Your SlideShare is downloading. ×
Michael Buckley - SEALS - Whole Exome Sequencing in the Clinic
Upcoming SlideShare
Loading in...5

Thanks for flagging this SlideShare!

Oops! An error has occurred.


Saving this for later?

Get the SlideShare app to save on your phone or tablet. Read anywhere, anytime - even offline.

Text the download link to your phone

Standard text messaging rates apply

Michael Buckley - SEALS - Whole Exome Sequencing in the Clinic


Published on

Associate Professor Michael Buckley, Clinical Director and Senior Staff Specialist, SEALS presented "Whole Exome Sequencing in the Clinic" at the National Pathology Forum 2013. …

Associate Professor Michael Buckley, Clinical Director and Senior Staff Specialist, SEALS presented "Whole Exome Sequencing in the Clinic" at the National Pathology Forum 2013.

This annual conference provides a platform for the public and private sectors to come together and discuss all the latest issues affecting the pathology sector in Australia. For more information, please visit the conference website:

Published in: Health & Medicine, Technology

  • Be the first to comment

  • Be the first to like this

No Downloads
Total Views
On Slideshare
From Embeds
Number of Embeds
Embeds 0
No embeds

Report content
Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

No notes for slide


  • 31. CCCAGATGCCCTGTTCCAGGAGGACAGCTACAAGAAACACCTGAAGCATCACTGTAACAAGTATGTTATTAGAGGGTGGACCTGGAGAGCTTAATTCCCTTTTTATTCTTTAAAAAATACATGCAGCCGGCCCTTCACGTCTGCAGATGCAGAACTCGCAGATTTGGAGGGTCAACTGAGGGACCTGAGCATCTGCGGATCTTGGTGTCTGAGGGGGGTCCTGGAACCATACTCCCGCGGATATGGAGGGACAGCTCTG TTATTAAGACTTTTAAATGGTATAGTTATTGCCTTTGCACAGCCTTATCATTTTTCTTGAAATGTGGTGTCAAGTTGCAGGAGAGCGTACCTTTAGGTGACTGATTATTTTTTAACATGGTAAGATACACAACACAACGTTTACCATTTTTACCATTTATAAGTGAACAATTCATTGGCATTAATTACACTCACAATGCTGTATACTCACTATCTGTACCTGAAATGTTTCCATCTTCCCAAATATAAACACTGTATCAATTAAACA SEALS Genetics Performance of WES for Targeted Diagnosis • Eleven published studies using the whole exome sequencing approach to target a set of genes. (Minimum of 6 unrelated probands) PMID Disorder Heterogeneity Cohort Known Novel Genes Mitochondria 10 84 42 7 5 23 20 41 18 163 12 9 111 76 9 3 48 7 3 1 20 1 Mitochondrial complex I deficiency PMID: 23596069 Suspected mitochondrial disorders. >1000 PMID: 22277967 mitochondrial oxidative phosphorylation disease >1000 K&N Sensitivity 12 15 PMID: 22499348 Known 70% 6% 55% 70% 37% 86% 60% 37% 60% 37% 3 11 67% 6% 83% 12% 5 2 7 33% 11% 42% 14% 89% 33% 56% 14% 26 13 Neurosensory disorders PMID: 23226338 Autosomal recessive nonsyndromic hearing loss. 39 PMID: 23661368 Leber congenital amaurosis. 19 Complex Neurological Disorders PMID: 23169490 Meckel-Gruber syndrome in Arabs 10 PMID: 23352163 Multipex families with autism. 70 Others PMID: 22662265 PMID: 22492991 Pre-screened MODY. Prescreened Congenital disorders of glycosylation I PMID: 23054246 Prescreened Familial Hypercholesterolaemia. PMID: 23409019 non-BRCA1/BRCA2 familial breast cancer 20 9 • Average sensitivity of mutation detection was 39% for known genes, rising to 54% for known plus novel genes (medians 42% and 60% respectively)