Your SlideShare is downloading. ×
Large-scale data in life science
Upcoming SlideShare
Loading in...5
×

Thanks for flagging this SlideShare!

Oops! An error has occurred.

×

Introducing the official SlideShare app

Stunning, full-screen experience for iPhone and Android

Text the download link to your phone

Standard text messaging rates apply

Large-scale data in life science

1,445
views

Published on

Bigdata meetup in Tokyo at 8 Dec. 2011 by Tazro Inutano Ohta

Bigdata meetup in Tokyo at 8 Dec. 2011 by Tazro Inutano Ohta

Published in: Technology

0 Comments
4 Likes
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total Views
1,445
On Slideshare
0
From Embeds
0
Number of Embeds
4
Actions
Shares
0
Downloads
13
Comments
0
Likes
4
Embeds 0
No embeds

Report content
Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
No notes for slide

Transcript

  • 1. G E S C AL ELAR D A TA IN E SC IE N CE
  • 2. Update( new_suffix ){  current_suffix = active_point  test_char = last_char in new_suffix  done = false;  while ( !done ) {    if current_suffix ends at an explicit node {      if the node has no descendant edge starting with test_char        create new leaf edge starting at the explicit node      else        done = true;    } else {      if the implicit nodes next char isnt test_char {        split the edge at the implicit node        create new leaf edge starting at the split in the edge      } else        done = true;    }    if current_suffix is the empty string      done = true;    else       current_suffix = next_smaller_suffix( current_suffix )  }  active_point = current_suffix}
  • 3. photo by http://www.photoxpress.com/stock-photos/1814937
  • 4. photo by @meguu
  • 5. Large-scale data in Life Science Contentsfontin sans fonts by Jos Buivenga (exljbris). Thank You! -> www.exljbris.com
  • 6. NOW IS THE TION T-G ENERANEX ED ATA CAL NCE L ES ARG FE SCIE LI
  • 7. NOW IS THE TION T-G ENERANEX ED ATA CAL NCE L ES ARG FE SCIE LI
  • 8. DBCLS:DATABASE CENTER FOR LIFE SCIENCE
  • 9. Tazro Inutano Ohta @iNut/ Technical Specialist
  • 10. Large-scale data in Life Science
  • 11. or or ?ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAGCATGCATGCATGCATGCATGCATGCATGCAT or or ?GCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT photo by Togopic, Licensed under CreativeCommons 2.1 JP Attribution
  • 12. ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC Data ID : 000001ATGCATGCATGCATGCATGCATGCATGCATGATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCA organism : mouseTGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCA cell : nervous cellTGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCA sequencer : 454TGCATGCATGCATGCAGCATGCATGCATGCATGCATGCATGCATGCAT date : 2011 12 08GCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT photo by Togopic, Licensed under CreativeCommons 2.1 JP Attribution
  • 13. Next-generation sequencing data
  • 14. grazie per le informazioni @ma_ko * DNA exon
  • 15. *illumina HiSeq 2000
  • 16. https://twitter.com/#!/dritoshi/status/121817788200390656
  • 17. short read from NGSde novo assemble reference genome reference alignment
  • 18. short read from NGS de novode novo assemble reference genome reference alignment
  • 19. Velvethttp://www.ebi.ac.uk/~zerbino/velvet/SOAPdenovohttp://soap.genomics.org.cn/soapdenovo.htmlsequence assembly in wikipediahttp://en.wikipedia.org/wiki/Sequence_assembly
  • 20. short read from NGSde novo assemble reference genome reference alignment
  • 21. Chr1 Chr2 Chr3CPU1 CPU2 CPU3
  • 22. Troubles not yet shooted
  • 23. https://twitter.com/#!/dritoshi/status/110559890413600768
  • 24. https://twitter.com/#!/dritoshi/status/113546074760822784
  • 25. https://twitter.com/#!/dritoshi/status/114675417998311425
  • 26. http://bcbio.wordpress.com/tag/galaxy/
  • 27. ITPro http://itpro.nikkeibp.co.jp/article/NEWS/20110927/369510/
  • 28. grazie per le informazioni @yag_ays! asahi.com http://www.asahi.com/digital/bcnnews/BCN201111240007.html