend of at leastone low molecular weight PTFE (LPTFE) and at least one melt-processible fluoropolymer. After application directly to a substrate orover an underlying coating, the coating demonstrates improved abrasion and scratch resistance, as well as improved releasecharacteristics, as compared to known coatings that include only HPTFE or HPTFE with a small amount of melt processiblefluoropolymer.No. of Pages : 84 No. of Claims : 18 PATENT OFFICE JOURNAL 02/03/2012 3667
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2361/CHENP/2011 A(19) INDIA(22) Date of filing of Application :06/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : SYSTEMS AND METHODS FOR DYNAMIC CREATION AND RELEASE OF PROXY MOBILE IPCONNECTIONS(51) International classification :H04W60/00 (71)Name of Applicant :(31) Priority Document No :61/105,707 1)QUALCOMM Incorporated(32) Priority Date :15/10/2008 Address of Applicant :Attn: International IP Administration(33) Name of priority country :U.S.A. 5775 Morehouse Drive San Diego California 92121-1714(86) International Application No :PCT/US2009/060893 UNITED STATES OF AMERICA Filing Date :15/10/2009 (72)Name of Inventor :(87) International Publication No : NA 1)CHERIAN George(61) Patent of Addition to Application 2)WANG Jun :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :Disclosed are systems, methods and computer program products for facilitating dynamic addition and release of IP addresses in anestablished Proxy Mobile IPv6 (PMIP) sessions, for example, based on the demand of a mobile device. An example method comprisesreceiving from the mobile device a request to add a second IP interface type to a current communication session associated with a firstIP interface type, wherein the second IP interface type is different from the first IP interface type. The method further includesreceiving from the home network a set of IP addresses of the second IP interface type and establishing one or more IP flows of thesecond IP interface type using one or more received IP addresses. The method further includes associating the one or more IP flows ofthe second IP interface type with the current communication session for the mobile device.No. of Pages : 39 No. of Claims : 28 PATENT OFFICE JOURNAL 02/03/2012 3668
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2362/CHENP/2011 A(19) INDIA(22) Date of filing of Application :06/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : MOBILITY PROTOCOL SELECTION IN A MULTI-INTERNET PROTOCOL MOBILITYENVIRONMENT(51) International classification :H04L29/06 (71)Name of Applicant :(31) Priority Document No :61/107,598 1)QUALCOMM Incorporated(32) Priority Date :22/10/2008 Address of Applicant :Attn: International IP Administration(33) Name of priority country :U.S.A. 5775 Morehouse Drive San Diego California 92121-1714(86) International Application No :PCT/US2009/061731 UNITED STATES OF AMERICA Filing Date :22/10/2009 (72)Name of Inventor :(87) International Publication No : NA 1)WANG Jun(61) Patent of Addition to Application 2)CHERIAN George :NANumber 3)LIOY Marcello :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :Aspects describe selection of a mobility protocol after a mobile device has been authenticated with a network. Selection of mobilityprotocol after authentication can mitigate the amount of time needed to implement the mobility protocol. The mobility protocolsinclude a simple IP protocol, a proxy mobile IP protocol, and a client mobile IP protocol. Implementation of simple IP protocol andproxy mobile IP protocol are performed in a similar manner from the perspective of a mobile device. If IPCP negotiation is successful,proxy mobile IP protocol or simple IP protocol can be selected. If IPCP negotiation is not successful, client mobile IP protocol can beselected.No. of Pages : 41 No. of Claims : 25 PATENT OFFICE JOURNAL 02/03/2012 3669
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2377/CHENP/2011 A(19) INDIA(22) Date of filing of Application :07/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : GLUCURONIDATED ACETAMINOPHEN AS A MARKER OF HEPATIC DISORDERS(51) International classification :G01N33/94 (71)Name of Applicant :(31) Priority Document No :61/194,835 1)THE ARIZONA BOARD OF REGENTS on behalf of(32) Priority Date :01/10/2008 THE UNIVERSITY OF ARIZONA(33) Name of priority country :U.S.A. Address of Applicant :University Services Building Room(86) International Application No :PCT/US2009/058913 204 888 N. Euclid Avenue Tucson Arizona 85721-0158 United Filing Date :30/09/2009 States of America(87) International Publication No : NA (72)Name of Inventor :(61) Patent of Addition to Application 1)CHERRINGTON Nathan :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The present invention provides methods for diagnosing human hepatic disorders, such as non-alcoholic steatohepatitis (NASH),identifying a human subject at risk of an adverse drug reaction, and determining an appropriate dosage of a therapeutic drug for ahuman subject. The marker is an increased level of acetaminophen-glucuronide in a plasma or urine sample from a human subject.No. of Pages : 30 No. of Claims : 19 PATENT OFFICE JOURNAL 02/03/2012 3670
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2363/CHENP/2011 A(19) INDIA(22) Date of filing of Application :06/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : METHODS AND APPARATUS FOR OBTAINING CONTENT WITH REDUCED ACCESS TIMES(51) International classification :H04L29/08 (71)Name of Applicant :(31) Priority Document No :61/106,111 1)QUALCOMM Incorporated(32) Priority Date :16/10/2008 Address of Applicant :Attn: International IP Administration(33) Name of priority country :U.S.A. 5775 Morehouse Drive San Diego California 92121-1714(86) International Application No :PCT/US2009/061092 UNITED STATES OF AMERICA Filing Date :16/10/2009 (72)Name of Inventor :(87) International Publication No : NA 1)REZAIIFAR Ramin(61) Patent of Addition to Application 2)KAPOOR Rohit :NANumber 3)MOHANTY Bibhu P. :NA Filing Date 4)MITRANI Michael(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A method and apparatus for obtaining content with reduces round trip times is provided. The method may comprise transmitting, froma device (110), a primary- content item request to a proxy server (130) to obtain a primary content item (142) using a first protocol,receiving the primary content item (142) from the remote proxy (130) using the first protocol, generating one or more secondarycontent item requests for one or more secondary content items (144) associated with the primary content item (142), transmitting theone or more secondary content item requests to the proxy server (130) using a second protocol, wherein the second protocol decouplesthe one or more secondary content item requests from an acknowledgement of receipt of the one or more secondary content itemrequests, and receiving at least one of the one or more secondary content items (144) from the proxy server (130) using the secondprotocol.No. of Pages : 43 No. of Claims : 38 PATENT OFFICE JOURNAL 02/03/2012 3671
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2364/CHENP/2011 A(19) INDIA(22) Date of filing of Application :07/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : BREWING PROCESS :C12C5/00, (71)Name of Applicant :(51) International classification C12C7/04 1)NOVOZYMES A/S(31) Priority Document No :08166635.6 Address of Applicant :Krogshoejvej 36 DK-2880 Bagsvaerd(32) Priority Date :15/10/2008 Denmark :EUROPEAN (72)Name of Inventor :(33) Name of priority country UNION 1)KREISZ Stefan(86) International Application No :PCT/EP2009/063098 2)FREDERIKSEN Anne Mette Filing Date :08/10/2009(87) International Publication No : NA(61) Patent of Addition to Application :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A process for producing a wort comprising the steps of mixing a grist with water, adding a debranching enzyme, wherein saiddebranching enzyme has above 60% enzyme activity, at 64°C, for a period of 10 minutes, at pH 5.0, resting said mixture at 58-68°Cfor a period of 10-40 minutes, resting said mixture at 72-80°C, for a period of 5-20 minutes, and separating the wort from solidcomponentsNo. of Pages : 33 No. of Claims : 12 PATENT OFFICE JOURNAL 02/03/2012 3672
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2365/CHENP/2011 A(19) INDIA(22) Date of filing of Application :07/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : IMPROVEMENT OF ENZYMATIC HYDROLYSIS OF PRETREATED LIGNOCELLULOSE-CONTAINING MATERIAL WITH AGRICULTURAL RESIDUES :C12P7/10, (71)Name of Applicant :(51) International classification C12P19/02 1)NOVOZYMES NORTH AMERICA INC.(31) Priority Document No :61/101,464 Address of Applicant :77 Perry Chapel Church Road P.O.(32) Priority Date :30/09/2008 Box 576 Franklinton North Carolina 27525 United States of(33) Name of priority country :U.S.A. America(86) International Application No :PCT/US2009/059027 (72)Name of Inventor : Filing Date :30/09/2009 1)LI Xin(87) International Publication No : NA 2)CHEN Ye(61) Patent of Addition to Application :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A method for producing a fermentation product from a lignocellulose-containing material comprises pre-treating the lignocellulose-containing material; introducing agricultural residues to the pre-treated lignocellulose-containing material; exposing the pre-treatedlignocellulose-containing material to one or more hydrolyzing enzymes; and fermenting with a fermenting organism to produce afermentation product. The agricultural residues may be corn pith and/or corn cob.No. of Pages : 50 No. of Claims : 20 PATENT OFFICE JOURNAL 02/03/2012 3673
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2366/CHENP/2011 A(19) INDIA(22) Date of filing of Application :07/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : IMPROVEMENT OF ENZYMATIC HYDROLYSIS OF PRETREATED LIGNOCELLULOSE-CONTAINING MATERIAL WITH PAPER MILL SLUDGE(51) International classification :C12P19/02 (71)Name of Applicant :(31) Priority Document No :61/101,467 1)NOVOZYMES NORTH AMERICA INC.(32) Priority Date :30/09/2008 Address of Applicant :77 Perry Chapel Church Road PO Box(33) Name of priority country :U.S.A. 576 Franklinton North Carolina 27525 United States of America(86) International Application No :PCT/US2009/058920 (72)Name of Inventor : Filing Date :30/09/2009 1)LI Xin(87) International Publication No : NA 2)LUO Jing(61) Patent of Addition to Application :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A method for producing a fermentation product from a lignocellulose-containing material comprises pre-treating the lignocellulose-containing material; introducing paper mill sludge to the pre-treated lignocellulose-containing material; exposing the pre-treatedlignocellulose-containing material to an effective amount of hydrolyzing enzyme; and adding a fermenting organism to produce afermentation product. In an embodiment, the paper mill sludge comprises deinking paper sludge.No. of Pages : 51 No. of Claims : 17 PATENT OFFICE JOURNAL 02/03/2012 3674
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2402/CHENP/2011 A(19) INDIA(22) Date of filing of Application :08/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : METHOD AND APPARATUS FOR DETERMINING THE COUNTRY WHERE A MOBILE DEVICEHAS ACQUIRED SERVICE(51) International classification :H04W8/18 (71)Name of Applicant :(31) Priority Document No :61/106,300 1)QUALCOMM Incorporated(32) Priority Date :17/10/2008 Address of Applicant :Attn: International IP Administration(33) Name of priority country :U.S.A. 5775 Morehouse Drive San Diego California 92121-1714(86) International Application No :PCT/US2009/061074 UNITED STATES OF AMERICA Filing Date :16/10/2009 (72)Name of Inventor :(87) International Publication No : NA 1)ANANTHARAMAN Karthik(61) Patent of Addition to Application 2)HUTCHISON James A. :NANumber 3)GURGANUS Bryan :NA Filing Date 4)KANADE Parag Mohan(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :An apparatus and method for identifying a serving country using at least one system specific parameter comprising extracting the atleast one system specific parameter from a forward link signal; determining whether the at least one system specific parameter maps toa unique country; and identifying the serving country for a call.No. of Pages : 25 No. of Claims : 20 PATENT OFFICE JOURNAL 02/03/2012 3675
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2404/CHENP/2011 A(19) INDIA(22) Date of filing of Application :08/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : METHOD AND APPARATUS TO CONFIRM MOBILE EQUIPMENT HAS REMAINEDRELATIVELY STATIONARY USING ONE OR MORE PILOT SIGNAL(51) International classification :G01S5/02, G01S1/00 (71)Name of Applicant :(31) Priority Document No :12/262,923 1)QUALCOMM Incorporated(32) Priority Date :31/10/2008 Address of Applicant :Attn: International IP Administration(33) Name of priority country :U.S.A. 5775 Morehouse Drive San Diego California 92121-1714(86) International Application No :PCT/US2009/062696 UNITED STATES OF AMERICA Filing Date :30/10/2009 (72)Name of Inventor :(87) International Publication No : NA 1)HOLCMAN Alejandro R.(61) Patent of Addition to Application :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A tracking unit operably coupled to mobile equipment is provided. The tracking unit is capable of using a pilot channel for CDMAnetworks, a broadcast channel for GSM networks or the like, to determine that the tracking unit has remained relatively stationary.The tracking unit determines it has remained relatively stationary by determining that it is receiving the same radio frequency signalsat approximately the same strength as it previously received.No. of Pages : 33 No. of Claims : 30 PATENT OFFICE JOURNAL 02/03/2012 3676
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2408/CHENP/2011 A(19) INDIA(22) Date of filing of Application :10/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : METHOD FOR TESTING DRUG SENSITIVITY AND DEVICE THEREOF :C12Q1/04, (71)Name of Applicant :(51) International classification C12M1/16 1)Hunan-Tech New Medical Systems Co. Ltd.(31) Priority Document No :200910043007.0 Address of Applicant :Room 1608 16th Floor and 3rd door of(32) Priority Date :19/09/2009 Yuyuan Building No. 366 Fengling 2nd Road Changsha China-(33) Name of priority country :China 410000 China(86) International Application No :PCT/CN2010/000064 (72)Name of Inventor : Filing Date :14/01/2010 1)Jun PENG(87) International Publication No : NA(61) Patent of Addition to Application :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The present invention discloses a method for testing drug sensitivity and device thereof. The method comprises the steps of: preparingliquid samples by adding the medium containing gel materials to the concentrated bacterium or cell samples, adding coagulants to theliquid samples to form the colloidal samples, placing the drug test paper on the surface of the colloidal samples, and determining thedrug sensitivity by observing the drug inhibition zone after cultivation. The device for testing drug sensitivity is a box made oftransparent materials and comprises coagulants in its cavity.No. of Pages : 20 No. of Claims : 15 PATENT OFFICE JOURNAL 02/03/2012 3677
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2403/CHENP/2011 A(19) INDIA(22) Date of filing of Application :08/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : WAKE-UP TRIGGER FOR IMPLEMENTATION OF TARGET ACTIONS :H04L29/06, (71)Name of Applicant :(51) International classification H04W52/02 1)QUALCOMM Incorporated(31) Priority Document No :12/262,585 Address of Applicant :Attn: International IP Administration(32) Priority Date :31/10/2008 5775 Morehouse Drive San Diego California 92121-1714(33) Name of priority country :U.S.A. UNITED STATES OF AMERICA(86) International Application No :PCT/US2008/088330 (72)Name of Inventor : Filing Date :24/12/2008 1)KRISHNASWAMY Dilip(87) International Publication No : NA 2)KIM Frederick D.(61) Patent of Addition to Application 3)DALEY Robert S. :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :Aspects relate to automatic execution of a target action, which can be energy-intensive tasks, processing compute-intensive tasks,interaction with a node, or combinations thereof. A context aware trigger, power aware trigger, a randomly scheduled wakeup trigger,a deterministically scheduled wakeup trigger, and/or a predictively scheduled wakeup trigger can be utilized to determine theavailability of contexts associated with the target action. Based on the availability of a context that should be available, one or moretarget actions are automatically executed and/or selectively suspended.No. of Pages : 48 No. of Claims : 28 PATENT OFFICE JOURNAL 02/03/2012 3678
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2400/CHENP/2011 A(19) INDIA(22) Date of filing of Application :08/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : USER INTERFACE, DEVICE AND METHOD FOR PROVIDING A USE CASE BASED INTERFACE(51) International classification :G06F3/048 (71)Name of Applicant :(31) Priority Document No :12/241,974 1)NOKIA CORPORATION(32) Priority Date :30/09/2008 Address of Applicant :Keilalahdentie 4 FIN-02150 Espoo(33) Name of priority country :U.S.A. Finland(86) International Application No :PCT/FI2009/050705 (72)Name of Inventor : Filing Date :03/09/2009 1)Mikko Nurmi(87) International Publication No : NA 2)Tomi Viitala(61) Patent of Addition to Application :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :user interface includes a controller which is configured to receive a first and a second input identifying a first and a second objectassociated with each an attribute. The controller is also configured to pair the attributes to determine a resulting application accordingto the associated attributes and execute the resulting application.No. of Pages : 25 No. of Claims : 13 PATENT OFFICE JOURNAL 02/03/2012 3679
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2405/CHENP/2011 A(19) INDIA(22) Date of filing of Application :10/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : DEVICE AND METHOD FOR HORIZONTAL ROTARY JETTING CONSTRUCTION(51) International classification :E02D3/12, E02D7/24 (71)Name of Applicant :(31) Priority Document No :200810042915.3 1)SHANGHAI NO. 2 MUNICIPAL ENGINEERING CO.(32) Priority Date :12/09/2008 LTD.(33) Name of priority country :China Address of Applicant :Room 2301 Tonglian Tower No. 1565(86) International Application No :PCT/CN2009/000301 Jiaotong Road Putuo Shanghai 200065 China Filing Date :20/03/2009 (72)Name of Inventor :(87) International Publication No : NA 1)PENG Shaojie(61) Patent of Addition to Application 2)BAI Yun :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A construction device and a construction method for automatically balancing surrounding soil body pressure during a horizontal rotaryjetting reinforcement construction are provided. The device comprises a nozzle (1), a grouting pipe (2), a hole port sealing devicefixed to a working well wall, a valve (3) adjusting opening pressure automatically, and a pressure detection device (4). The pressuredetection device (4) is not mounted at the nozzle (1) or the grouting pipe (2), but mounted at the sealing device. The valve (3) will beopened automatically, when the slurry pressure is greater than the preestablished opening pressure of the value (3). Therefore, utilizingthe device and the method, the balance between the slurry pressure and the surrounding soil body pressure was kept all the time duringa horizontal rotary jetting reinforcement construction.No. of Pages : 27 No. of Claims : 10 PATENT OFFICE JOURNAL 02/03/2012 3680
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2409/CHENP/2011 A(19) INDIA(22) Date of filing of Application :11/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : SYSTEM AND METHOD FOR MEASURING EXTENSIONAL RHEOLOGY OF BODILY FLUID :G01N11/00, (71)Name of Applicant :(51) International classification G01N33/487 1)THE KOSASKY FAMILY TRUST(31) Priority Document No :NA Address of Applicant :160 Boylston Street Suite 2352(32) Priority Date :NA Chestnut Hill MA 02467 United States of America(33) Name of priority country :NA (72)Name of Inventor :(86) International Application No :PCT/US2009/042806 1)KOSASKY Harold J. Filing Date :05/05/2009(87) International Publication No : NA(61) Patent of Addition to Application :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The rheological apparatus contains a first mating surface and a second mating surface. A housing moveably orients the first matingsurface to the second mating surface. A biasing member contained within the housing is connected to the first mating surface. Thebiasing member biases the first mating surface to move away from the second mating surface. A handle is connected to the secondmating surface. The handle allows manual manipulation of the second mating surface. An extensional measurement device integralwith the housing is positioned to measure a distance between the first mating surface and the second mating surface.No. of Pages : 41 No. of Claims : 20 PATENT OFFICE JOURNAL 02/03/2012 3681
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2406/CHENP/2011 A(19) INDIA(22) Date of filing of Application :10/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : EXCAVATOR FOR FOUNDATION PIT (71)Name of Applicant :(51) International classification :E02F3/352 1)SHANGHAI NO. 2 MUNICIPAL ENGINEERING CO.(31) Priority Document No :200810203472.1 LTD.(32) Priority Date :27/11/2008 Address of Applicant :No. 3 Lane 13 Longwu Road Xuhui(33) Name of priority country :China District Shanghai 200232 China(86) International Application No :PCT/CN2009/000874 2)SHANGHAI URBAN CONSTRUCTION (GROUP) Filing Date :04/08/2008 CORPORATION(87) International Publication No : NA (72)Name of Inventor :(61) Patent of Addition to Application 1)BAI Yun :NANumber 2)PENG Shaojie :NA Filing Date 3)CHEN Lisheng(62) Divisional to Application Number :NA 4)ZHAO Guoqiang Filing Date :NA 5)SHEN Junhua 6)CHEN Chuancan(57) Abstract :An excavator for foundation pit comprises a bracket, an excavating device and a running mechanism. The bracket comprises twoparalleling long guides (9). The excavating device provided on the bracket comprises a turnover bucket (1) and a telescopic excavatingarm (4). The excavating device can move along the long guides (9) and rotate horizontally on the long guides (9). The runningmechanism comprises two double-caterpillar units (12) provided under the both ends of the bracket, each of the double-caterpillarunits (12) can rotate horizontally respectively.No. of Pages : 21 No. of Claims : 6 PATENT OFFICE JOURNAL 02/03/2012 3682
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2401/CHENP/2011 A(19) INDIA(22) Date of filing of Application :08/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : AUTOMATED CALL ROUTING BASED ON AN ACTIVE PRESENCE PROFILE(51) International classification :H04L29/08 (71)Name of Applicant :(31) Priority Document No :12/211,431 1)International Business Machines Corporation(32) Priority Date :16/09/2008 Address of Applicant :New Orchard Road Armonk New(33) Name of priority country :U.S.A. York 10504 UNITED STATES OF AMERICA(86) International Application No :PCT/EP2009/061855 (72)Name of Inventor : Filing Date :14/09/2009 1)LEI Io Tong(87) International Publication No : NA(61) Patent of Addition to Application :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A method and system for automatically routing a call to an identity of multiple identities (607) based on an active presence profile. Asubscription message is sent to a users contact addresses. The contact addresses include identities (607) of the user and indicators ofremote servers that manage real time communication systems. A presence document (3b) that includes a presence status of a firstidentity of the user is received. The presence status indicates that the first identity is offline. A registration message is issued to aremote server (614), resulting in a call redirection from the first identity (608) to a second identity (610). The second identity (610) isincluded in an active presence profile and is associated with a computing system (616) that receives the redirected call. If multiplepresence profiles of the user are active, a matching algorithm selects a contact address of one of the active presence profiles todetermine the call redirection.No. of Pages : 33 No. of Claims : 8 PATENT OFFICE JOURNAL 02/03/2012 3683
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2407/CHENP/2011 A(19) INDIA(22) Date of filing of Application :10/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : COLD-LAUNCH METHOD AND APPARATUS THEREOF(51) International classification :B64F1/06 (71)Name of Applicant :(31) Priority Document No :200810143241.6 1)Xuanzhe HU(32) Priority Date :19/09/2008 Address of Applicant :102 Building 9 Cuihu Village Hunan(33) Name of priority country :China University of Technology Wenhua Road Zhuzhou China.(86) International Application No :PCT/CN2009/000963 (72)Name of Inventor : Filing Date :21/08/2009 1)Xuanzhe HU(87) International Publication No : NA 2)Zhenhua HU(61) Patent of Addition to Application 3)Aiwu HU :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :A cold-launch method and apparatus are provided. The present invention follows the formula of accumulated energy quick releasing +effective transmission = launching movement . A gas-liquid combined cylinder (1) is used as the catapult mainbody and iscooperated with a gas tank (6) and a control valve (1-1). In the cold launch condition of the catapult being closed, the high energy gasstored in the gas tank of the catapult gets into a gas-access end of the gas-liquid combined cylinder through the control valve and isquickly released. Synchronously multistage pistons (10-12) in the liquid-access end of the gas-liquid combined cylinder are thrust tolaunch the load. An energy recovering device for the cold launch is provided. In one solution, an energy recovering pump (2-4) and atake-off cylinder (2-2) are installed on a shuttle carriage (2), and a position limiting cylinder (3-1) is mounted on a guide rail (2-5).Alternatively, a movable slide rail (2-6) is hinged to the front portion of the guide rail, and the energy recovering pump and the take-off cylinder are installed on said movable slide rail.No. of Pages : 21 No. of Claims : 10 PATENT OFFICE JOURNAL 02/03/2012 3684
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2410/CHENP/2011 A(19) INDIA(22) Date of filing of Application :11/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : METHODS AND COMPOSITIONS FOR INCREASING THE AMOUNTS OF PHOSPHORUSAVAILABLE FOR PLANT UPTAKE FROM SOILS :A01C1/06, (71)Name of Applicant :(51) International classification C09K17/00 1)NOVOZYMES BIOLOGICALS LIMITED(31) Priority Document No :08165591.2 Address of Applicant :3935 Thatcher Ave Saskatoon(32) Priority Date :01/10/2008 Saskatchewan S7R1A3 CANADA :EUROPEAN (72)Name of Inventor :(33) Name of priority country UNION 1)HNATOWICH Garry Lawrence(86) International Application No :PCT/CA2009/001390 2)STECKLER Shelagh Jean Filing Date :10/01/2009 3)LEGGETT Mary Elizabeth(87) International Publication No : NA 4)PRIEST Kari Lynn(61) Patent of Addition to Application :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The present invention relates to a method of enhancing growth conditions for plants by growing the plants in soil containing, inproximity to the plant roots, both a phosphorus source and at least two strains of the fungus Penicillium, particularly P. bilaiae, moreparticularly strains NRRL 50162 and NRRL 50169.No. of Pages : 26 No. of Claims : 19 PATENT OFFICE JOURNAL 02/03/2012 3685
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2439/CHENP/2011 A(19) INDIA(22) Date of filing of Application :11/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : CARBOHYDRATE BINDING MOLECULES :A61K45/06, (71)Name of Applicant :(51) International classification A61P31/00 1)UNIVERSITY COURT OF THE UNIVERSITY OF ST.(31) Priority Document No :61/096,569 ANDREWS(32) Priority Date :12/09/2008 Address of Applicant :College Gate North Street St.(33) Name of priority country :U.S.A. Andrews KY16 9AJ United Kingdom(86) International Application No :PCT/GB2009/002189 (72)Name of Inventor : Filing Date :11/09/2009 1)CONNARIS Helen(87) International Publication No : NA 2)TAYLOR Garry(61) Patent of Addition to Application :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The present invention provides compounds, compositions, medicaments and methods comprising or using carbohydrate bindingmolecules. More specifically, the invention provides a means of treating diseases and/or conditions caused or contributed to bypathogens, particularly microbial pathogens and methods of screening, identifying, detecting tagging and/or labeling carbohydrates.No. of Pages : 63 No. of Claims : 21 PATENT OFFICE JOURNAL 02/03/2012 3686
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2440/CHENP/2011 A(19) INDIA(22) Date of filing of Application :11/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : AUTOSTEROSCOPIC DISPLAY OF AN IMAGE(51) International classification :G02B27/22 (71)Name of Applicant :(31) Priority Document No :NA 1)HEWLETT-PACKARD DEVELOPMENT COMPANY(32) Priority Date :NA L.P.(33) Name of priority country :NA Address of Applicant :11445 Compaq Center Drive West(86) International Application No :PCT/US2008/082132 Houston TX 77070 U.S.A . Filing Date :31/10/2008 (72)Name of Inventor :(87) International Publication No : NA 1)Amir SAID(61) Patent of Addition to Application :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :In a method of creating an autostereoscopic display of an image, a plurality of images are received at a spatial-resolution-to-angular-resolutionconverter. The plurality of images each have differing incident angles with respect to the spatial-resolution-to-angular-resolution-converter. An autostereoscopically displayed image is created from the plurality of images using the spatial-resolution-to-angular-resolution-converter.No. of Pages : 31 No. of Claims : 15 PATENT OFFICE JOURNAL 02/03/2012 3687
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2444/CHENP/2011 A(19) INDIA(22) Date of filing of Application :12/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : ETHANOL PRODUCTION BY MICROORGANISMS(51) International classification :C12P7/06, C12N1/21 (71)Name of Applicant :(31) Priority Document No :61/106,543 1)JOULE UNLIMITED INC.(32) Priority Date :17/10/2008 Address of Applicant :83 Rogers St. Cambridge MA 02142(33) Name of priority country :U.S.A. (US) Tamil Nadu India(86) International Application No :PCT/US2009/055949 (72)Name of Inventor : Filing Date :03/09/2009 1)GREEN Brian(87) International Publication No : NA 2)REPPAS Nikos(61) Patent of Addition to Application 3)ROBERTSON Dan :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The present disclosure relates to methods and compositions for engineering photoautotrophic organisms to convert carbon dioxide andlight into fatty acid esters and other molecules, including biofuels. The molecules are then secreted by the organism into a growthmedium.No. of Pages : 274 No. of Claims : 20 PATENT OFFICE JOURNAL 02/03/2012 3688
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2446/CHENP/2011 A(19) INDIA(22) Date of filing of Application :12/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : POLYMERIC WAVELENGTH CONVERTING ELEMENTS :C09K11/02, (71)Name of Applicant :(51) International classification H01J1/00 1)KONINKLIJKE PHILIPS ELECTRONICS N.V.(31) Priority Document No :08164400.7 Address of Applicant :GROENEWOUDSEWEG 1(32) Priority Date :16/09/2008 EINDHOVEN 5621 BA NETHERLANDS(33) Name of priority country :EPO (72)Name of Inventor :(86) International Application No :PCT/IB2009/053978 1)DE CARVALHO ESTEVES Ana C. Filing Date :11/09/2009 2)COPIC Roel(87) International Publication No : NA 3)DE WITH Gijsbertus(61) Patent of Addition to Application 4)MAREE Chrysostomus H. M. :NANumber 5)VAN DER VEEN Niels :NA Filing Date 6)BROKKEN-ZIJP Josephina C. M.(62) Divisional to Application Number :NA 7)LAVEN Jozua Filing Date :NA(57) Abstract :A wavelength converting element (104), typically for a LED (101), is provided, comprising luminescent particles (105) dispersed in amatrix (106) comprising crosslinked polysiloxane. Crosslinked polysiloxanes are temperature stable, typically up to temperaturesabove 300C, meaning that they are stable under normal operating conditions of light emitting diodes. Further, crosslinkedpolysiloxanes are stable towards exposure to light, meaning that they will not degrade/discolor as a consequence of high intensity lightexposure. The polymeric wavelength converter can easily be shaped in different forms. This may lead to better outcoupling of the lightfrom a LED-converter system.No. of Pages : 22 No. of Claims : 15 PATENT OFFICE JOURNAL 02/03/2012 3689
  • (12) PATENT APPLICATION PUBLICATION (21) Application No.2449/CHENP/2011 A(19) INDIA(22) Date of filing of Application :12/04/2011 (43) Publication Date : 02/03/2012(54) Title of the invention : LIGHT-EMITTING ARRANGEMENT(51) International classification :F21K99/00 (71)Name of Applicant :(31) Priority Document No :08164417.1 1)KONINKLIJKE PHILIPS ELECTRONICS N.V.(32) Priority Date :16/09/2008 Address of Applicant :GROENEWOUDSEWEG 1(33) Name of priority country :EPO EINDHOVEN 5621 BA NETHERLANDS(86) International Application No :PCT/IB2009/053947 (72)Name of Inventor : Filing Date :09/09/2009 1)VAN ELMPT Rob F. M.(87) International Publication No : NA 2)DE KONING Niels(61) Patent of Addition to Application 3)JACOBS Jean P. :NANumber :NA Filing Date(62) Divisional to Application Number :NA Filing Date :NA(57) Abstract :The invention relates to a light-emitting arrangement comprising a printed circuit board, PCB, having at least one electrically andthermally conductive portion, a light-emitting diode, LED, being thermally connected to the at least one electrically and thermallyconductive portion by at least one contact of the LED, and a heat release member for dissipating heat generated by the LED, the heatrelease member being thermally connected to the at least one electrically and