Twin studies

INDIAN DENTAL ACADEMY
Leader in continuing dental education
www.indiandentalacademy.com

www.indiandentalaca...
Introduction
The influence of genetic and environmental factors on growth and
development of the dentofacial complex has b...
Sir Francis Galton (1875) was the first person who suggested, that studies on
twins would be particularly useful in defini...
Methods of studying genetic inheritance

1. Family studies, Pedigree analysis
2. Twin studies
3. Contingency method
4. Con...
Family line Pedigree: One of the best methods to identify the characteristics or
diseases that cannot be explained by any ...
Types of twins: 1. Monozygotic and 2. Dizygotic
Monozygotic twins: They are two individuals developed from a single fertil...
Although twin studies have several limitations like identification of different
types of twins as well as their developmen...
Causes of Fraternal Twinning:
It is felt that fraternal twins are conceived due to higher levels of Follicular
Stimulating...
Twinning rates in Tamilnadu:

Rao PS. Inbaraj SG, Muthurathnam S.

Reported twining rates and relates these to maternal ag...
Mechanism of twinning
Steinman .G
Examined the role of calcium in conjoined twinning.
Conjoined twins are an extreme examp...
Delayed ovulation and monozygotic twinning: Bomsel-Helmreich, Papiernik-Berkhauer.E
The relation between MZ twinning, chro...
Markers to identify the zygosity in twins
I. Morphologic marker:
1. Somatoscopic –Color and texture of skin ,hair, and eye...
Dermatoglyphics
Proposed by Cummins and Midlo (1926) implies the study of
patterned tracies of fine ridges on the digits a...
Spitz, Moutin, Busnel –Used dermatoglyphics to establish zygosity in twins and
Correctly classified 86.75% of pairs.

Plai...
MONOZYGOTIC TWINS

DIZYGOTIC TWINS

www.indiandentalacademy.com
ROLLED PRINT

PLAIN PRINT
TYPES OF FINGERPRINTS

ACCIDENTAL WHORL
www.indiandentalacademy.com

LOOP
Core
Delta
WHORL

TENTED ARCH

ARCH
: FINGERPRINT PATTERNS
www.indiandentalacademy.com
Cardinal points
With the exception of the arch patterns and accidental patterns, other
patterns viz loops, whorls, twinned...
Ridge characteristics

Tracing the courses of an individual ridge, some ridges end abruptly, while others
fork and become ...
Ridge counts
Since the arch and Tented arch patterns do not have the cardinal points (i.e. core
and delta), no ridge count...
Pattern type
.

S.N
o

Pattern type

Subdivision

Symbo
l

1.

Arches

Plain Arches
Tented Arches

A
T

2.

Loops

Radical...
Different types of genetic markers
• SCAR Sequence Characterized Amplified Region
• RFLPs Restriction Fragment Length Poly...
What are microsatellites ?
These are short sequence of nucleotides (such as GATA)
which are repeated over and over again a...
DNA: key
points
Double stranded

alphabet of DNA
Nucleotides;
2 nucleotides
= 1 base pair

Attraction between
base pairs: ...
Where are microsatellites found?

Microsatellites

www.indiandentalacademy.com

Majority are in non-coding region
Homozygous
Homozygous twins
, CGTAGCCTTGCATCCTTCTCTCTCTCTCTCTATCGGTACTACGTGG…
…CGTAGCCTTGCATCCTTCTCTCTCTCTCTCTATCGGTACTACG...
Excellent marker for DNA fingerprinting because:


Polymorphic (fast-evolving)



Single locus



Neutral (non-coding)
...
DNA Fingerprinting (DNA typing/profiling)

•

•

No two individuals produced by sexually
reproducing organisms (except ide...
Micro satellite analysis include the following steps,


DNA isolation from twin samples



Quantification of DNA. (Spect...
DNA Isolation

Vacuette –Disposable Syringe.

Thermopak box

Cold room
www.indiandentalacademy.com Autoclaving units
DNA isolation

Falcon tubes

After centrifuge-Pellet

Centrifuge

Reagent B

Centrifuge

Phenol and chloroform

www.indian...
Centrifuge

Eppendroff tubes

Isolated DNA

Spin

www.indiandentalacademy.com

Drying
Optical density( O.D)
Optical density

Spectrophotometer

www.indiandentalacademy.com
Gel electrophoresis

Gel tray

Elec weighing machine

Autoclave

DNA diluent with loading dye

www.indiandentalacademy.com...
Transilluminating Equipment

www.indiandentalacademy.com

Gel picture under UV light of transilluminator
Locus, repeat motif,size range and dye label of AmpFlSTR Profiler Plus kit

PCR kit used – AmpFlSTR Profilier Plus kit

Lo...
Polymerized Chain Reaction ( PCR)
Steps

Conditions

Initial denaturation

95°c

28 cycles at

94°C

11 min
1 min

59°C

1...
PCR: Polymerase Chain Reaction

A 3 stage process that
is temperature dependent:

Step 1: with heat, the two
DNA stands se...
PCR amplification:

Wow ! That’s a lot of copies

www.indiandentalacademy.com
Taq Polymerase

Hot water bacteria:
Thermus aquaticus
Taq DNA polymerase
www.indiandentalacademy.com
Gene Scan Analysis

Automated DNA Sequencer- ABI Prism 3700

www.indiandentalacademy.com
Genotyping

ZYGOSITY DETERMINATION – GENE SCAN ANALYSIS REPORT FOR
www.indiandentalacademy.com
MONOZYGOTIC TWIN PAIR
ZYGOSITY DETERMINATION – GENE SCAN ANALYSIS REPORT FOR
DIZYGOTIC TWIN PAIR
www.indiandentalacademy.com
Arya et, al
26 pairs of monozygotic and 16 pairs of dizygotic like sexed twins cephalograms
were analyzed to find out the ...
Robert S. Corruccini, Rosario Potter
conducted a study on the occlusal characteristics in 32 pairs of monozygotic

twins a...
Susanne C, Defrise – Gussenhoven E, Van Wanseele, Tassin A

Analyzed 17 head and face measurements of 205 twin pairs, aged...
Sharma K. Corruccini RS, Henderson AM (1985)
studied 58 pairs of twins (23 MZ and 35DZ) from Chandigarh INDIA .
, Indian M...
Lundstrom and McWilliams (1987)
conducted a study to compare horizontal and vertical cephalometric distances
with regard t...
Brown et al

studied the dentofacial characteristics of South Australian twins with an objective
to develop methods for th...
Lundstrom and Mc William

Compared some vertical and horizontal cephalometric size variables as regard to
heritability in ...
Burke studied facial morphology in twins.
Facial morphology has been important in twin studies and two dimensional
photogr...
Sorin M.S, Ramsey TC, Hart TC, and Farrington FH

Digitized lateral cephalograms of 33 families of monozygotic twins and t...
Vanco C. Sergi.R, KasaiK, Richards L.C, Townsend G.C: et al
selected lateral photographs of 23 male and 19 female monozygo...
Claudio.M, Martina.R, G.B.Grossi
heritability of 39 lateral cephalometric variables were estimated by statistical
method o...
Savoye, Loose, Carels Deron

evaluated the genetic and environmental contribution to facial proportions and
compared them ...
Liu H, Deng H, Cao CF, Ono H.
Studied systematically the heritability of dental traits in 82 pairs of female –
female twin...
Mossey. P.A. (1999)
reviewed various studies regarding heritability of malocclusion and concluded
that there is considerab...
Conclusion
• A full knowledge of interplay between
environmental and genetic patterns
involved in the development of crani...
T
h
a
n
k
U

www.indiandentalacademy.com
Singh GD, Kutcipal E, Mc Namara JA.
Investigated the craniofacial morphology in twins with cleft lip and/or palate
.and lo...
Identical Twins:
When one egg is fertilized by one sperm cell, and then divides and separates,
two identical cells will re...
Upcoming SlideShare
Loading in …5
×

Twin studies seminar1 /certified fixed orthodontic courses by Indian dental academy

678
-1

Published on


The Indian Dental Academy is the Leader in

continuing dental education , training dentists

in all aspects of dentistry and offering a wide

range of dental certified courses in different

formats.

Indian dental academy provides dental crown &

Bridge,rotary endodontics,fixed orthodontics,
Dental implants courses.for details pls visit

www.indiandentalacademy.com ,or call
0091-9248678078

0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total Views
678
On Slideshare
0
From Embeds
0
Number of Embeds
0
Actions
Shares
0
Downloads
8
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Twin studies seminar1 /certified fixed orthodontic courses by Indian dental academy

  1. 1. Twin studies INDIAN DENTAL ACADEMY Leader in continuing dental education www.indiandentalacademy.com www.indiandentalacademy.com
  2. 2. Introduction The influence of genetic and environmental factors on growth and development of the dentofacial complex has been the topic of debate and controversy from ancient times till date. As far as dentofacial deformities and malocclusion are concerned, there is arguably a significant role for the case being genetic. How and why disease show a familial distribution has been the goal of many genetic epidemiological studies. A better understanding of the relative effects of genes and environment on dentofacial and occlusal parameters should improve our knowledge on the etiology of orthodontic disorders and therefore also on the possibilities and limitations of the orthodontic treatment and treatment planning Heredity has been investigated by racial, family-line, and twin method, the influence of heredity can be assessed by studying the family members, observing the similarities and differences between mother-child, fatherchild, and sibling pairs www.indiandentalacademy.com
  3. 3. Sir Francis Galton (1875) was the first person who suggested, that studies on twins would be particularly useful in defining the parts played by hereditary and environmental influences in determining the form and size of the human body. He suggested that different rates of growth towards a similar final outcome might be found and stated that “Twins afford the most potential tools to evaluate the interaction between “Nature and Nurture”. The twin method is one of the most effective methods available for investigating genetically determined variables in orthodontics as well as in other medical fields, depending on the variance in the shape and the size of skull and teeth on genetic and environmental influences. www.indiandentalacademy.com
  4. 4. Methods of studying genetic inheritance 1. Family studies, Pedigree analysis 2. Twin studies 3. Contingency method 4. Consanguinity method. 5. Population studies. 6. Racial comparisons. 7. Cytogenetic studies 8. Correlation studies www.indiandentalacademy.com
  5. 5. Family line Pedigree: One of the best methods to identify the characteristics or diseases that cannot be explained by any other way can be done by their occurrence between parents and offspring's. A large number of families are necessary to be included in such studies. but one should take into consideration the possibility that the trait can be dominant (1:1) or recessive(3:1) in the population examined. The larger the number of generations, the better a trait can be traced by repetitive occurrence. Inbreeding: Some special family line studies lead to a better understanding of the mechanism of transmission of characteristics. The study of inbreeding is undertaken among isolated groups because there is a greater chance of recessive traits to be produced often. A study of a group where polygamy is practiced helps us in identifying the traits transmitted by the father through different mothers to the children. Twin studies: The twin method is one of the most effective methods available for investigating genetically determined variables in orthodontics as well as in other medical fields, depending on the variance in the shape and the size of skull and teeth on genetic and environmental influences www.indiandentalacademy.com
  6. 6. Types of twins: 1. Monozygotic and 2. Dizygotic Monozygotic twins: They are two individuals developed from a single fertilized ovum, which divides into two at an early stage of development .Monozygotic twins thus have a genetic make-up identical to each other. Dizygotic twins: They are two individuals developed from two separate ova, ovulated and fertilized at the same time. The two ova are fertilized by two different sperms. They are not genetically identical as they develop from different embryos. They are analogous to siblings except that they have an almost similar developmental environment including the intrauterine life. Twin studies are done by analyzing monozygotic and dizygotic twins in a specific manner. In case of monozygotic twins, they have a similar genetic makeup ,but postnatally some of them have different environmental conditions. This helps us to study the expression of the genetic factors and at the same time, the environmental influences on this genetic expression. similarly in case of dizygotic twins who have a similar environmental condition, the influence of genetic as well as the environmental factors in the expression and development www.indiandentalacademy.com of an individual can be studied.
  7. 7. Although twin studies have several limitations like identification of different types of twins as well as their developmental environment, work of many researches have thrown light into the understanding of genetic contribution in the growth and development of an individual. Causes of Identical Twinning: It is not really known how identical twinning occurs, but there are some theories. One theory is that it may be related to aging of the egg after ovulation: an “over -ripe”egg. Another theory states that since the rate of identical twins is higher in mothers who are either very young or very old ,identical twins may be due to the hormonal imbalances seen at these ages. Supporting this, mothers of identical twins have been shown to have an earlier menopause, which is also due to hormones. Having two sets of identical twins would be a rare occurrence. The odds of having more than one set of identical twins are at least one in 70,000. www.indiandentalacademy.com
  8. 8. Causes of Fraternal Twinning: It is felt that fraternal twins are conceived due to higher levels of Follicular Stimulating Harmone (FSH) in the mother. This Harmone stimulates the growth and ripening of the eggs. Mother of fraternal twins tend to have increased height, and weight, earlier start of the menstrual cycle, and shorter menstrual cycles, all of which are probably hormone-related. Once you have had fraternal twins, your chance of having another set of twins is three to four times that of the general population. Changing trends in Twinning: Acta Genet Med Gemellol 1993; 42 (3-4); 289-94 Biostatistics indicates a fall in the DZ twinning rate and a rise in the MZ twinning over the decade between 1982-1991.These figures seem to reverse the trend of the period 1960-1982.One plausible explanation is offered by the age – data on mothers, which indicate that twins of different sex are more frequently born to mothers above the age of 35.Since extensive family planning measures have reduced the upper age limit of mothers, the birth-rate of twins of different sex has also fallen. Due to the increased proportions of twins of the same sex, Weinberg’s differential method will therefore report a decline in the DZ twinning rate, wherever the mean age of mothers has fallen (I.e. most mothers do not reproduce after the age of 35) www.indiandentalacademy.com
  9. 9. Twinning rates in Tamilnadu: Rao PS. Inbaraj SG, Muthurathnam S. Reported twining rates and relates these to maternal age, parity, and consanguinity. Birth weights and other dimensions at birth and infant mortality are studied. The overall twinning rate was 1 in 115 births.DZ twinning rates increased significantly with maternal age and parity. The measurements at birth for likesexed twin pairs were lower than that of unlike-sexed, but the mortalities did not differ significantly. Twins in general, had a several fold increase in mortality as compared with singletons. The twinning rates and epidemiological characteristics of births in southeast Uttar Pradesh,-India. Sharma The data revealed higher incidence of breech twins (11.84% of all cotwins) as compared to breech single births (2.18%).But the perinatal mortality and caesarean section rates were similar in both twin and singleton pregnancies. The twinning rate for mothers over 35yrs of age was about four times higher than that in mothers younger than 20 yrs. Seasonal variations were observed for both twin and singleton births. The highest frequency of births was observed from August through October. But seasonal index for twinning rate showed a clear bimodal distribution with peaks in April and September. www.indiandentalacademy.com
  10. 10. Mechanism of twinning Steinman .G Examined the role of calcium in conjoined twinning. Conjoined twins are an extreme example of MZ twinning. Women were subjected to environmental triggers. There is an increase in conjoint twinning following use of oral contraceptives. It is hypothesized that this resulted from prolonged ovulatory dysfunction in lightweight women. The incidence of uniovular twinning is inversely related to women's prepregnancy weights. Concluded that factors that induce calcium depression, and delayed implantation encourage uniovular duplication in general, and CJ twinning in particular. Maternal smoking and twinning:. Kallen.K Smoking women, compared with non-smoking women, were at increased risk of having DZ twins, but the risk increase was only evident among multiparas.No association was found between MZ twinning and maternal smoking. Social class and human twinning: Bonnelykke.B A trend was found in DZ –twinning, with significantly fewer DZ-twins born in the lower social classes, but not in MZ-twinning. All results were controlled for www.indiandentalacademy.com maternal age and parity.
  11. 11. Delayed ovulation and monozygotic twinning: Bomsel-Helmreich, Papiernik-Berkhauer.E The relation between MZ twinning, chromosomal anomalies, and embryonic mortality induced by delayed ovulation, could be connected and related to the poor perinatal conditions frequently observed in human MZ twins. The factors that influence twinning rates. - Nylander P.P Found that DZ twinning rates varied with maternal age and parity, the MZ twinning rate remaining fairly constant .Other factors that influence DZ twinning rates were maternal height, social class, ethnicity, and illegitimacy. No significant association was found between twining and maternal blood groups or season of the year. An important factor that also influences twinning was maternal serum FSH level. www.indiandentalacademy.com
  12. 12. Markers to identify the zygosity in twins I. Morphologic marker: 1. Somatoscopic –Color and texture of skin ,hair, and eyes. 2. Somatometric : Shape of head, facial features, nose, eye statuses. 3. Anthropometric – Human body measurements. II. Traditional markers; 1. Dermatoglyphics : Study of dermal ridges on the palms. 2. Behavioral – Tongue rolling, arm folding, presence or absence of mid phalangeal hair. III. Genetic markers; 1. Blood group 2. Proteins and isoenzymes. 3. DNA / Molecular marker ( DNA polymorphism) www.indiandentalacademy.com
  13. 13. Dermatoglyphics Proposed by Cummins and Midlo (1926) implies the study of patterned tracies of fine ridges on the digits and palms. Several studies have shown that most dermatoglyphic traits are inherited with varying degree of complexity. MZ twins show high intrapair similarity than DZ twins. Finger prints are divided into 3 main groups consisting of Arches – 5% loops -65% whorls. – 30% Studies have shown that there is considerable difference with respect to heritability, values between palmer and sole patterns, in that they are the highest for sole loops, and triradii and the lowest for mot palmar loops.----Finger print facts Dienekes-Anthropology -2003 www.indiandentalacademy.com
  14. 14. Spitz, Moutin, Busnel –Used dermatoglyphics to establish zygosity in twins and Correctly classified 86.75% of pairs. Plain and rolled impressions Fingerprints are impressions of the inner surfaces of the fingers from the first joints to the tips. When a print is made by simple contact between the finger and a receptive surface it is called as a PLAIN impression. To record the finger impression in full from the ridged surface, it is necessary to roll the finger from one nail end to the other end. Because of the method adopted, the resultant impression is called a ROLLED impression www.indiandentalacademy.com
  15. 15. MONOZYGOTIC TWINS DIZYGOTIC TWINS www.indiandentalacademy.com
  16. 16. ROLLED PRINT PLAIN PRINT TYPES OF FINGERPRINTS ACCIDENTAL WHORL www.indiandentalacademy.com LOOP
  17. 17. Core Delta WHORL TENTED ARCH ARCH : FINGERPRINT PATTERNS www.indiandentalacademy.com
  18. 18. Cardinal points With the exception of the arch patterns and accidental patterns, other patterns viz loops, whorls, twinned loops and lateral pocket loops are either subdivided by “Counting” or “tracing” the ridges between the cardinal points, or fixed points namely, the CORES and the DELTA’s. Core : The core means the central point of the pattern. It is near the point where the innermost ridge re-curves. In loop and whorl patterns there is only one core. In twinned loops and lateral pocket loops there are two cores. Delta : The delta, as its triangular structure occurs at the point where the ridges, flowing across the finger, separate to enclose the basic pattern. One delta is found in loop patterns and two deltas are found in whorls, twinned loops and lateral pocket loops. Accidental patterns may have more than two deltas. Core Delta WHORL www.indiandentalacademy.com
  19. 19. Ridge characteristics Tracing the courses of an individual ridge, some ridges end abruptly, while others fork and become two. Sometimes, the limbs of such a fork join together again almost at once and form an “enclosure”. Occasionally short independent ridges and “Spur” formations occur. These peculiarities are called RIDGE CHARACTERISTICS. The different type of ridge characteristics are : • • • • • Termination, or ending Bifurcation, or fork Enclosure, or lake Independent ridge or island Spur www.indiandentalacademy.com
  20. 20. Ridge counts Since the arch and Tented arch patterns do not have the cardinal points (i.e. core and delta), no ridge counts are possible for these two patterns. Ridge counts are given for the loop, whorl and composite patterns. In loops, the number of ridges intervening between the core and delta are to be counted. In whorls, which occur in right hand fingers, the ridges intervening between the core and left side delta are counted and whereas the whorls, which occur in left hand fingers the ridges intervening between the core and right side delta are counted In twinned loops and lateral pocket loops there are two well defined loops called ascending loop and descending loop. In these two patterns, the number of ridges intervening between the core and delta of the ascending loop are to be counted. Since the accidental patterns have more than two deltas, it is not considered for ridge counts. www.indiandentalacademy.com
  21. 21. Pattern type . S.N o Pattern type Subdivision Symbo l 1. Arches Plain Arches Tented Arches A T 2. Loops Radical Loops Ulnar Loops R U 3. Whorls 4. Composite Numerical value Pattern type - W Twinned Loops Lateral pocket loops Accidentals Numerical value Arch 1 Tented Arch 2 Radial Loop 3 Ulnar Loop 4 Whorl 5 Twinned Loop 6 Lateral Pocket loop www.indiandentalacademy.com Accidental 7 8 TL LP AC
  22. 22. Different types of genetic markers • SCAR Sequence Characterized Amplified Region • RFLPs Restriction Fragment Length Polymorphism • AFLP Amplified Fragment length Polymorhisms • RAPD-PCR Randomly amplified polymorphic PCR • Direct In-situ Single Copy PCR (DISC-PCR) • Microsatellite analysis www.indiandentalacademy.com
  23. 23. What are microsatellites ? These are short sequence of nucleotides (such as GATA) which are repeated over and over again a number of times in tandem. Also called as 1. SSR (Simple sequence repeat ) 2. STR (Short tandem repeat) 3. VNTR (Variable number tandem repeat) www.indiandentalacademy.com
  24. 24. DNA: key points Double stranded alphabet of DNA Nucleotides; 2 nucleotides = 1 base pair Attraction between base pairs: bonds G with C; A with T. www.indiandentalacademy.com
  25. 25. Where are microsatellites found? Microsatellites www.indiandentalacademy.com Majority are in non-coding region
  26. 26. Homozygous Homozygous twins , CGTAGCCTTGCATCCTTCTCTCTCTCTCTCTATCGGTACTACGTGG… …CGTAGCCTTGCATCCTTCTCTCTCTCTCTCTATCGGTACTACGTGG… 5’ flanking region 3’ flanking region Dizygous twins Heterozygous CGTAGCCTTGCATCCTTCTCTCTCTCTCTCT ATCGGTACTACGTGG… …CGTAGCCTTGCATCCTTCTCTCTCTCTCTCTCTCTATCGGTACTACGTGG www.indiandentalacademy.com
  27. 27. Excellent marker for DNA fingerprinting because:  Polymorphic (fast-evolving)  Single locus  Neutral (non-coding)  Relative ease of use  High levels of accuracy  Repeatable www.indiandentalacademy.com
  28. 28. DNA Fingerprinting (DNA typing/profiling) • • No two individuals produced by sexually reproducing organisms (except identical twins) have exactly the same genotype. Why? – Crossing-over of chromosomes in meiosis prophase I. – Random alignment of maternal/paternal chromosomes in meiosis metaphase I. – Mutation – DNA replication errors (same effect as www.indiandentalacademy.com mutation)
  29. 29. Micro satellite analysis include the following steps,  DNA isolation from twin samples  Quantification of DNA. (Spectrophotometer)  Gel electrophoresis  Polymerized chain reaction (PCR) using 9 STR loci PCR machine –Gene Amp 9700 PCR kit –AmpF/STR Profilier Plus kit  Gene scan analysis of PCR amplicons using automated DNA sequencer ( ABI Prism 3700 )  Genotyping. www.indiandentalacademy.com
  30. 30. DNA Isolation Vacuette –Disposable Syringe. Thermopak box Cold room www.indiandentalacademy.com Autoclaving units
  31. 31. DNA isolation Falcon tubes After centrifuge-Pellet Centrifuge Reagent B Centrifuge Phenol and chloroform www.indiandentalacademy.com Centrifuge Aqueous , protein and solvent layers
  32. 32. Centrifuge Eppendroff tubes Isolated DNA Spin www.indiandentalacademy.com Drying
  33. 33. Optical density( O.D) Optical density Spectrophotometer www.indiandentalacademy.com
  34. 34. Gel electrophoresis Gel tray Elec weighing machine Autoclave DNA diluent with loading dye www.indiandentalacademy.com Electrophoresis app Before electrophoresis After electrophoresis
  35. 35. Transilluminating Equipment www.indiandentalacademy.com Gel picture under UV light of transilluminator
  36. 36. Locus, repeat motif,size range and dye label of AmpFlSTR Profiler Plus kit PCR kit used – AmpFlSTR Profilier Plus kit Locus Region D3S1358 3p vWA Common Sequence motif Size range(bp)a Dyelabel TCTA(TCTG)1-3(TCTA)n 114-142 5-FAM 12p TCTA(TCTG)3-4 (TCTA)n 157-197 5-FAM FGA 4q28 (TTTC)3TTTT TTCT 219-267 5-FAM D8S1179b 8 (TCTA)n C 128-168 JOE D21S11 21 189-243 JOE D18S51 18q21 (AGAA)n 273-341 JOE D5S818 5q21-31 (AGAT)n 135-171 NED D13S317 13q22-31 (GATA)n 206-234 NED D7S820 7q (GATA)n 258-294 NED (TCTA)n(TCTG)n(TCTA)3 A(TCTA)3TCA(TCTA)2TCCA TA T(TCTA)n www.indiandentalacademy.com
  37. 37. Polymerized Chain Reaction ( PCR) Steps Conditions Initial denaturation 95°c 28 cycles at 94°C 11 min 1 min 59°C 1 min 72°C 1 min Final Extension 60°C 45 min Hold at 25°C Forever Gene AMP 9700 www.indiandentalacademy.com
  38. 38. PCR: Polymerase Chain Reaction A 3 stage process that is temperature dependent: Step 1: with heat, the two DNA stands separate Step 2: with cooling, primers bind to the DNA in the desired location Step 3: with more heat, new nucleotides are added at the ends of the primers making 2 new DNA strands www.indiandentalacademy.com
  39. 39. PCR amplification: Wow ! That’s a lot of copies www.indiandentalacademy.com
  40. 40. Taq Polymerase Hot water bacteria: Thermus aquaticus Taq DNA polymerase www.indiandentalacademy.com
  41. 41. Gene Scan Analysis Automated DNA Sequencer- ABI Prism 3700 www.indiandentalacademy.com
  42. 42. Genotyping ZYGOSITY DETERMINATION – GENE SCAN ANALYSIS REPORT FOR www.indiandentalacademy.com MONOZYGOTIC TWIN PAIR
  43. 43. ZYGOSITY DETERMINATION – GENE SCAN ANALYSIS REPORT FOR DIZYGOTIC TWIN PAIR www.indiandentalacademy.com
  44. 44. Arya et, al 26 pairs of monozygotic and 16 pairs of dizygotic like sexed twins cephalograms were analyzed to find out the genetic variability of 6 mandibular dimensions and 3 craniofacial dimensions. The sample was tested as to whether an individual bone showed any larger component of genetic variability than that shown by the craniofacial complex. The genetic component was predominant in the variability of all the dimensions measured except the dimensions left gonion-right gonion in which the environmental component of the variability was predominant. Mandibular dimensions showed a greater component of genetic variability than that showed by the craniofacial dimensions. The length and width of the mandible appeared to have a greater component of genetic variability than did the height dimensions indicating that the height dimensions are more susceptible to environmental influences www.indiandentalacademy.com
  45. 45. Robert S. Corruccini, Rosario Potter conducted a study on the occlusal characteristics in 32 pairs of monozygotic twins and 28 pairs of dizygotic twins using dental stone casts. Zygosity was determined using serologic and dermatoglyphics criteria. They studied arch shape, size, and symmetry, overjet. Overbite, posterior cross bite, buccal segment relation, rotations and displacements. They concluded that arch size variation, tooth displacement and cross bite showed significant genetic variance. They also concluded an increased environmental component of variance in occlusion. www.indiandentalacademy.com
  46. 46. Susanne C, Defrise – Gussenhoven E, Van Wanseele, Tassin A Analyzed 17 head and face measurements of 205 twin pairs, aged 18 to 25 years. They found significant genetic variance for both sexes in face length, head breadth, and frontal breath, for several breadth measurements of the face for physio – face height, and nose height. A significant genetic variance component is found for Nasion – Gnathion, Nasion – stomion, and lip height in males, and for the two ear measurements in females. They suggested that the sex differences for heritability may be due to random factors and to continued growth from 18 – 25 years in males www.indiandentalacademy.com
  47. 47. Sharma K. Corruccini RS, Henderson AM (1985) studied 58 pairs of twins (23 MZ and 35DZ) from Chandigarh INDIA . , Indian MZ twins had higher variance than did DZ in most instances. There was also evidence of strong environmental covariance for MZ and DZ twins. The study revealed substantial, complex environmental determination for some dental dimensions especially for incisors and second molars. www.indiandentalacademy.com
  48. 48. Lundstrom and McWilliams (1987) conducted a study to compare horizontal and vertical cephalometric distances with regard to heritability. The material used consisted of 56 pairs of twins of the same sex ranging from 13-20 years of age. Heritability (h2) and cultural inheritance (c2) were determined according to the path analysis method and quotients between genetic and environmental standard deviations were compared. No systemic difference could be found between horizontal and vertical measurements, but the highest heritability values were obtained among four vertical variables. www.indiandentalacademy.com
  49. 49. Brown et al studied the dentofacial characteristics of South Australian twins with an objective to develop methods for the quantification and analysis or morphological asymmetry in the facial structures using dental casts and stereo photographs of the face. They observed some interesting features of facial morphology, particularly asymmetry in a pair of monozygotic twin pair. There was close match between the face of a twin and the mirror image of his brother than there was between the original faces. Evidence of mirror imaging was also present in the maxillary dentition, for example in the position of the central incisors and eruption sequence of the third molars www.indiandentalacademy.com
  50. 50. Lundstrom and Mc William Compared some vertical and horizontal cephalometric size variables as regard to heritability in twins, the sample consisted of 28 pairs of monozygotic and 27 pairs of dizygotic twins. The highest heritability coefficients were found for facial height to facial depth and for upper to lower sella-apical base distances, while the lowest was for upper to lower sella incisal edge distances www.indiandentalacademy.com
  51. 51. Burke studied facial morphology in twins. Facial morphology has been important in twin studies and two dimensional photography was generally used to record the face. A technique of three dimensional photogrametry was described, which has been used to examine intrapair differences in facial parameters in 18 pairs of twins. Zygosity was first determined by using serological tests, standing height, finger, print ridge count, tooth size, hair and eye color. Stereoscopy was then used to measure 13 facial parameters and compare intrapair differences in facial parameters size in monozygotic and dizygotic twins. The results when compared with other tests showed that stereoscopic vision recorded similar faces in monozygotic and dissimilar faces in dizygotic twins and had a real basis which could be measured dimensionally www.indiandentalacademy.com
  52. 52. Sorin M.S, Ramsey TC, Hart TC, and Farrington FH Digitized lateral cephalograms of 33 families of monozygotic twins and their siblings. Eight skeletal parameters were measured: FA to SN, SNA, SNB, ANB, angle of convexity, mandibular plane to SN angle, Y- axis and pogonion to NB distance. MZ twin pairs and their siblings showed a normal distribution pattern for all the skeletal parameters, except the pogonion to NB distance measurement. There was found to be statistically significant correlation between age and facial angle and ANB.A familial aggregation effect was found for SNA, ANB, and angle of convexity. Some genetic influence was found for FA, mandibular plane angle and Y- axis, while the Pg to NB distance showed neither genetic influence, nor a familial aggregation. www.indiandentalacademy.com
  53. 53. Vanco C. Sergi.R, KasaiK, Richards L.C, Townsend G.C: et al selected lateral photographs of 23 male and 19 female monozygous (MZ), and 15 male and 22 female dizygous (DZ) twin pairs from the records of the South Australian Twin study to investigate the role of genetic influence on variation in facial profile. Soft tissue landmarks and facial profiles were identified traced and digitized. Linear and angular measures defined by the landmarks were calculated and a series of Fourier functions derived to describe the facial profiles.. Correlations within monozygotic pairs were consistently higher than within dizygotic pairs for both the facial dimensions and the Fourier amplitudes, providing evidence of significant genetic contribution to facial convexity, facial height and facial depth. Variability in nose and lip morphology appeared to be under stronger environmental influence. www.indiandentalacademy.com
  54. 54. Claudio.M, Martina.R, G.B.Grossi heritability of 39 lateral cephalometric variables were estimated by statistical method of path analysis and Dahlberg quotient in 10 pairs of monozygotic twins, 10pairs of dizygotic same sex twins and 10 pairs of same sex singletons. They found that many of the 39 cephalometric variables evaluated were under strong genetic control, especially the vertical ones, among which, heritability seems to be expressed more anteriorly than posteriorly. Mandibular shape seemed to be more genetically determined than mandibular size. All five cephalometric typological Ricketts parameters as well as the linear horizontal McNamara’s measurement and lower incisor to A-Pg line confirm a very high heritability. A peculiar triangular area on the lateral view of the face and delimited by Na, geometric Go, and geometric Gn points (the so called triangle of face similarity) showed high heritability coefficients. The lower third of the face showed a strong genetic control www.indiandentalacademy.com
  55. 55. Savoye, Loose, Carels Deron evaluated the genetic and environmental contribution to facial proportions and compared them with earlier genetics analysis of the different facial components using model fitting and path analysis. They found high genetic influence for vertical proportions. The lowest heritability values were found for Sella – Upper incisal edge to Sella – lower incisal edge. The lower genetic determination of the facial proportions compared with their components indicated that the indices are subjected to more complex interactions between gene and environment www.indiandentalacademy.com
  56. 56. Liu H, Deng H, Cao CF, Ono H. Studied systematically the heritability of dental traits in 82 pairs of female – female twins from 6 – 12 years. Zygosity diagnosis was made by DNA fingerprinting. The study was composed of questionnaires, oral examination, model measurements, and panoramic radiographs. The same analytic method was used for each of the dental traits and comparison of their heritability was made. The levels of heritability of the dental traits were divided into 4 types; strong, median, weak, and weaker heritability. The number of third molars present, tooth size, arch size, and upper lateral incisor malformation were under strong genetic influence; hypodontia indicated a median heritability ; a weak heritability was seen in tooth eruption and caries ,and a weaker heritability was found in occlusal traits. www.indiandentalacademy.com
  57. 57. Mossey. P.A. (1999) reviewed various studies regarding heritability of malocclusion and concluded that there is considerable evidence suggesting a significant role of genes in the etiology of many dental anomalies. Furthermore, a frequency of association of one or more of these dental anomalies coincidentally in the same pedigree suggests some kind of genetically controlled inter relationship. The clinical significance of the inheritance of certain dental anomalies is that the clinicians should be vigilant in the expectation that the clinical or radiographic detection of one anomaly should alert them to the possibility of other defects in the same individual or other family members. Early diagnosis would enable interceptive pediatric and orthodontic opportunities in relation to ectopic, missing, or malformed teeth. www.indiandentalacademy.com
  58. 58. Conclusion • A full knowledge of interplay between environmental and genetic patterns involved in the development of craniofacial features will enable the future practitioners to effectively guide growth with orthodontic therapy. www.indiandentalacademy.com
  59. 59. T h a n k U www.indiandentalacademy.com
  60. 60. Singh GD, Kutcipal E, Mc Namara JA. Investigated the craniofacial morphology in twins with cleft lip and/or palate .and localize differences, compared with noncleft (NC) twins. They studied poster anterior cephalographs of 32 pairs of DZ, concordant, like –sexed twins. The NC group consisted of 20 pairs on noncleft twins. The cleft twin (CT) group consisted of 12 pairs of concordant twins. Main outcome measures included changes in linear distances, differences in form difference matrices, and visualization of deformations of thin-plate spline (TPS) transformation grids. They concluded that twins with orofacial clefts differed from their unaffected counterparts by a midfacial skeletal morphology characterized by decrease in interorbital and intranasal widths and relatively shorter maxillary base heights and widths. www.indiandentalacademy.com
  61. 61. Identical Twins: When one egg is fertilized by one sperm cell, and then divides and separates, two identical cells will result. These cells will then develop into identical twins. The DNA profiles for identical twins will be identical. Additionally, the physical attributes of identical twins will seem similar for traits such as hair color, hair texture, eye color, height, and weight. They must also be of the same sex. Fraternal Twins (Non identical twins): When two eggs are independently fertilized by two different sperm cells, fraternal twins result. The DNA profiles for fraternal twins will not be identical, and they are just like full-siblings that are born at different times. Further more, if the two sperm cells originated from 2 different men then the twins or would be like 2 half-siblings. Additionally, the physical attributes of fraternal twins may not seem similar for traits such as hair color, hair texture, eye color, height, and weight. They also may not be of the same sex www.indiandentalacademy.com

×