Indian Journal of Research in Pharmacy and Biotechnology
ISSN: 2320-3471 (Online)
ISSN: 2321-5674 (Print)

Editor
B.Pragat...
INDIAN JOURNAL OF RESEARCH IN PHARMACY AND BIOTECHNOLOGY
Instructions to Authors
Manuscripts will be subjected to peer rev...
ISSN No: 2321- 5674 (Print) ISSN No: 2320-3471(Online)

Indian Journal of Research in Pharmacy and Biotechnology
Informati...
ISSN No: 2321- 5674 (Print) ISSN No: 2320-3471(Online)

Indian Journal of Research in Pharmacy and Biotechnology

Electron...
Indian Journal of Research in Pharmacy and Biotechnology
ISSN: 2320-3471 (Online)
ISSN: 2321-5674 (Print)
S.No.
1

2

3

4...
Indian Journal of Research in Pharmacy and Biotechnology
ISSN: 2320-3471 (Online)
ISSN: 2321-5674 (Print)
24

Analytical m...
Sharma et.al

Indian Journal of Research in Pharmacy and Biotechnology

ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)

...
Sharma et.al

Indian Journal of Research in Pharmacy and Biotechnology

diabetic toxicity has been recently investigated. ...
Sharma et.al

Indian Journal of Research in Pharmacy and Biotechnology

prepared with 0.5 µg/ml if Ethidium Bromide (EtBr)...
Sharma et.al

Indian Journal of Research in Pharmacy and Biotechnology

ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)

...
Sharma et.al

Indian Journal of Research in Pharmacy and Biotechnology

ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)

...
Sharma et.al

Indian Journal of Research in Pharmacy and Biotechnology

than 50years. To the best of our knowledge frequen...
Swathi et.al

Indian Journal of Research in Pharmacy and Biotechnology

ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)

...
Swathi et.al

Indian Journal of Research in Pharmacy and Biotechnology

Phosphoric Acid was analytical reagent grade suppl...
Swathi et.al

Indian Journal of Research in Pharmacy and Biotechnology

Accuracy (Recovery studies): The accuracy of the
m...
Swathi et.al

Indian Journal of Research in Pharmacy and Biotechnology

S.NO

1.

2.

S.NO

1.

2.

ISSN: 2321-5674(Print)...
Swathi et.al

Indian Journal of Research in Pharmacy and Biotechnology

ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)

...
Swathi et.al

ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)

Indian Journal of Research in Pharmacy and Biotechnology

...
Swathi et.al

Indian Journal of Research in Pharmacy and Biotechnology

ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)

...
Sindhura and Agarwal et.al

Indian Journal of Research in Pharmacy and Biotechnology

ISSN: 2321-5674(Print) ISSN: 2320 – ...
Sindhura and Agarwal et.al

Indian Journal of Research in Pharmacy and Biotechnology

2. MATERIALS AND METHODS
UV-3000 LAB...
Sindhura and Agarwal et.al

Indian Journal of Research in Pharmacy and Biotechnology

3.1.6. System precision: System prec...
Sindhura and Agarwal et.al

Indian Journal of Research in Pharmacy and Biotechnology

S.No
1
2
3
4
5
Average
SD
% RSD

S.N...
Sindhura and Agarwal et.al

Indian Journal of Research in Pharmacy and Biotechnology

Figure.4.Standard chromatogram

Figu...
Sindhura and Agarwal et.al

Indian Journal of Research in Pharmacy and Biotechnology

4.4. Accuracy: The recoveries of pur...
Jyothsna et.al

Indian Journal of Research in Pharmacy and Biotechnology

ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)...
Jyothsna et.al

Indian Journal of Research in Pharmacy and Biotechnology

Standards and chemicals used: Pharmaceutical gra...
Jyothsna et.al

Indian Journal of Research in Pharmacy and Biotechnology

intercept and correlation coefficient, and the r...
Jyothsna et.al

Indian Journal of Research in Pharmacy and Biotechnology

ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)...
Jyothsna et.al

Indian Journal of Research in Pharmacy and Biotechnology

ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)...
Jyothsna et.al

Indian Journal of Research in Pharmacy and Biotechnology

Fig 1: Structure of Losartan potassium

ISSN: 23...
Jyothsna et.al

ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)

Indian Journal of Research in Pharmacy and Biotechnology...
Jyothsna et.al

Indian Journal of Research in Pharmacy and Biotechnology

ICH, Q2A validation of analytical procedure:
Met...
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Indian journal of research in pharmacy and biotechnology issue 5
Upcoming SlideShare
Loading in …5
×

Indian journal of research in pharmacy and biotechnology issue 5

4,743 views
4,615 views

Published on

Indian Journal of Research in Pharmacy and Biotechnology (IJRPB) is a peer review journal available in online and in printed formats. This journal publishes original research work that contributes significantly to advance the scientific knowledge in various aspects of pharmacy and biotechnology. We are pleased to introduce ourselves as the novel, imminent and sovereign pharmacy information service in India. The foundation aims to support every effort to empower pharmacy education and research, and more importantly young research scholars in pharmacy and biotechnology.

Published in: Education, Business, Technology
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
4,743
On SlideShare
0
From Embeds
0
Number of Embeds
1
Actions
Shares
0
Downloads
66
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Indian journal of research in pharmacy and biotechnology issue 5

  1. 1. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2320-3471 (Online) ISSN: 2321-5674 (Print) Editor B.Pragati Kumar, M.Pharm, Assistant Professor, Nimra College of Pharmacy Consulting editor Dr. S Duraivel, M.Pharm, Ph.D., Principal, Nimra College of Pharmacy Associate Editors Mr. Debjit Bowmick, M.Pharm., (Ph.D) Assistant Professor, Nimra College of Pharmacy Mr. Harish Gopinath, M.Pharm., (Ph.D) Assistant Professor, Nimra College of Pharmacy Dr. M. Janardhan, M.Pharm., Ph.D. Professor, Nimra College of Pharmacy Dr. A. Ravi Kumar, M.Pharm., Ph D. Professor, Bapatla College of Pharmacy Editorial Advisory Board Dr.Y.Narasimaha Reddy, M. Pharm., Ph D. Principal, University college of Pharmaceutical Sciences, Kakatiya University, Warangal. Dr.V.Gopal, M. Pharm., Ph D. Dr. Biresh Kumar Sarkar, Asstt.Director (Pharmacy), Kerala Dr. M.Umadevi, M.Sc. (Agri), Phd Principal, Mother Theresa Post Graduate & Research Institute of Health Sciences,Pondicherry-6 Research Associate, Tamil Nadu Agricultural University, Coimbatore Dr. J.Balasubramanium, M. Pharm., Ph D. Dr. V.Prabhakar Reddy, M. Pharm., Ph D. General Manager, FR&D R A Chem Pharma Ltd., Hyderabad Principal, Chaitanya College of Pharmacy Education & Research, Warangal Dr.P.Ram Reddy, M. Pharm., Ph D. Dr. S.D.Rajendran, M. Pharm., Ph D. Director, Pharmacovigilance, Medical Affairs, Sristek Consultancy Pvt. Ltd, Hyderabad General Manager, Formulation, Dr.Reddy’s Laboratory, Hyderabad IJRPB 1(5) www.ijrpb.com September – October 2013
  2. 2. INDIAN JOURNAL OF RESEARCH IN PHARMACY AND BIOTECHNOLOGY Instructions to Authors Manuscripts will be subjected to peer review process to determine their suitability for publication provided they fulfill the requirements of the journal as laid out in the instructions to authors. After the review, manuscripts will be returned for revision along with reviewer’s and/or editor’s comments. Don’t copy and paste the article content from internet or other sources like e-books etc. Authors are the sole responsible persons for the article, article content; results of the research conducted and copy right issues if any. The editor and the editorial board are not entitled to change the article content, results and diagrammatic representations which are given by authors. The article will be published only after getting the approved galley proof from the authors. Kindly follow the below guidelines for preparing the manuscript: 1. Prepare the manuscript in Times New Roman font using a font size of 12. There shall not be any decorative borders anywhere in the text including the title page. 2. Don’t leave any space between the paragraphs. 3. Divide the research article into a. Abstract Visit us at b. Introduction www.ijrpb.com c. Materials and Methods Contact us/ send your articles to: d. Results Email: ijrpb@yahoo.com e. Discussion Phone no: 9490717845; 9704660406 f. conclusion g. References 4. References should include the following in the same order given below a) Author name followed by initials b) Title of the book/ if the reference is an article then title of the article c) Edition of the book/ if the reference is an article then Journal name d) Volume followed by issue of the journal e) Year of publication followed by page numbers 5. Download the author declaration form from the web site www.ijrpb.com, fill it and submit it after signing by corresponding and co-authors to IJRPB. You can send the filled in form by post or scanned attachment to ijrpb@yahoo.com. 6. Keep in touch with the editor through mail or through phone for further clarifications as well as for timely publication of your article. Indian Journal of Research in Pharmacy and Biotechnology is a bimonthly journal, developed and published in collaboration with Nimra College of Pharmacy, Ibrahimpatnam, Vijayawada, Krishna District, Andhra Pradesh, India-521456 Printed at: F. No: 501, Parameswari Towers, Ibrahimpatnam, Vijayawada, India -521456 IJRPB 1(5) www.ijrpb.com September – October 2013
  3. 3. ISSN No: 2321- 5674 (Print) ISSN No: 2320-3471(Online) Indian Journal of Research in Pharmacy and Biotechnology Information regarding Indexing/ abstracting of our journal IJRPB The following is the list of organizations confirmed Indexing/ abstracting of our journal IJRPB Index Copernicus Value (ICV) is 5.43 given by Index Copernicus International, Poland CHUNG YUAN CHRISTIAN UNIVERSITY, CHINA
  4. 4. ISSN No: 2321- 5674 (Print) ISSN No: 2320-3471(Online) Indian Journal of Research in Pharmacy and Biotechnology Electronic Journals Library SCIENCE NET, CHINA PUBHUB, USA Advanced Science Index Saarbrücken, Germany OCLC, Worldcat Knowledge Base, Canada NEWJOUR, USA
  5. 5. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2320-3471 (Online) ISSN: 2321-5674 (Print) S.No. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 Contents Evaluation of the association of rs8052394 of metalothionein-1a gene with type 2 diabetes mellitus in Nepalese population Surya Prasad Sharma, Bishal Khatiwada, Binita Dhakal, Uddhav Timilsina a novel RP- HPLC method development and validation of atorvastatin and fenofibrate in bulk and pharmaceutical dosage forms Vinjam Swathi, Nanda Kishore Agarwal, Kumari Jyothsna Analytical method development and validation for the simultaneous estimation of Lamivudine, Zidovudine and Efavirenz by RP-HPLC in bulk and pharmaceutical dosage forms Sindhura D, Nanda Kishore Agarwal Novel RP-HPLC method development and validation of Losartan potassium and Amlodipine drugs in pure and pharmaceutical dosage forms Kumari Jyothsna, Chandana N, Vinjam Swathi Formulation and In-Vitro evaluation of Ornidazole gastroretentive tablets by using low density swellable polymers Abeda Aqther, B. Pragati kumar, Peer Basha Formulation and evaluation of Fenofibrate tablets prepared by employing bioavailability enhancement technique Siva kothapally, Pragati Kumar Bada, Harish G Formulation and e valuation of famotidine fast dissolving tablets by direct compression method B.Venkateswarlu, B.Pragati Kumar, Debjit Bowmik Formulation and evaluation of matrix floating tablets of Ofloxacin and Tinidazole combination Syed Peer Basha, Pragati Kumar B, Duraivel S, Abeda Aqther Formulation and In-Vitro evaluation of Terbutaline sulphate sustained release tablets Rajeswari Kola, Deepa Ramani N, Pragati Kumar B Evaluation of antidiabetic activity of Methanolic extract of flowers of Cassia siamea in Alloxan induced diabetic rats of basal diet and maida mixed diet Pushpavathi P, Janarthan M, Firasat Ali Formulation and evaluation of transdermal patches of anti-hypertensive drug metoprolol succinate Koteswararao P, Duraivel S, Sampath Kumar KP, Debjit Bhowmik Neuropharmacological screening of ethanolic extract of Nelumbo nucifera gaertner seeds Sirisha Chowdary G A review on use of genetically engineered microorganisms for bioremediation of environmental pollutants and heavy metals Mariz Sintaha Hepatoprotective effect of hydroalcoholic extract of Ocimum gratissimum leaves on Rifampicin-Isoniazid induced rats Sreenu Thalla,Venkata Ramana K, Delhiraj N Analytical method development and validation of Amitriptyline hydrochloride and Chlordiazepoxide in tablet by RP-HPLC Neeli Sujatha, K Haritha Pavani Evaluation of hepatoprotective activity of Sapindus emarginatus vahl pericarp extract against anti tubercular drugs induced liver damage in rats Shoba Rani J, Janarthan M, Firasat Ali Evaluation of anti-diabetic and hepato protective activity of 95% methanolic extract of Terminalia tomentosa bark by using albino rats Srilakshmi P, Janarthan M, Zuber Ali M Formulation of mouth dissolving tablets of Naproxen Rajesh Reddy K, Nagamahesh Nandru, Desam Asha Latha, Srinivasa Rao Chekuri Preparation of immediate release Atorvastatin and sustained release matrix tablets of Gliclazide using retardant hydroxypropyl methyl cellulose Vinod Raghuvanshi, Jayakar B, Debjit Bhowmik, Harish G, Dureivel S Phytochemical sreening and antidiabetic antioxidant effect of Ecbolium ligustrinum flowers extracts Ranjitsingh B Rathor, Rama Rao D, Prasad Rao Development and validation of assay method for meloxicam tablets by RP-HPLC K. Ranjith, M.V.Basaveswara Rao, T.E.G.K.Murthy RP-HPLC development and validation of assay and uniformity of dosage units by content uniformity for in house lamivudine and abacavir combined tablet K. Ranjith, M.V.Basaveswara Rao, T.E.G.K.Murthy Validation of a simple and rapid HPLC method for the determination of Metronidazole and Norfloxacin in combined dosage form SK Asma Parveen, Chandana Nalla Volume 1 Issue 5 www.ijrpb.com Page No. 570-575 576-582 583-588 589-596 597-601 602-608 609-613 614-620 621-624 625-628 629-634 635-642 643-648 649-654 655-659 660-663 664-667 668-671 672-675 676-678 679-681 682-685 686-691 September – October 2013
  6. 6. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2320-3471 (Online) ISSN: 2321-5674 (Print) 24 Analytical method development and validation for the estimation of olmesartan medoxomil by RP-UPLC in bulk and pharmaceutical dosage forms Farhana pattan, K.Haritha Pavani, A.Kiran Kumar, N.Sunny Babu, K.V.Kalyan Kumar, Chandana N Formulation development and evaluation of Gliclazide gel using water soluble Sodium carboxy methyl cellulose polymer Vaibhav Kumar Mishra, Shashi Shekhar Tripathi Analytical method development and validation of Gemifloxacin and Ambroxol in solid dosage form by reverse phase high performance liquid chromatography Md Haseena Begum, Nanda Kishore Agarwal and Duraivel S Evaluation of the anti hyperglycemic activity of methanolic extract of root of heliotropium indicum in streptozotocin and alloxan induced diebetic rats Aqheel MA , Janardhan M, Durrai vel S Novel RP-HPLC method development and validation of Metformin and Pioglitazone drugs in pure and pharmaceutical dosage forms Alekhya Pallapolu, Aneesha A Carbon nano tube: a review K.Shailaja, Tahseen Sameena, S.P.Sethy, Prathima Patil, Md. Owais Ashraf Stability indicating RP-HPLC method for the simultaneous determination of Candesartan cilexetil and hydrochlorothiazide in bulk and dosage forms Veeranjaneyulu D, Aneesha A, Nandakishore Agarwal A review on enhancement of solubility and disolution rate of bcs class-ii drug by solid dispersion and nonaqeous granulation technique Chakravarthi V, Duraivel S Evaluation of anti-infl ammatory activity of Canthium parviflorum by In-Vitro method Kandikattu Karthik, Bharath Rathna Kumar P, Venu Priya R, Sunil Kumar K , Ranjith Singh.B.Rathore Evaluation of nephro protectiveactivity of methanolic extract of seeds of Vitis vinifera against Rifampicin and Carbontetra chloride induced nephro toxicity in wistar rats Kalluru Bhargavi, N Deepa Ramani, Janarthan M, Durraivel S Analytical method development and validation of estimation method for Sotalol hydrochloride tablets by using RP-HPLC G Abirami, K Anand Kumar, T.Veterichelvan, Arunateja Muvva A study on role of demographic factors in small investors’ savings in stock market Durga Rao P V, Chalam G V and Murty T N Morbidity pattern among the elderly population in a south Indian tertiary care institution: analysis of a retrospective study Narayan V, Chandrashekar R Testicular gene expression profiling of Phenytoin treated albino rats using cdna microarray Rajkumar R, Vathsala Venkatesan, Sriram Thanigai Formulation and in-vitro evaluation of Lornoxicam immediate release and Diclofenac sodium sustained release bilayered tablets B. Manikanta Anil, K. Narendra Kumar reddy 692-696 39 Formulation and evaluation of cefpodoxime proxetil sustained release matrix tablets Divya Palparthi, K. Narendra Kumar Reddy 758-760 40 Formulation and development of sustained release matrix tablet using natural polymers L. P. Hingmire, D. M. Sakarkar 761-764 25 26 27 28 29 30 31 32 33 34 35 36 37 38 Volume 1 Issue 5 www.ijrpb.com 697-700 701-706 707-710 711-716 717-719 720-724 725-728 729-731 732-735 736-740 741-743 744-747 748-753 754-757 September – October 2013
  7. 7. Sharma et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) EVALUATION OF THE ASSOCIATION OF rs8052394 OF METALOTHIONEIN-1A GENE WITH TYPE 2 DIABETES MELLITUS IN NEPALESE POPULATION Surya Prasad Sharma1,2* ,Bishal Khatiwada1,2, Binita Dhakal1,2, Uddhav Timilsina1 1. Department of Biotechnology, College for Professional Studies, Kathmandu, Nepal 2. Department of Biotechnology, Sikkim Manip al University, Gangtok, Sikkim *Corresponding author: suryapdsharma@gmail.com ABSTRACT Polymorphisms in metallothionein-1A gene associated with the risk of type 2 diabetes mellitus and its complications. Metallothioneine (MT) as a potent antioxidant can affect energy metabolism. The present study was undertaken to investigate the association between MT gene polymorphism and type 2 diabetes mellitus. Polymorphism in rs8052394 of Metallothioneine 1A gene at lys51Arg is the most prevalent mutation in T2DM. Polymerase Chain Reaction Restriction Fragment Length Polymorphism (PCR-RFLP) has been found to be a reliable and effective tool to identify the specific gene alteration that is responsible for the development of T2DM and its complication. The aim of study was to identify the mutation in specific part of rs8052394 of MT1A gene (lys51Arg substitution) in diabetic population by PCR-RFLP technique. All together 62 diabetic samples were collected and DNA extraction was performed according to protocol of D.K. Lahari et al. Amplification of fragment with MT1A gene at 51th position of amino acid performed in a XP Thermocycler using primers Forward: 5’-ACTAAGTGTCCTCTGGGGCTG 3’ and Reverse: 5’-AATGGGTCACGGTTGTATGG 3’ of MT1A gene cleaved by pstI enzyme. The restriction fragments obtained were electrophoreses in a 2% agarose gel and were visualized using transilluminator. Mutation of MT1A gene was present in 40.32% of 62 patients, out of which 19.35%was of ≤50 yrs of age group. On comparing the mean age of two category of genotype (AA and AG/GG, correlation is statistically significant with p=0.044 (CI=95%).This is the first time that the mutation positions in MT1A gene Lys51Arg substitution have been studied in Nepalese population with Type II diabetic. Since Nepal is geographically located between two countries (India and China) with around 30% of world’s total diabetic cases, researches in this subject seems to be of a rationale work. Keywords: Diabetes Mellitus type II, SNP, rs8052394, Metallothioneine 1A, PCR-RFLP 2009). In general the MT is known to modulate three INTRODUCTION fundamental processes: Diabetes mellitus is a metabolic disorder in which person is characterized by the high blood sugar either 1) The release of gaseous mediators such as hydroxyl because the body does not produce enough insulin, or radical or nitric oxide; because cells do not use the insulin that is produced 2) Apoptosis, and (World Health Organisatio, 1999). The classical 3) The binding and exchange of heavy metals such as symptoms of diabetes are polyuria (frequent urination), zinc, cadmium or copper. polydipsia (increased thirst) and polyphagia (increased hunger) (Cooke, 2008). Almost one in 10 of the world Metallothionein and Its Relationship with Diabetes: population already has this condition, or can be expected Metallothioneins (MTs) are a group of intracellular metalto develop it during their lifetime, with prevalence rates binding and cysteine-enriched proteins and are highly forecast to double within the next 15 years (Florence, inducible in many tissues in response to various types of 2003). According to WHO (2000A.D.), at least 171 stress. Although it mainly acts as a regulator of metal million people worldwide suffer from diabetes, or 2.8% of homeostasis such as zinc and copper in tissues, MT also the population (Wild, 2004). acts as a potent antioxidant and adaptive (or stress) protein Metallothionein 1A (MT1A), mRNA: Metallothionein (MT) is a sulfhydryl- and cysteine-rich protein found in microorganisms, plants and all invertebrate and vertebrate animals. Metallothioneins are a group of ubiquitous lowmolecular-weight proteins that have functional roles in cell growth, repair and differentiation. These are those family of proteins with low molecular mass and high affinity to certain metal ions (Cai, 2007). They are implicated primarily in metal ion detoxification, in that they are essential for the protection of cells against the toxicity of cadmium, mercury and copper (Higashimoto, IJRPB 1(5) www.ijrpb.com to protect cells and tissues from oxidative stress. Diabetes affects many Americans and other populations, and its development and toxic effect on various organs have been attributed to increased oxidative stress. Studies showed that zinc-induced or genetically enhanced pancreatic MT synthesis prevented diabetes induced by chemicals such as streptozotocin and alloxan, and zinc pretreatment also prevented spontaneously developed diabetes. Since diabetic complications are the consequences of organ damage caused by diabetic hyperglycemia and hyperlipidemia through oxidative stress, whether MT in nonpancreatic organs also provides a preventive effect on September – October 2013 Page 570
  8. 8. Sharma et.al Indian Journal of Research in Pharmacy and Biotechnology diabetic toxicity has been recently investigated. It has been demonstrated that overexpression of cardiac MT significantly prevented diabetes-induced cardiomyopathy. Likewise, over expression of renal MT also prevented diabetes-induced renal toxicity. In addition, it was found that MT as an adaptive protein is over expressed in several organs in response to diabetes. Therefore, the biological importance of diabetes-induced MT in diabetic complications and subsequent other pathogenesis was further explored. This polymorphism is the result of a nucleotide change A to G at position 55231329 of chromosome 16. Similarly 225 number position of mRNA sequence, and it results in the substitution of Lysine (k) by Arginine (r) at 51 position of the MET1A protein. In the wild type, codon AAA codes for Lysine but in mutated type, codon AAA changes to AGA hence it codes for different amino acid Arginine. After analysis by MUpro we found that protein structure stability was decrease due to this polymorphism. Among the seven identified SNPs: rs8052394, rs11076161, rs8052334, rs964372, rs7191779, rs708274 and rs10636. Significant associations of MT1A rs8052394 (G alteration) with T2DM and decreased serum SOD activity were established. The other six SNPs were not significantly associated with T2DM. However, SNPs rs964372 and rs10636 were found to be significantly associated with increased serum triglyceride and neuropathy among T2DM individuals. It is a restriction enzyme isolated from an E. coli strain that carries the PstI gene from Providencia stuartii 164 (ATCC 49762). According to Nepal Diabetic Association, the number of people suffering from diabetes above 40 years in urban areas has climbed up to 19% of special note is that there will be a 67% increase in prevalence of diabetes in developing countries from 2010-2030 (Shaw, 2010). According to UN, 246 million people in the world are suffering from diabetes and approximately half of that fall in Nepal, India, China and other Asian countries. Increase in the incidence of diabetes mellitus is the 4th leading cause of death in world. Each year 3.8 million people die from diabetes and its related complication like cardiomyopathy, stroke, nephropathy, neuropathy, eye disease etc and the gene metallothionein 1A may be responsible for such complications. It has also been found that polymorphism in metallothionein 1A gene may be responsible for even inducing diabetes not only its complications. Polymorphism in single nucleotide in metallothionein 1A leads for to decrease in level of SOD which may be due to the death of pancreatic β cells (Grarup, 2007). Metallothionein (MT) isoforms I and II are polypeptides with potent antioxidative and antiinflammatory properties (Lina, 2008) and once occur polymorphism; it causes in the alteration in the normal function of the protein and causes different complications IJRPB 1(5) www.ijrpb.com ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) like aging, neuropathy, retinopathy, stroke etc. Since diabetes and its complications are the 4th leading cause of death, it needs to be diagnosed soon. The most rapid results could be achieved by using molecular methods including real-time PCR, single-strand-conformation polymorphism analysis (SSCP) (Lina, 2008) multiplexallele-specific PCR (MASPCR), mass spectrophotometry, Allele-Specific Hybridization etc. But the PCR-RFLP approach has several advantages of being cheap, robust and simple to both perform and interpret, basically requiring PCR and electrophoresis set up. Genes significantly associated with developing type 2 diabetes, include TCF7L2, PPARG, FTO, KCNJ11, NOTCH2, WFS1, CDKAL1, IGF2BP2, SLC30A8, JAZF1, and HHEX (Lina, 2008; Shoelson, 2006). Within all these family, Metallothionine and its different isoforms have a relationship with T2DM and other disease like neuropathy, hyperlipidemia etc. Among different MT, the isoform MT 1A with SNP rs8052394 is found to have a significant relationship with T2DM (Lina, 2008). The magnitude and trends in diabetes and the polymorphism in MT1A gene at rs8052394 are epidemiologically important to monitor, the estimation of the burden of disease is programmatically relevant in shaping policies for screening and treatment. METHODS Study Population: 63 diabetic subjects (Male: 30 Female: 32) were randomly selected within Kathmandu Valley Population. Samples collected were reported as T2DM from Kathmandu Model Hospital, Bhrikutimandap Samjhana Laboratory, Mangalbazzar. Study Design: A cross sectional study was designed to explore the polymorphism in rs8052394 of MT 1A gene in T2DM patients. Study Site: Department of Biotechnology, College for Professional Studies, Kathmandu, Nepal. Selection of Sample: Samples reported as T2DM according to WHO criteria 2006 Criteria to Confirm T2DM 1) Age above 40 years 2) Fasting Blood Glucose: >110mg% 3) Post-prandial Glucose: >140mg% Data Processing and Analysis: Data will be analyzed manually as well as using SPSS and interpreted according to frequency distribution and percentage. The statistical tool chi-square and t test will be applied to analyze the data. Data will be presented in tables and figures. Clinically and epidemiologically relevant information from each patient including, age, sex, dietry habits was obtained. DNA extraction from T2DM samples: D.K Lahiri et.al method: 1% Agarose Gel Electrophoresis of Extracted DNA: 1% agarose gel was September – October 2013 Page 571
  9. 9. Sharma et.al Indian Journal of Research in Pharmacy and Biotechnology prepared with 0.5 µg/ml if Ethidium Bromide (EtBr) in it. 6 µl if each extracted DNA sample and the loading dye mixed in the ratio 5:1 was loaded on the wells and run for an hour at 80-90 Volt on Tris Acetate EDTA (TAE) buffer. The DNA bands were observed under UV transilluminator. PCR Amplification of rs8052394 Specific Exon Fragment of MT1A Gene: The primary task for performing the PCR is to standardize the reaction mixture and to optimize the PCR conditions for the reaction to occur accurately so that the DNA is amplified efficiently. The reaction and the PCR programme were standardize to precisely amplify the rs8052394 specific Exon fragment of MT1A gene in the DNA sample by PCR using the primers to get a 283 bp amplified product. Forward: 5’ACTAAGTGTCCTCTGGGGCTG 3’ Reverse: 5’AATGGGTCACGGTTGTATG3’ 2% Agarose gel electrophoresis of PCR amplified products: To check if the specific DNA segments have been amplified or not, the PCR products were electrophoresed on 2% agarose gel(0.8gm of agarose+40ml of 1X TAE buffer+0.5µg/ml of EtBr) in 1X TAE buffer along with 100bp DNA ladder(Fermentas) for 1 hour at 90 volt. Since the specific PCR primers amplified a 283bp PCR product, single DNA band was observed lying in between 200 and 300bp as indicated by DNA marker when viewed on UV transilluminator. The PCR amplified products were stored at 4°C. Restriction Digestion of PCR amplified ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) Products Steps:  Incubation at 37°C for 3 hours  Heat Inactivation at 65°C for 20 minutes  Holding at 4°C forever. RESULTS Genomic DNA was extracted from blood cells. The extracted DNA was run through 1% agarose gel electrophoresis. PCR product was run through 2% agarose gel electrophoresis. Finally digested product was run through 3% agarose gel electrophoresis. Further the incubation of the reaction mixture was carried out in the thermocycler and the following program was used; Then the digested product was analyzed by agarose gel electrophoresis. 3%Agarose gel Electrophoresis of digested products: After digestion of the 283bp fragment obtained by PCR, to check for three possible genotypes, 15µl of digested products were mixed with 3µl of loading dye and loaded on the wells of 3%agarose gel in 1XTAE buffer along with 100bp DNA ladder for 1 hour at 90 volts. The result was viewed under UV transilluminator for number of DNA fragments obtained. The amplified product was subjected to digestion by PstI restriction enzyme. After digestion of the 283 bp fragment by PCR, 165bp, 283bp the restriction enzyme digested fragment was run on 3% agarose gel electrophoresis. The gel picture below depicts the band pattern for genotypes. Genotypic distribution was in accordance with Hardy-Weinberg Equilibrium when analysed by PopGene.S2 software with χ2=1.7494, df=1 and P>0.05. Table.1. PCR reaction mixture with component and volume Reagent Stock Final Concentration Volume/ Reaction 10XPCR buffer 2.5µl 25mM Mgcl2 1.5mM 2.0µl 10 µM (Each) dNTPs 200 µM 0.5µl 100 µM Reserve primer 0.4 µM 1.0µl 5 units/ µl.Taq polymerase 0.4 µM 0.2µl Nuclease free D/W 1 Units/ µl 12.8µl Total Master Mix 20 µl DNA extract 5 µl Total 25 µl IJRPB 1(5) www.ijrpb.com September – October 2013 Page 572
  10. 10. Sharma et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) Table.2.The following program was standardized for the amplification reaction Step Temperaure (oC) Time Initial Denaturation 95 5 Minutes Denaturation 95 1 minutes Primer Annealing 55.7 45 seconds Extension 72 45 seconds Cycle repeat from step 2 (35 cycles) Final extension 72 7 minutes Holding 4 Forever End Table.3.The reaction mixture for restriction digestion Master Mix for Restriction Digestion Pst I 0.5 µl 10X Buffer ‘O’ 1.5 µl Nuclease free distilled water 3.0 µl PCR product 10 µl Table.4.Genotype Distribution in Nepalese Population Allotypes Band Patterns Frequency Total sample (a) GG 118 165 1 62 GA 118 165 283 24 AA 283 37 Table.5. Distribution of genotypic frequency of SNP rs8052394 SNP Group CASE no Genotype X2 P 62 Rs8052394 Case GG GA AA 1.7494 0.79035 1 24 37 Table6: Agewise distribution in accordance to mutation Age < 50 51-60  61 33.87 22.58 43.55 Percentage 21 14 27 Total Number Figure.1.WHO distributions of diabetic people IJRPB 1(5) www.ijrpb.com Figure.2.Outline of mechanisms by which MT coordinate with Zn prevents diabetes development and diabetic complications rs8052394 of MET1A gene September – October 2013 Page 573
  11. 11. Sharma et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) Figure.3.Gender wise distribution of patients Figure.6. 3% Agarose Gel Electrophoresis of digested product by PSTL restriction enzymes DISCUSSION The present study revealed an association of MT genes with T2DM. SNP rs8052394 detected in this study was highly polymorphic. The χ2 goodness-of-fit test showed that the genotypic distribution of rs8052394 SNP was not deviated from the Hardy- Weinberg equilibrium (P >0.05), suggesting the suitability of this sample pool for genetic analysis. The allelic frequency distribution analysed by PopGene software showed that ‘G’ allele (p=0.79035) is high in Nepalese Population whereas ‘A’ allele (q=0.20965) is less in frequency. The gender wise distribution of rs8052394 of MT1A gene mutated and wild type or differently mutated strains. Among male subjects 30 (48.39%) weresuffering from diabetes and 32(51.61%) were from female subjects. This shows no any significant relationship between the prevalence of diabetes mellitus and gender. Agewise distribution of the T2DM patient: Agewise distribution of the patient shows that 33.87% people were less than 50 years, 22.58 were between 51-60 and 43.55 %were >61. In a given diabetic population, the chance of alteration on different genes are possible which are responsible for the induction of T2DM (Shoelson, 2006; Lyssenko, 2008). But the role of MT1A is most widely studied due to the importance of this gene. The mutation IJRPB 1(5) www.ijrpb.com in MT1A gene is a major mechanism for the development of diabetes and its complications. The most common mutation is the Lys51Arg substitution in MT1A gene, which is present in approximately 36.13% of the diabetic population and is associated with relatively high level induction of the diabetes and its complication (Lina, 2008). But however it should be remembered that at normal condition MTIA gene acts as antioxidant therefore prevents diabetes (Papouli, 2000). The most frequent mutation patterns of diabetic patient of MT1A gene occurs at rs8052394 fragment at aminoacid51 (36.13%) of MT1Agene. But mutation in MT1A gene occurs in a higher frequency than any other gene and is regarded as to be most important in diagnosing diabetes (Lina Yang, 2008). CONCLUSION The study of genotype frequency distribution for the MT1A polymorphism in rs8052394 in Nepalese population from Nepal for the first time will definitely serve as a major achievement in understanding the molecular level of mechanism and effects of the gene mutation which varies in different geographical region of world. We found that rs8052394 of MT1A gene mutation at amino acid 51 accounted 40.3% among which the mutation is more commonly found on the age group less September – October 2013 Page 574
  12. 12. Sharma et.al Indian Journal of Research in Pharmacy and Biotechnology than 50years. To the best of our knowledge frequency of the MT1Agene lys51arg mutation has not been previously determined in Nepalese diabetic population. The higher percentage (40.3%) of common mutation in MT1A definitely highlights the importance of the 51st amino acid for development of diabetes and its complication. BIBLIOGRAPHY American diabetes association, Report: Type 2 diabetes in children and adolescents. Diabetes care 2000, 23:381-9 Cai L, Diabetic cardiomyopathy and its prevention by metallothionein: experimental evidence, possible mechanisms and clinical implications, Curr Med Chem, 14, 2007, 2193–2203. Cooke DW, Plotnick L, Type 1 diabetes mellitus in pediatrics, Pediatr Rev Nov, 29 (11), 2008, 374–384. Florence Demenais, Timo Kanninen, Cecilia M. Lindgren, A meta-analysis of four European genome screens (GIFT Consortium) shows evidence for a novel region on chromosome 17p11.2–q22 linked to type 2 diabetes, Human Molecular Genetics, 12(15), 2003, 1865–1873. ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) Mikkel Faurschou1, Milena Penkowa, Claus Bøgelund Andersen, Henrik Starklint4 and Søren Jacobsen: The renal metallothionein expression profile is altered in human lupus nephritis. Arthritis Research & Therapy, 10, 2008, 761. Papouli E, Defais M, Larminat F, Over expression of metallothionein-II sensitizes rodent cells to apoptosis induced by DNA cross-linking agent through inhibition of NF-kappaβ activation, J Biol Chem, 277, 2000, 47644769. Shoelson SE, Lee J, Goldfine AB, Inflammation and insulin resistance, J Clin Invest, 116 (7), 2006, 1793–801 Wild S, Roglic G, Green A, Sicree R, King H, Global prevalence of diabetes: estimates for 2000 and projections for 2030, Diabetes Care, 2004, 27(5), 1047–1053. World Health Organisation & Department of Non communicable Disease Surveillance (1999). Definition, Diagnosis and Classification of Diabetes Mellitus and its Complications. Grarup N, Andersen G, Gene-environment interactions in the pathogenesis of type 2 diabetes and metabolism. Current Opinion in Clinical Nutrition & Metabolic Care, 10, 2007, 420–426. Higashimoto Minoru, Isoyama Naohiro, Ishibashi Satoshi, Inoue Masahisa, Takiguchi Masufumi, Suzuki Shinya, Ohnishi Yoshinari, Sato Masao:Tissue dependent preventive effect of metallothionein against DNA damage in dyslipidemic mice under repeated stresses of fasting or restraint, Life Sciences, 84, 2009, 569-575 J. E. Shaw, R. A. Sicree, and P. Z. Zimmet, Global estimates of the prevalence of diabetes for 2010 and 2030. Diabetes Research and Clinical Practice, 87(1), 2010, 4– 14. Lahari D. K., Steve Bye, Nurenberger Jr J. J., Mario E., Hondes D. and Crisp M, A non organic and non enzymatic extraction methods gives high yields of genomic DNA from whole blood samples than do nine other methods tested, J. Biochem. Biophys Methods, 25, 1992, 193–205 Li X, Cai L, Feng W, Diabetes and Metallothionein, Mini Rev Med Chem, 7, 2007, 761–768. Lina yang, Polymorphisms in metallothionein-1 and -2 genes associated with the risk of type 2 diabetes mellitus and its complications, Am J Physiol Endocrinol Metab, 294, 2008, 987-992. Lyssenko V, Jonsson A, Almgren P, Clinical risk factors, DNA variants, and the development of type 2 diabetes, The New England Journal of Medicine, 359 (21), 2008, 2220–2232. IJRPB 1(5) www.ijrpb.com September – October 2013 Page 575
  13. 13. Swathi et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) A NOVEL RP- HPLC METHOD DEVELOPMENT AND VALIDATION OF ATORVASTATIN AND FENOFIBRATE IN BULK AND PHARMACEUTICAL DOSAGE FORMS Vinjam Swathi, Nanda Kishore Agarwal, Kumari Jyothsna Nimra College of Pharmacy, Jupudi, Vijayawada, A.P, India *Corresponding author: Email: swathi.vinjam90@gmail.com, Phone +91-9490776192 ABSTRACT The present investigation describes about a simple, economic, selective, accurate, precise reverse phase high performance liquid chromatographic method for the simultaneous estimation of Atorvastatin and Fenofibrate in pure and pharmaceutical dosage forms. Atorvastatin and Fenofibrate were well separated using a Thermohypersil BDS C18 column of dimension 100 × 4.6, 5µm and Mobile phase consisting of Methanol: Water (Adjusted with orthophosphoric acid to pH-2) in the ratio of 40:60v/v at the flow rate 1 ml/min and the detection was carried out at 274nm with PDA detector. The Retention time for Atorvastatin and Fenofibrate were found to be 1.438, 2.949 respectively. The developed method was validated for recovery, specificity, precision, accuracy, linearity according to ICH guidelines. The method was successfully applied to Atorvastatin and Fenofibrate combination pharmaceutical dosage form. KEY WORDS: RP-HPLC, Atorvastatin, Fenofibrate, Accuracy, Precision. Atorvastatin and Fenofibrate in bulk and Pharmaceutical 1. INTRODUCTION dosage forms as per ICH guidelines. Atorvastatin ((3R, 5R)-7-[2-(4fluorophenyl)-3-phenyl-4-(phenylcarbamoyl)-5-propan-2The goal of this study is to develop rapid, economical ylpyrrol-1-yl]-3, 5-dihydroxyheptanoic acid) is a member HPLC method for the analysis of Atorvastatin and of the drug class known as statins. It is used for lowering Fenofibrate in combined dosage form using most cholesterol. Atorvastatin is a competitive inhibitor of commonly employed column (C18) and simple mobile hydroxymethylglutaryl-coenzyme-A (HMG-CoA) phase preparation. reductase, the rate-determining enzyme in cholesterol In the present proposed work a successful attempt biosynthesis via the mevalonate pathway. HMG-CoA had been made to develop a method for the simultaneous reductase catalyzes the conversion of HMG-CoA to estimation of Atorvastatin and Fenofibrate pharmaceutical mevalonate. It acts primarily in the liver. Decreased dosage form and validate it. From the economical point of hepatic cholesterol levels increases hepatic uptake of view and for the purpose of routine analysis, it was cholesterol and reduces plasma cholesterol levels. decided to develop a more economical RP-HPLC method Fenofibrate (propan-2-yl 2-{4-[(4with simple mobile phase preparation for the estimation of chlorophenyl) carbonyl] phenoxy}-2 methyl propanoate) Atorvastatin and Fenofibrate combinational dosage form. is a drug of the fibrate class. It is mainly used to reduce The method would help in estimate of drugs in single run cholesterol levels in patients at risk of cardiovascular which reduces the time of analysis and does not require disease. Like other fibrates, it reduces low-density separate method for each drug. Thus, the paper reports an lipoprotein (LDL) and very low density lipoprotein economical, simple and accurate RP-HPLC method for the (VLDL) levels, as well as increasing high-density above said pharmaceutical dosage forms. lipoprotein (HDL) levels and reducing triglycerides level. 2. MATERIALS AND METHODS It is used alone or in conjunction with statins in the Quantitative HPLC was performed on a high treatment of hypercholesterolemia and performance liquid chromatograph -Waters e2695Alliance hypertriglyceridemia. It lowers lipid levels by activating HPLC system connected with PDA Detector 2998 and peroxisome proliferator-activated receptor alpha (PPARα). Empower2 Software. The drug analysis data were PPARα activates lipoprotein lipase and reduces apoprotein acquired and processed using Empower2 software running CIII, which increases lipolysis and elimination of under Windows XP on a Pentium PC and Thermohypersil triglyceride-rich particles from plasma. BDS C18 column of dimension 100 × 4.6, 5µm particle Literature survey revealed that very few methods size. In addition an analytical balance (DENVER 0.1mg have been reported for the analysis of Atorvastatin and sensitivity), digital pH meter (Eutech pH 510), a sonicator Fenofibrate combinational dosage forms which include (Unichrome associates UCA 701) were used in this study. UV spectroscopy, Reverse Phase High performance Standards and chemicals used: Pharmaceutical grade Liquid Chromatography, Densitometric method, HPTLC Atorvastatin and Fenofibrate were kindly supplied as a gift methods. The present study illustrate development and sample by Dr.Reddy’s Laboratory, Hyderabad, and validation of simple, economical, selective, accurate, Andhra Pradesh, India. Methanol was of HPLC grade and precise RP-HPLC method for the determination of Purchased from E. Merck, Darmstadt, Germany. Ortho IJRPB 1(5) www.ijrpb.com September – October 2013 Page 576
  14. 14. Swathi et.al Indian Journal of Research in Pharmacy and Biotechnology Phosphoric Acid was analytical reagent grade supplied by Fischer Scientific Chemicals. Water HPLC grade was obtained from a Milli-QRO water purification system. Atorvastatin and Fenofibrate Tablets available in the market as Lipicure-TG (intas pharmaceuticals, Sikkim, India.) in composition of Atorvastatin (10mg), Fenofibrate (150mg). Preparation of mobile phase: Transfer water into 1000ml of beaker dissolve and diluted volume with water. Then adjust its pH to 2 with Ortho Phosphoric Acid (OPA). The Water adjusted pH to 2 with OPA: Methanol (60:40 v/v) and filtered through 0.45µ membrane filter and degassed by sonication. Preparation of calibration standards: 10mg Atorvastatin and 16mg Fenofibrate was taken into a 10, 50 ml of volumetric flask and add 10ml of Diluent and sonicated for 10 minutes and made up with Diluent. It was further diluted to get stock solution of Atorvastatin and Fenofibrate (To get 0.02 ppm and 0.32 ppm solution respectively). This is taken as a 100% concentration. Working standard solutions of Atorvastatin and Fenofibrate was prepared with mobile phase. To a series of 10 ml volumetric flasks, standard solutions of Atorvastatin and Fenofibrate in the concentration range of 0.01-0.03µg/ml and 0.16-0.48µg/ml were transferred respectively. System suitability: System suitability are an integral part of chromatographic system. To ascertain its effectiveness, certain system suitability test parameters were checked by repetitively injecting the drug solutions at 100% concentration level for Atorvastatin and Fenofibrate to check the reproducibility of the system. At first the HPLC system was stabilized for 40 min. One blank followed by six replicate analysis of solution containing 100% target concentration of Atorvastatin and Fenofibrate were injected to check the system suitability. To ascertain the system suitability for the proposed method, a number of parameters such as theoretical plates, peak asymmetry, and retention time were taken and results were presented in Table 1. Recommended procedure: Calibration curves for Atorvastatin and Fenofibrate: Replicate analysis of solution containing 0.01-0.03µg/mL, 0.16-0.48µg/mL of Atorvastatin and Fenofibrate sample solutions respectively were injected into HPLC according to the procedure in a sequence and chromatograms were recorded. Calibration curves were constructed by plotting by taking concentrations on X-axis and ratio of peak areas of standards on Y-axis and regression equation were computed for both drugs and represented in Table .6 Analysis of marketed formulation: The content of ten tablets was weighed accurately. Their average weights IJRPB 1(5) www.ijrpb.com ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) were determined. Powder of tablets equivalent to one tablet weight (521.1mg) were weighed and taken in a 50 ml volumetric flask, dissolved in diluents, shaken and sonicated for about 20 minutes then filtered through 0.45µ membrane filter. The filtered solution was further diluted (5 to 50ml) in the diluents to make the final concentration of working sample equivalent to 100% of target concentration. The prepared sample and standard solutions were injected into HPLC system according to the procedure. from the peak areas of Atorvastatin and Fenofibrate the amount of the drugs in the sample were computed. The contents were calculated as an average of six determinations and experimental results were presented in Table 4. The representive standard and sample chromatograms were shown in fig.2 and fig.3. Validation study of Atorvastatin and Fenofibrate: An integral part of analytical method development is validation. Method validation is the process to confirm that the analytical procedure employed for a specific test is suitable for its intended use. The newly developed RPHPLC method was validated as per International Conference on Harmonization (ICH) guidelines for parameters like specificity, system suitability, accuracy, linearity, precision (repeatability), limit of detection (LOD), limit of Quantification (LOQ) and robustness. Specificity: The effect of wide range of excipients and other additives usually present in the formulation of Atorvastatin and Fenofibrate in the determination under optimum conditions were investigated. The specificity of the RP-HPLC method was established by injecting the mobile phase and placebo solution in triplicate and recording the chromatograms. The common excipients such as lactose anhydrous, microcrystalline cellulose and magnesium state have been added to the sample solution injected and tested. Precision: precision study of sample (Losartan potassium and Amlodipine) was carried out by estimating corresponding responses 6 times on the same day for the 100% target concentration. The percent relative standard deviation (%RSD) is calculated which is within the acceptable criteria of not more than 2.0. Linearity: The linearity graphs for the proposed assay methods were obtained over the concentration range of 0.01-0.03µg/ml and 0.16-0.48µg/ml (50-150%) Atorvastatin and Fenofibrate respectively. Method of least square analysis is carried out for getting the slope, intercept and correlation coefficient, regression data values and the results were presented in Table 2. The representative chromatograms indicating the sample were shown in fig.2&3. A calibration curve was plotted between concentration and area response and statistical analysis of the calibration curves were shown in fig. 6&7. September – October 2013 Page 577
  15. 15. Swathi et.al Indian Journal of Research in Pharmacy and Biotechnology Accuracy (Recovery studies): The accuracy of the method is determined by calculating recovery of Atorvastatin and Fenofibrate by the method of addition. Known amount of Atorvastatin and Fenofibrate at 50%, 100%, 150% is added to a pre quantified sample solution. The recovery studies were carried out in the tablet in triplicate each in the presence of placebo. The mean percentage recovery of Atorvastatin and Fenofibrate at each level is not less than 99% and not more than 101%. ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) (±5), mobile phase composition (±5%), and pH of the buffer solution. LOD and LOQ: Limit of detection is the lowest concentration in a sample that can be detected but not necessarily quantified. Under the stated experimental conditions. The limit of quantification is the lowest concentration of analyte in a sample that can be determined with acceptable precision and accuracy. Limit of detection and limit of quantification were calculated using following formula LOD=3.3(SD)/S and LOQ=10(SD)/S, where SD= standard deviation of response (peak area) and S= average of the slope of the calibration curve. Robustness: The robustness is evaluated by the analysis of Atorvastatin and Fenofibrate under different experimental conditions such as making small changes in flow rate (±0.2 ml/min), λmax (±5), column temperature Table 1: optimized chromatographic conditions and system suitability parameters for proposed method S.NO Parameter Chromatographic conditions 1. Instrument Waters e2695 Alliance HPLC with Empower2 software 2. Column thermohypersil C18, (5μ, 150 x 4.6mm) 3. Detector PDA Detector 2998 4. 5. Diluents Mobile phase Methanol Water(adjusted pH 2.0 with OPA): methanolo (60:40 v/v) 6. Flow rate 1ml/min 7. Detection wavelength 274nm 8. Temperature 35°c 9. Injection volume 5µl 10. Retention time Atorvastatin Fenofibrate Theoretical plate count 12. 13. 2.949 Atorvastatin Fenofibrate Tailing factor Atorvastatin Fenofibrate Resolution factor 11. 1.438 2552 3000 1.17 1.59 9.38 Table 2: Specificity study S.NO. Name of the solution Retention time in min 1. Blank No peaks 2. Atorvastatin 1.438 3. Fenofibrate 2.949 IJRPB 1(5) www.ijrpb.com September – October 2013 Page 578
  16. 16. Swathi et.al Indian Journal of Research in Pharmacy and Biotechnology S.NO 1. 2. S.NO 1. 2. ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) Table 3: results of precision study Injection number Sample Atorvastatin Fenofibrate Precission RT 1.443 1.438 1.442 1.382 1.441 1.444 1 2 3 4 5 6 Mean %RSD(NMT 2.0) 1 2 3 4 5 6 Mean %RSD(NMT 2.0) Peak area 2054782 2054809 2065165 2060368 2041300 2043795 2053370 0.50 3515822 3503597 3509064 3507668 3511717 3513906 3510296 0.1 2.977 2.961 2.973 2.970 2.973 2.877 Table 4: Recovery data of the proposed Atorvastatin and Fenofibrate Sample Spiked Amount Recovered Amount %Recovered (µg/ml) (µg/ml) 10.04 10.02 100.16 Atorvastatin 19.983 19.94 100 29.937 29.85 99.3 158.47 158.82 100.33 Fenofibrate 316.538 317.59 100.33 474.20 476.32 100.33 %Average recovery 100% 100.33% Table 5: Robustness results of Atorvastatin and Fenofibrate S.NO sample 1. parameters Flow rate (±0.2) Optimized Atorvastatin Flow rate (±0.2) 2. 35°C 1ml/min Fenofibrate Temperature (±5°C) IJRPB 1(5) www.ijrpb.com 35°C Peak area 2187263 6100287 Plate count 3021 2723 1.2 30 35 40 0.8 1 1.209 1.357 1.438 1.211 2.508 2.940 1639328 1565593 2043083 1639328 3198139 3507208 2856 2943 2552 2734 3037 3234 2.495 2.488 2378287 2519528 2810 2853 35 2.949 3527161 3222 40 Temperature (±5°C) RT 1.799 1.436 1.2 30 1ml/min Used 0.8 1 3.684 2643655 2958 September – October 2013 Page 579
  17. 17. Swathi et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) Table 6: linearity data of the Atorvastatin and Fenofibrate S.NO sample 1. Atorvastatin 2. Fenofibrate Linearity level (µg/ml) 0.1 0.15 0.2 0.25 0.3 0.01 0.015 0.02 0.025 0.03 Peak area 1024859 1530720 2028343 2552721 3061292 1756257 2634474 3501613 4352056 5252030 Slope Y-intercept r² 20379 1640.2 0.999 34837 15635 0.999 Table.7: Limit of Detection and Limit of Quantification Parameter Atorvastatin Fenofibrate Limit of detection(LOD) 0.00013µg/mL 0.00210µg/mL Limit of Quantification(LOQ) 0.00046µg/mL 0.0070µg/mL Fig.1: Structure of Atorvastatin Fig.3: Chromatogram of Blank solution Fig.2 Structure of Fenofibrate Fig. 4: Typical Chromatogram of standard Fig. 5: Typical chromatogram of Atorvastatin and Fenofibrate in marketed formulation IJRPB 1(5) www.ijrpb.com September – October 2013 Page 580
  18. 18. Swathi et.al ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) Indian Journal of Research in Pharmacy and Biotechnology ATORVASTATINy = 20379x + 1640.2 r² = 0.999 3000000 Area 2000000 1000000 Linear (Area) 0 0 100 200 CONC. Fig. 6: Linearity of Atorvastatin 15635 r² = 0.999 6000000 AREA 4000000 AREA FENOFIBRATE34837x + y= 4000000 Area 2000000 Linear (Area) 0 0 100 200 CONC. 3. RESULTS AND DISCUSSION Fig. 7: Linearity of Fenofibrate 0.03µg/ml for Atorvastatin and 0.16-0.48µg/ml for Fenofibrate. Reverse phase HPLC method was preferred for the determination of Atorvastatin and Fenofibrate. Preliminary experiments were carried out to achieve the best chromatographic conditions for the simultaneous determination of the drug substances. Several column types and lengths were tried considering other chromatographic parameters. C18 column with a 4.6 mm inner diameter and 5µm particle size was chosen. The detection wave length was selected as 274nm with PDA detector. Chromatographic conditions were optimized by changing the mobile phase composition and buffers used in mobile phase. The experimental results were shown in table 6 and fig.6&7. The % recovery of Atorvastatin and Fenofibrate was found to be in the range of 99.5 to 100 % & 99 to 100.33% respectively. As there was no interference due to excipients and mobile phase, the method was found to be specific. As both compounds pass the peak purity, the method was found to be specific. The method was robust and rugged as observed from insignificant variation in the results of analysis by changes in Flow rate, column oven temperature, mobile phase composition and wave length separately and analysis being performed by different analysts. Different experiments were performed to optimize the mobile phase but adequate separation of the drugs could not be achieved. By altering the pH of buffer results a good separation. Different proportions of solvents were tested. Eventually the best separation was obtained by the isocratic elution system using a mixture of water (adjusted the pH to 2 with OPA): methanol (60:40, v/v) at a flow rate of 1 ml/min. a typical chromatogram for simultaneous estimation of the two drugs obtained by using a above mentioned mobile phase. Under these conditions Atorvastatin and Fenofibrate were eluted at 1.438min and 2.949minutes respectively with a run time of 5 minutes. The representative chromatogram of this simultaneous estimation shown in fig. 3 & 4 and results were summarized in Table 1. The results were shown in Table 5. The LOD and LOQ values were calculated based on the standard deviation of the response and the slope of the calibration curve at levels approximately the LOD and LOQ. The limit of detection was obtained as 0.00013µg/mL for Atorvastatin and 0.00210µg/mL for Fenofibrate. The limit of quantitation was obtained as 0.00046µg/mL for Atorvastatin and 0.0070µg/mL for Fenofibrate which shows that the method is very sensitive. The results were shown in Table. 7. The Methanol and water (pH 2 with OPA) (40:60, v/v) was chosen as the mobile phase. The run time of the HPLC procedure was 5 minutes at flow rate of 1ml/min was optimized which gave sharp peak, minimum tailing factor. The system suitability parameters were shown in Table 1 were in within limit, hence it was concluded that the system was suitable to perform the assay. The method shows linearity between the concentration range of 0.01- IJRPB 1(5) www.ijrpb.com 4. CONCLUSION A new validated RP-HPLC method has been developed for the quantitative and Qualitative determination of Atorvastatin and Fenofibrate in tablet dosage forms in bulk and pharmaceutical dosage forms was established. The method was completely validated shows satisfactory results for all the method validation parameters tested and method was free from interferences of the other active ingredients and additives used in the formulation. Infact results of the study indicate that the developed method was found to be simple, reliable, accurate, linear, sensitive, economical and reproducible and have short run time which makes the method rapid. Hence it can be concluded that the proposed method was a good approach September – October 2013 Page 581
  19. 19. Swathi et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) for obtaining reliable results and found to be suitable for the routine analysis of Atorvastatin and Fenofibrate in Bulk drug and Pharmaceutical formulations. Linda LN: Reviewer guidance-Validation of chromatographic methods, Center for drug evaluation and research, 1994, 1-30. 5. ACKNOWLEDGEMENT The authors would like to thank beloved parents and all my well wishers, one and all who have helped me directly and indirectly in completing this project work. Lloyd R.Synder, Joseph J.Kirkland, Joseph L.Glajeh, Practical HPLC method development, 2nd Edition. 1997,114. REFERENCES D A Shah, KK Bhatt, RS Mehtha, MB Shankar, TR Gandhi, Development and validation of a RP-HPLC method for determination of Atorvastatin calcium and Aspirin in a capsule dosage form, Indian Journal of Pharmaceutical Sciences, 69(4), 2007, 546-549. Deepti Jain, N Jain, R Raghuwanshi,Development and validation of RP-HPLC method for simultaneous estimation of Atorvastatin calcium and Fenofibrate in tablet dosage forms, Indian Journal of Pharmaceutical Sciences,70(2), 2008, 263-265. Gadewar CK, Mundik MB, Chandekar NA, Mahajan NM, Telgoti PD,RP-HPLC Method for Simultaneous Estimation of Atorvastatin Calcium Ezetimibe in Pharmaceutical Formulation, Asian Journal of Research in Chemistry, 3(2), 2010, 485-490. Hirave Rupali. V, Bendgude Ravindra.D, Maniyar Mithun.G, Kondavar Manish.S, Patil Sandeep.B, Spectrophotometric method for Simultaneous estimation of Atorvastatin Calcium & Fenofibrate in tablet Dosage Form, International Journal of Drug Development & Research, 5(1), 2013, 38-42. ICH-Q2A, Text on Validation of Analytical Procedures, ICH Harmonized Tripartite Guideline, Geneva, 1995, 2-3. ICH-Q2B, Validation of Analytical Procedures: Methodology, ICH Harmonized Tripartite Guideline, Geneva, 1996, 1-8. Krishna R. Gupta, Sonali S.Askarkar, Prashanth R.Rathod, Sudhir G.wadodkar, Validated spectrophotometric determination of Fenofibrate in Formulation, Der Pharmacia Sinica, pelagia research library, UK, 1(1), 2010, 173-178. IJRPB 1(5) www.ijrpb.com Nagavalli D, Balipaka Srinivas, Kalyan Chakravarthy C, A validation analytical method development for the simultaneous estimation of Metformin hydrochloride and Fenofibrate in pure and in tablet dosage form, International research journal of pharmacy, 2(12), 2011, 146-149. Onkar S. Havele, Shweta S.Havele, Simultaneous Determination of Atorvastatin calcium and Pioglitazone hydrochloride in Its Multicomponent Dosage Forms by UV Spectrophotometry, International Journal of Pharmacy and Pharmaceutical Science Research, 1(2), 2011, 75-79. P. N. Dhabale, D.S.Gharge, Simultaneous spectrophotometric estimation of Atorvastatin and Fenofibrate in bulk drug and dosage form by using simultaneous equation method. International Journal of ChemTech Research, 2 (1), 2010, 325-328. R.J.Hamilton and Swell, Introduction to HPLC, 2nd Edition, 2-94. Rajasekaran A, Sasikumar R, Dharuman J, Simultaneous RP-HPLC method for the stress degradation studies of Atorvastatin calcium and Ezetimibe in multicomponent dosage form, Ars Pharmaceutica, Spain,US.52(3), 2011, 12-18. Rupali Hirave, S.D.Bhinge, S.M.Malipatil, A.S.Savali, RP-HPLC method for simultaneous estimation of Atorvastatin Calcium and Fenofibrate in tablet dosage forms, Journal of PharmacyResearch, 3 (10), 2010, 2400. T.Depan, K Paul Ambethkar, G.Vijaya Lakshmi, M.D.Dhanaraju, Analytical Method Development And Validation of RP-HPLC For Estimation of Atorvastatin Calcium And Fenofibrate in Bulk Drug and Tablet Dosage forms, European Journal of Applied sciences, 3 (2), 2011, 35-39. September – October 2013 Page 582
  20. 20. Sindhura and Agarwal et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) ANALYTICAL METHOD DEVELOPMENT AND VALIDATION FOR THE SIMULTANEOUS ESTIMATION OF LAMIVUDINE, ZIDOVUDINE AND EFAVIRENZ BY RP-HPLC IN BULK AND PHARMACEUTICAL DOSAGE FORMS Sindhura D*, Nanda Kishore Agarwal Department of pharmaceutical analysis, Nimra College of Pharmacy *Corresponding Author: dasarisindhura.pharma@gmail.com, Phone no: 9951089007 ABSTRACT A simple rapid, accurate, precise and reproducible validated reverse phase HPLC method was developed for the determination of Lamivudine, Zidovudine and Efavirenz in bulk and pharmaceutical dosage forms. The quantification was carried out using Symmetry C18 (250 X 4.6 mm, 5 µm) column run in isocratic way using mobile phase comprising of methanol and water in the ratio of 65:35 v/v and a detection wavelength of 250nm, and injection volume of 20µL, with a flow rate of 1.0mL/min. The retention times of Lamivudine, Zidovudine and Efavirenz was found to be 2.519, 3.015 and 24.103. The method was validated in terms of linearity, precision, accuracy, LOD, LOQ and robustness in accordance with ICH guidelines. The linearity ranges of the proposed method lies between 0.080 mg/mL to 0.120 mg/mL, which is equivalent to 80% to 120% and with correlation coefficient of r2=0.9995,0.9994 and 0.9993 for Lamivudine, Zidovudine and Efavirenz. The assay of the proposed method was found to be 99.98%, 99.96% and 100.14%. The recovery studies were also carried out and mean % Recovery was found to be 100.7%, 100.28%, 100.45%. The % RSD from reproducibility was found to be <2%. The proposed method was statistically evaluated and can be applied for routine quality control analysis of Lamivudine, Zidovudine and Efavirenz in bulk and in Pharmaceutical dosage form. Key Words: Lamivudine, Zidovudine, Efavirenz, RP-HPLC, Symmetry C18, Tablets, Validation. 1. INTRODUCTION Lamivudine is 4-amino-1-[(2R, 5S)-2(hydroxymethy1)1, 3- oxathiolan-5-yl]-1, 2- dihydro pyramidine-2-one.The molecular weight is 229.26, molecular formula is C8H11N3O3S. It is an enantiomer of dideoxy analogue of cytidine. Zidovudine is 3' azido-3'deoxythymidine. The molecular weight is 267.24, molecular formula is C10H13N5O4.It is a thymidine analogue. Both Lamivudine and Zidovudine inhibits the HIV reverse transcriptase enzyme competitively and acts as a chain terminator of DNA synthesis and is used in the treatment of both types of HIV I and HIV II virus and chronic hepatitis B.Efavirenz is chemically (S)-6-chloro4-(cyclopropylethynyl)-1,4-dihydro4-(trifluoromethyl)2H-3,1- benzoxazin-2-one. The molecular weight is 315.67, molecular formula is C14H9ClF3NO2.It diffuses Figure.1.Structure of Lamivudine IJRPB 1(5) www.ijrpb.com into the cell where it binds adjacent to the active site of reverse transcriptase. This produces a conformational change in the enzyme that inhibits function. Literature review reveals very few methods are reported for the assay of Lamivudine, Zidovudine and Efavirenz in Tablet dosage forms using RP-HPLC method. The reported HPLC methods were having disadvantages like high flow rate, more organic phase and use of costly solvents. The proposed RP-HPLC method utilizes economical solvent system and having advantages like better retention time, less flow rate, very sharp and symmetrical peak shapes. The aim of the study was to develop a simple, precise, economic and accurate RPHPLC method for the estimation of Lamivudine, Zidovudine and Efavirenz in Tablet dosage forms. Figure.2. Structure of Zidovudine Figure.3.Structure of Efavirenz September – October 2013 Page 583
  21. 21. Sindhura and Agarwal et.al Indian Journal of Research in Pharmacy and Biotechnology 2. MATERIALS AND METHODS UV-3000 LABINDIA double beam with UV win 5software UV-VISIBLE spectrophotometer with 1cm matched quartz cells. Schimadzu HPLC equipped with SPD 20A UV-VIS detector and the column used was SYMMETRY C18 (250*4.6mm, 5µ). The data acquisition was performed by using LC solutions software. 2.1. Chemicals and reagents: Lamivudine, Zidovudine and Efavirenz pure samples were obtained from Mylan Laboatories, Hyderabad, India and dosage form “DuovirE” marketed by CIPLA was purchased from local pharmacy. Other chemicals all are of HPLC grade. 2.2. Preparation of mobile phase: A suitable quantity of degassed mixture of methanol and water in the ratio of 65:35 v/v was prepared and filtered through 0.45µ filter under vacuum filtration. 2.3. Preparation of standard solution: Standard solution of Lamivudine, Zidovudine and Efavirenz (600μg/ml, 150 μg/ml,300μg/ml) was prepared by dissolving 60mg of Efavirenz, 15mg of Lamivudine and 30mg of Zidovudine working standard in 50ml of diluent with sonication and made up to 100ml with the same diluent. 2.4. Preparation of sample solution: Five tablets were weighed and finely powdered and a powder quantity equivalent to 150mg Lamivudine, 300mg of Zidovudine and 600mg of Efavirenz were accurately weighed and transferred to a 100ml volumetric flask and 50ml of diluent was added to the same. The flask was sonicated for 30 min and volume was made up to the mark with diluent. Transferred 5ml of solution into a 50ml volumetric flask and dilute up to the mark with diluent so as to obtain a concentration of 150,300,600 μg/mL mixed well and injected. The amount present in each tablet was calculated by comparing the area of standard Efavirenz, Lamivudine, Zidovudine and tablet sample. 2.5. Method optimization: The chromatographic separation was performed using Symmetry C18 (250×4.6mm, 5µm) column. For selection of mobile phase, various mobile phase compositions were observed for efficient elution and good resolution. The mobile phase consisting of methanol and water in the ratio of 65:35v/v was found to be the optimum composition for efficient elution of analyte. The mobile phase was injected to the column at a flow rate of 1.0 ml/min for 35min. The column temperature was maintained at 30oC. The analyte was monitored at 250 nm using UV-detector. The retention time of the drugs was found to be 2.519, 3.015 and 24.103min. Mobile phase was used as IJRPB 1(5) www.ijrpb.com ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) diluent during the standard and test samples preparation. 3. RESULTS 3.1. Method Validation 3.1.1. System suitability: System suitability tests are an integral part of method validation and are used to ensure adequate performance of the chromatographic system. Retention time (RT), number of theoretical plates (N) or column efficiency and tailing factor (T) were evaluated for five injections of standard solution at a solution of 100µg/ml of Lamivudine, Zidovudine and Efavirenz. The results are tabulated in the table no-2 and the chromatogram was shown in the figure no- 4. 3.1.2. Specificity: Specificity is the ability of analytical method to measure accurately and specifically the analyte in the presence of components that may be expected to be present in the sample. The specificity of method was determined by spiking possible impurities at specific level to standard drug solution (100ppm). The diluent and placebo solutions were also injected to observe any interference with the drug peak. The results are tabulated in the table no-3 and the chromatogram was shown in the figure no- 5, 6. 3.1.3. Linearity: Linearity is the ability of the method to produce results that is directly proportional to the concentration of the analyte in samples with given range. The linearity of Lamivudine, Zidovudine and Efavirenz was in the concentration range of 80-120%.From the linearity studies calibration curve was plotted and concentrations were subjected to least square regression analysis to calculate regression equation. The regression coefficient was found to be 0.9995 for Lamivudine, 0.9994 for Zidovudine and 0.9993 for Efavirenz and shows good linearity for three drugs. The results are tabulated in the table no-4 and the chromatogram was shown in the figure no- 7, 8, 9. 3.1.4. Accuracy: Accuracy is the closeness of results obtained by a method to the true value. It is the measure of exactness of the method. Accuracy of the method was evaluated by standard addition method. Recovery of the method was determined by spiking an amount of the pure drug (80%,100% ,120%) at three different concentration levels in its solution has been added to the pre analyzed working standard solution of the drug. The results are tabulated in the table no-5, 6, 7. 3.1.5. Precision: The precision of the analytical method was studied by analysis of multiple sampling of homogeneous sample. The Precision expressed as standard deviation or relative standard deviation. September – October 2013 Page 584
  22. 22. Sindhura and Agarwal et.al Indian Journal of Research in Pharmacy and Biotechnology 3.1.6. System precision: System precision was performed by injecting a standard solution of Lamivudine, Zidovudine and Efavirenz at working concentrations five times. The results are tabulated in the table no-8. 3.1.7. Method precision: Method precision was performed by analyzing a sample solution of Lamivudine, Zidovudine and Efavirenz by injecting six replicates of the same sample preparations at a concentration of 100ppm/mL. The results are tabulated in the table no-9. ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) 3.1.8. Robustness: Robustness shows the reliability of an analysis with respect to deliberate variations in method parameters. If measurements are susceptible to variations in analytical conditions, the analytical conditions should be suitably controlled or a precautionary statement should be included in the procedure. Table.1.Optimized chromatogram conditions for Lamivudine, Zidovudine and Efavirenz Column Symmetry C18 (250*4.6mm,5µ) Mobile phase Methanol: Water(65:35) Flow rate 1.0 ml/ min Wavelength 250 nm Injection volume 20 l Column temperature 30o C Run time 35 min Table.2. System suitability Data for Lamivudine, Zidovudine and Efavirenz Lamivudine Zidovudine Peak area Peak area 1 2027423 1501204 2 2025853 1500977 3 2026576 1501113 4 2025030 1501308 5 2027292 1502391 Average 2026435 1501399 SD 1005 568 %RSD 0.05 0.04 Theoretical plates 6615 7512 Tailing factor 1.25 1.32 Retention time 2.519 3.015 S.No Peak Name Lamivudine Zidovudine Efavirenz Table.3.Specificity Data for Lamivudine, Zidovudine and Efavirenz Retention Time (Minutes) 2.541 3.001 22.403 Efavirenz Peak area 3138895 3142519 3150529 3154259 3158911 3149023 8251 0.26 4500 1.12 24.103 RT ratio 1.00 1.18 8.82 Table.4. Linearity Data for Lamivudine, Zidovudine and Efavirenz Lamivudine Zidovudine Efavirenz Level Con. (mg/ml) Peak area Con.(mg/ml) Peak area Con.(mg/ml) Peak area 80% 0.07959 1576950 0.08005 1169205 0.08095 2521629 90% 0.08855 1761010 0.09010 1299358 0.08846 2753981 100% 0.10350 2040551 0.10360 1504208 0.10290 3198155 110% 0.10810 2121575 0.10850 1565537 0.10853 3342493 120% 0.11950 2357552 0.12015 1735081 0.11925 3701006 Slope 19338642.0219 14201079.1883 30526500.1606 Intercept 40602.8714 27753.3632 50253.3069 Correlation coefficient 0.9997 0.9997 0.9997 R square 0.9995 0.9994 0.9993 IJRPB 1(5) www.ijrpb.com September – October 2013 Page 585
  23. 23. Sindhura and Agarwal et.al Indian Journal of Research in Pharmacy and Biotechnology S.No 1 2 3 4 5 Average SD % RSD S.No 1 2 3 4 5 6 Average SD % RSD ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) Table.5. System precision of Lamivudine, Zidovudine and Efavirenz (8) Lamivudine Zidovudine Efavirenz Area RT Area RT Area RT 2027423 2.540 1501204 3.044 3138895 25.192 2025853 2.540 1500977 3.043 3142519 25.100 2026576 2.544 1501113 3.045 3150529 25.061 2025030 2.541 1501308 3.043 3154259 24.954 2027292 2.542 1502391 3.042 3158911 24.559 2026435 1501399 3149023 1005 568 8251 0.05 0.04 0.26 Table.6. Method precision of Lamivudine, Zidovudine and Efavirenz(9) Lamivudine Assay RT Zidovudine RT Efavirenz (%) Assay (%) Assay (%) 99.5 2.539 99.3 3.019 99.3 100.5 2.539 99.6 3.019 100.4 99.5 2.541 99.4 3.024 99.3 99.6 2.539 99.8 3.020 99.8 99.8 2.537 99.5 3.020 99.9 100.0 2.540 99.9 3.021 99.9 99.8 99.6 99.8 0.4 0.2 0.4 0.4 0.2 0.4 RT 22.841 22.869 22.940 22.941 22.889 22.941 - Table.7. Variation in flow rate, column temperature and buffer for Lamivudine (10) Lamivudine Flow (mL/min) Temperature(oC) Buffer Low High Low High Low High %RSD 0.05 0.12 0.30 0.03 0.05 0.25 Retention time 3.094 2.556 2.814 2.808 2.809 2.821 Plate count 5.54 6.10 5124 5029 5954 4054 Tailing factor 1.20 1.21 1.20 1.26 1.32 1.22 Parameter Table.8.Variation in flow rate, column temperature and buffer for Zidovudine (11) Zidovudine Flow (mL/min) Temperature(oC) Buffer Low High Low High Low High %RSD 0.14 0.17 0.19 0.06 0.04 0.18 Retention time 3.598 3.000 3.316 3.310 3.291 3.351 Plate count 4818 6010 4523 6842 4898 5818 Tailing factor 1.14 1.21 1.18 1.18 1.27 1.25 Parameter Table.9.Variation in flow rate, column temperature and buffer for Efavirenz(12) Efavirenz Flow (mL/min) Temperature(oC) Buffer Low High Low High Low High %RSD 0.43 0.17 0.23 0.15 0.31 0.23 Retention time 25.251 20.889 23.399 23.677 21.621 26.840 Plate count 4558 5518 5326 5692 5558 4558 Tailing factor 1.32 1.18 1.23 1.32 1.31 1.31 Parameter IJRPB 1(5) www.ijrpb.com September – October 2013 Page 586
  24. 24. Sindhura and Agarwal et.al Indian Journal of Research in Pharmacy and Biotechnology Figure.4.Standard chromatogram Figure.6.Chromatogram for Specificity Figure.8.Linearity plot for Zidovudine 4. DISSCUSSION 4.1. System suitability: From the system suitability studies it was observed that retention time of Lamivudine, Zidovudine and Efavirenz was found to be 2.519, 3.015 and 24.103 min. % RSD of peak area was found to be 0.05.0.04 and 0.26. Theoretical plates were found to be more than 4000. USP tailing factor was found to be 1.25, 1.32 and 1.12 for Lamivudine, Zidovudine and Efavirenz. All the parameters were within the limit. IJRPB 1(5) www.ijrpb.com ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) Figure.5.Sample chromatogram Figure.7. Linearity plot for Lamivudine Figure.9.Linearity plot for Efavirenz 4.2. Specificity: The Chromatograms of Standard and Sample are identical with nearly same Retention time. There is no interference with blank and placebo to the drugs. Hence the proposed method was found to be specific. 4.3. Linearity: From the Linearity data it was observed that the method was showing linearity in the concentration range of 80-120μg/ml for Lamivudine, Zidovudine and Efavirenz. Correlation coefficient was found to be 0.9995, 0.9994 and 0.9993 for three compounds. September – October 2013 Page 587
  25. 25. Sindhura and Agarwal et.al Indian Journal of Research in Pharmacy and Biotechnology 4.4. Accuracy: The recoveries of pure drug from the analyzed solution of formulation were in the range of 99.3%-101.6%, which shows that the method was accurate. 4.5. Precision 4.5.1. System precision: The percentage relative standard deviation (RSD) for the peak area of Lamivudine, Zidovudine and Efavirenz were 0.05, 0.04 and 0.26. 4.5.2. Method precision: The percentage relative standard deviation for the assay values of Lamivudine, Zidovudine and Efavirenz were 0.4, 0.2 and 0.4. 4.6. Ruggedness: Comparison of both the results obtained for two different Analysts shows that the method was rugged for Analyst-Analyst variability. The %RSD for intermediate precision for Lamivudine, Zidovudine and Efavirenz was found to be 0.4, 0.2 and 0.4. 4.7. Robustness  ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) forms, Journal of Pharmacy Research, 4(10), 2011, 37663768. Pishawikar SA, Jadhav SD, Bhatia M.s and Thamake SL, UV spectrophotometric method for the estimation of Lamivudine, Zidovudine and Nevirapine in pure and tablet formulation, Asian Journal of Research in Chemistry Issue, 4(3), 2010, 1-3. M. Kumar, B. Jayakar, C. Saravanan and M. V. Kumudhavalli, RP-HPLC method for simultaneous estimation of Lamivudine and Zidovudine in pure and tablet formulation, J. Chem. Pharm. Res, 1(2), 2010, 478481. Palani Venkatesh, M.Ruthu and Y.Padmanabha Reddy, Normal phase HPTLC method for the simultaneous analysis of Lamivudine and Zidovudine in fixed dose combination tablets, Journal of Pharmaceutical Analysis, 2(2), 2012, 152-155. As the % RSD of retention time and asymmetry were within limits for variation in flow rate (± 0.1 ml). Hence the allowable flow rate should be within 0.9 ml to 1.1 ml. As the % RSD of retention time and asymmetry were within limits for variation (+ 20C) in column oven temperature. Hence the allowable variation in column oven temperature is + 20C. As the % RSD of retention time and asymmetry were within limits for variation (+ 2 %) in composition of mobile phase. Hence the allowable variation in mobile phase composition is ± 2 %. All the system suitability parameters are within limits for variation (±2nm) in wavelength. Hence the allowable variation in wavelength is ± 2nm. The results obtained were satisfactory and are in good agreement as per the ICH guidelines. Sigonda, Yogendra Singh and Rajiv Sharma, Normal phase HPTLC method for the simultaneous analysis of Lamivudine, Stavudine and Nevirapine in fixed dose combination tablets, Journal of Pharmaceutical and Biomedical Analysis, 54(3), 2010, 445-450. 4.8. Acknowledgement: The authors thankful to Mr. K. Srinivasa Rao (AGM), Mr. Jyothibasu Director, Mylan Laboratories for providing necessary facilities to carry out the research work. 5. CONCLUSION Jacqueline De Souza, Eunice Kazue Kano, Eunice Emiko Mori Koono, Simone Grigoleto Schramm, Valentina Porta and Sílvia Storpirtis, LC–UV Methodology for Simultaneous Determination of Lamivudine and Zidovudine in Plasma by Liquid–Liquid Extraction, Chromatographia, 2(69), 2009, 231-235.     Finally it concludes that all the parameters are within the limits and meet the acceptance criteria of ICH guidelines for method validation. The proposed method was simple, accurate, specific, precise, robust, rugged and economical. Hence this method is validated and can be used for routine sample analysis REFERENCES Balamuralikrishna K, Mahendra K. And B. Syama Sundar, RP-HPLC method for the simultaneous estimation of Efavirenz, Lamivudine and Zidovudine in tablet dosage IJRPB 1(5) www.ijrpb.com Hemanth Kumar and Anil Bhandari, Reverse-phase high performance liquid chromatographic method for simultaneous determination of plasma zidovudine and nevirapine with UV detection at 260 nm, Journal of Pharmaceutical and Biomedical Analysis, 29(6), 2002, 1081-1088. Sindhuri and Versha Parcha, High performance liquid chromatographic method was developed for the simultaneous estimation of lamivudine, zidovudine and nevirapine in pharmaceutical dosage forms, Journal of Chromatography, 7(2) 2013, 353-362. Ashok Peepliwal, Sagar D. Vyawahare and Chandrakant G. Bonde, Quantitative analysis of Zidovudine containing formulation by FT-IR and UV spectroscopy, Anal. Methods, 11, 2010, 1756-1763. Beckett AH, Stenlake JB, Practical pharmaceutical chemistry. Vol. II. New Delhi: CBS Publisher and Distributors, 1986, 13-17. Skoog, DA Holler, FJ Nieman, T.A. Principles of instrumental analysis, Thomson Brooks/Cole, Fifth edition. 1998, 329-335. September – October 2013 Page 588
  26. 26. Jyothsna et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) NOVEL RP-HPLC METHOD DEVELOPMENT AND VALIDATION OF LOSARTAN POTASSIUM AND AMLODIPINE DRUGS IN PURE AND PHARMACEUTICAL DOSAGE FORMS Kumari Jyothsna, Chandana N, Vinjam Swathi Nimra College of Pharmacy, Vijayawada, A.P, India *Corresponding author: Email: jyothsna.s.k24@gmail.com, Phone +91-9492940598 ABSTRACT A fast, robust and accurate RP-HPLC method was developed and validated for simultaneous determination of Losartan potassium and Amlodipine in tablets. The mobile phase was mixture of aqueous Tri ethyl amine with pH 2.0 and Acetonitrile(70:30), effluent flow rate monitored at 1.0 ml/min. the stationary phase was C18 column, 3µm(4.6×250mm). The solutions of standard and the sample were prepared in methanol. The retention times was found to be 2.916min and 5.214min for Losartan potassium and Amlodipine respectively at 246nm. Calibration graphs constructed at their wavelengths of determination were linear in the concentration range of 50-150µg/ml. The percentage assay for Losartan potassium and Amlodipine were found to be 101% and 100%respectively. The method was validated and it was found to be accurate, precise, linear and reproducible as per ICH guidelines. Keywords: RP-HPLC, Losartan potassium, Amlodipine, Accuracy, Precision, Linearity. 1. INTRODUCTION Losartan potassium is a [2-butyl-4-chloro-1-({4[2-(2H-1,2,3,4-tetrazol-5-yl)phenyl]phenyl}methyl)-1Himidazol-5-yl]methanol monopotassium salt. It competitively inhibits the binding of angiotensin II to AT1 in many tissues including vascular smooth muscle and the adrenal glands. Inhibition of angiotensin II binding to AT1 inhibits its AT1-mediated vasoconstrictive and aldosterone-secreting effects and results in decreased vascular resistance and blood pressure. Losartan potassium is 1,000 times more selective for AT1 than AT2. Inhibition of aldosterone secretion may increase sodium and water excretion while decreasing potassium excretion. It is effective for reducing blood pressure and may be used to treat left ventricular hypertrophy and diabetic nephropathy. Amlodipine (3-ethyl 5-methyl 2-[(2aminoethoxy)methyl]-4-(2-chlorophenyl)-6-methyl-1,4dihydropyridine-3,5-dicarboxylate) decreases arterial smooth muscle contractility and subsequent vasoconstriction by inhibiting the influx of calcium ions through L-type calcium channels. Calcium ions entering the cell through these channels bind to calmodulin. Calcium-bound calmodulin then binds to and activates myosin light chain kinase (MLCK). Activated MLCK catalyzes the phosphorylation of the regulatory light chain subunit of myosin, Inhibition of the initial influx of calcium decreases the contractile activity of arterial smooth muscle cells and results in vasodilation. The vasodilatory effects of amlodipine result in an overall decrease in blood pressure. Another possible mechanism is that amlodipine inhibits vascular smooth muscle carbonic anhydrase I activity causing cellular pH increases which may be involved in regulating intracelluar calcium influx through calcium channels. IJRPB 1(5) www.ijrpb.com Literature survey revealed that very few methods have been reported for the analysis of Losartan potassium and Amlodipine combinational dosage forms which include UV spectroscopy, High performance Liquid Chromatography, HPTLC methods. The present study illustrate development and validation of simple, selective, accurate, economical precise RP-HPLC method for the determination of Losartan potassium and Amlodipine in bulk and Pharmaceutical dosage forms as per ICH guidelines. The aim of this study is to develop rapid, economical HPLC method for the analysis of Losartan potassium and Amlodipine in combined dosage form using most commonly employed column (C18) and simple mobile phase preparation. In the present work a successful attempt had been made to develop a method for the simultaneous estimation of Losartan potassium and Amlodipine pharmaceutical dosage form and validate it. The method would help in estimation of drugs in single run which reduces the time of analysis and does not require separate method for each drug. Thus, the paper reports an economical, simple and accurate RP-HPLC method for the above said pharmaceutical dosage forms. 2. MATERIALS AND METHODS Equipments used: Quantitative HPLC was performed on a high performance liquid chromatography -Waters e2695Alliance HPLC system connected with PDA Detector 2998 and Empower2 Software. The drug analysis data were acquired and processed using Empower2 software running under Windows XP on a Pentium PC and Agilent Zorbax C18, (3μ, 250 x 4.6mm). In addition an analytical balance (DENVER 0.1mg sensitivity), digital pH meter (Eutech pH 510), a sonicator (Unichrome associates UCA 701) were used. September – October 2013 Page 589
  27. 27. Jyothsna et.al Indian Journal of Research in Pharmacy and Biotechnology Standards and chemicals used: Pharmaceutical grade Losartan potassium and Amlodipine were kindly supplied as a gift sample by Dr.Reddy’s Laboratory, Hyderabad, India. Acetonitrile and methanol was of HPLC grade, Purchased from E. Merck, Darmstadt, Germany. Triethylamine was analytical reagent grade supplied by Fischer Scientific Chemicals. Water HPLC grade was obtained from a Milli-QRO water purification system. Losartan potassium and Amlodipine Tablets available in the market as Losar-A (Unichem pharmaceuticals, Himachal pradesh, India.) in composition of Losartan potassium (50mg) Amlodipine (5mg). Preparation of mobile phase: Transfer water into 1000ml of beaker dissolve and diluted volume with water. Then adjust its pH to 2.0 with Trithylamine. The Water adjusted pH to 2 with Triethylamine: acetonitrile (70:30 v/v) and filtered through 0.45µ membrane filter and degassed by sonication. Preparation of calibration standards: 10mg Losartan potassium and 10mg Amlodipine was taken into a 50, 10 ml of Volumetric flask and add 10ml of Diluent and sonicated for 10 minutes and made up with Diluent.It was further diluted to get stock solution of Losartan potassium and Amlodipine (To get 0.2 ppm and 0.02 ppm solution Respectively). This is taken as a 100% concentration. Working standard solutions of Losartan potassium and Amlodipine was prepared with mobile phase. To a series of 10 ml volumetric flasks, standard solutions of Losartan potassium and Amlodipine in the concentration range of 0.1-0.3µg/ml and 0.01-0.03µg/ml were transferred respectively. System suitability: System suitability is an integral part of chromatographic system. At first the HPLC system was stabilized for 40 min. One blank followed by six replicate analysis of solution containing 100% target concentration of Losartan potassium and Amlodipine were injected to check the system suitability. To ascertain the system suitability for the proposed method, a number of parameters such as theoretical plates, retention time were taken and results along with optimized chromatographic conditions were presented in Table 1. Recommended procedure: Calibration curves for Losartan potassium and Amlodipine: Replicate analysis of solution containing 0.1-0.3µg/ml and 0.01-0.03µg/ml of Losartan potassium and Amlodipine sample solutions respectively were injected into HPLC according to the procedure in a sequence and chromatograms were recorded. Calibration curves were constructed by plotting by taking concentrations on X-axis and ratio of peak areas of IJRPB 1(5) www.ijrpb.com ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) standards on Y-axis and regression equation were computed for both drugs and represented in Table 2. Analysis of marketed formulation: The content of Ten tablets were weighed accurately. Their average weights were determined. Powder of tablets equivalent to two tablets weight(600.04mg) were weighed and taken in a 50 ml volumetric flask, dissolved in diluents, shaken and sonicated for about 20 minutes then filtered through 0.45µ membrane filter. The filtered solution was further diluted (5 to 50ml) in the diluent to make the final concentration of working sample equivalent to 100% of target concentration. The prepared sample and standard solutions were injected into HPLC system according to the procedure. From the peak areas of Losartan potassium and Amlodipine the amount of the drugs in the sample were computed. The contents were calculated as an average of six determinations and experimental results were presented in Table 3. The representive standarad and sample chromatograms were shown in fig. 4and fig.5. Validation study of Losartan potassium and Amlodipine: An integral part of analytical method development is validation. Method validation is the process to confirm that the analytical procedure employed for a specific test is suitable for its intended use. The newly developed RP-HPLC method was validated as per International Conference on Harmonization (ICH) guidelines for parameters like specificity, system suitability, accuracy, linearity, precision (repeatability), limit of detection(LOD), limit of Quantification(LOQ) and robustness. Specificity: The effect of wide range of excipients and other additives usually present in the formulation of Losartan potassium and Amlodipine in the determination under optimum conditions were investigated. The specificity of the RP-HPLC method was established by injecting the mobile phase and placebo solution in triplicate and recording the chromatograms. The common excipients such as lactose anhydrous, microcrystalline cellulose and magnesium state have been added to the sample solution injected and tested. Precision: precision study of sample (Losartan potassium and Amlodipine) was carried out by estimating corresponding responses 6 times on the same day for the 100% target concentration. The percent relative standard deviation (%RSD) is calculated which is within the acceptable criteria of not more than 2.0. Linearity: The linearity graphs for the proposed assay methods were obtained over the concentration range of 0.1-0.3µg/ml and 0.01-0.03µg/ml (50-150%) Losartan potassium and Amlodipine respectively. Method of least square analysis is carried out for getting the slope, September – October 2013 Page 590
  28. 28. Jyothsna et.al Indian Journal of Research in Pharmacy and Biotechnology intercept and correlation coefficient, and the results were presented in Table 2. A calibration curve was plotted between concentration and area response and statistical analysis of the calibration curves were shown in fig 6,7. Accuracy (Recovery studies): The accuracy of the method is determined by calculating recovery of Losartan potassium and Amlodipine by the method of addition. Known amount of Losartan potassium and Amlodipine at 50%, 100%, 150% is added to a pre quantified sample solution. The recovery studies were carried out in the tablet in triplicate each in the presence of placebo. The mean percentage recovery of Losartan potassium and Amlodipine at each level is not less than 99% and not more than 101%. Robustness: The robustness is evaluated by the analysis of Losartan potassium and Amlodipine under different experimental conditions such as making small changes in flow rate (±0.2 ml/min), column temperature (±5). LOD and LOQ: Limit of detection is the lowest concentration in a sample that can be detected but not necessarily quantified, under the stated experimental conditions. The limit of quantification is the lowest concentration of analyte in asample that can be determined with acceptable precision and accuracy. Limit of detection and limit of quantification were calculated using following formula LOD=3.3(SD)/S and LOQ=10(SD)/S, where SD= standard deviation of response (peak area) and S= average of the slope of the calibration curve. 3. RESULTS AND DISCUSSION Reverse phase HPLC method was preferred for the determination of Losartan potassium and Amlodipine. Preliminary experiments were carried out by changing the mobile phase composition and buffers used in mobile phase. Different experiments were performed to optimize the mobile phase. By altering the pH of buffer results a good separation. Different proportions of solvents were tested. Eventually the best separation was obtained by the isocratic elution system using a mixture of water (adjusted IJRPB 1(5) www.ijrpb.com ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) the pH to 2 with Triethyl amine): acetonitrile (70:30, v/v) at a flow rate of 1 ml/min. Several column types and lengths were tried considering other chromatographic parameters. C18 column with 250 x 4.6mm length, inner diameter and 3µm particle size was chosen. The detection wave length was selected as 246nm with PDA detector. A typical chromatogram for simultaneous estimation of the two drugs obtained by using a above mentioned mobile phase. Under these conditions Losartan potassium and Amlodipine were eluted at 2.916min and 5.216min respectively with a run time of 6 minutes. The representative chromatogram of this simultaneous estimation shown in fig. 3,4,5 and system suitability results along with optimized chromatographic conditions were summarized in Table 1. The method shows linearity between the concentration range of 0.1-0.3µg/ml for Losartan potassium and 0.01-0.03µg/ml for Amlodipine. The experimental results were shown in table 6 and fig 6, 7. The % recovery of Losartan potassium and Amlodipine was found to be in the range of 99.5 to 100 % & 99 to 100.33% respectively, the results wer shown in Table 4. As there was no interference due to excipients and mobile phase, the method was found to be specificresults were shown inTable 2 and fig 3,4,5. The precssion obtained was within the limits i.e., RSD<2 which would indicate that the proposed method was quite precise and reproducible and results were shown in Table 3. The method was robust and rugged as observed from insignificant variation in the results of analysis by changes in Flow rate, column oven temperature. The results were shown in Table 5. The LOD and LOQ values were calculated based on the standard deviation of the response and the slope of the calibration curve at levels approximately the LOD and LOQ. The limit of detection was obtained as 0.000633µg/mL for Losartan potassium and 0.000069µg/mL for Amlodipine. The limit of quantitation was obtained as 0.0021µg/mL for Losartan potassium and 0.00023µg/mL for Amlodipine which shows the method is very sensitive. September – October 2013 Page 591
  29. 29. Jyothsna et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) Table.1. Optimized chromatographic conditions and system suitability parameters for proposed method Parameter Chromatographic conditions Instrument Waters e2695 Alliance HPLC with Empower2 software Column Agilent Zorbax C18, (3μ, 250 x 4.6mm) Detector PDA Detector 2998 Diluents Methanol Mobile phase Aqueous triethylamine(Ph 2.0): acetonitrile (70:30 v/v) Flow rate 1ml/min Detection wavelength 246nm Temperature Ambient(35°c) Injection volume 5µl Retention time Losartan potassium 2.91 Amlodipine 5.21 Theoretical plate count Losartan potassium 8216 Amlodipine 8081 Tailing factor Losartan potassium 1.59 Amlodipine 1.43 Resolution factor 12.25 Table.2. Specificity study Name of the solution Retention time in min Blank No peaks Losartan potassium 2.91 Amlodipine 5.21 Sample Losartan potassium Amlodipine IJRPB 1(5) www.ijrpb.com Table.3. Results of precision study Injection number Precision RT Peak area 1 2.920 6126639 2 2.919 6167905 3 2.916 6160774 4 2.919 6188024 5 2.915 6138705 6 2.917 6127062 Mean 6156494 %RSD(NMT 2.0) 0.40 1 5.216 9971154 2 5.214 9966863 3 5.212 9970936 4 5.214 9990844 5 5.207 9954087 6 5.207 9963155 Mean 9969177 %RSD(NMT 2.0) 0.12 September – October 2013 Page 592
  30. 30. Jyothsna et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) Table.4. Recovery data of the proposed Losartan potassium and Amlodipine Sample SpikedAmount RecoveredAmount %Recovered %Average (µg/ml) (µg/ml) recovery 49.5 49.95 101 Losartan 101% 99 100.26 101 potassium 148.5 149.56 101 4.95 4.94 100 Amlodipine 100.33% 9.9 9.93 101 14.85 14.96 100 Table 5: Robustness results of Losartan potassium and Amlodipine sample parameters Flow rate (±0.2) Losartan potassium Optimized 1ml/min Temperature (±5°C) 35°C Flow rate (±0.2) 1ml/min Temperature (±5°C) 35°C Amlodipine used 0.8 1 1.2 30 35 40 0.8 1 1.2 30 35 40 RT 3.408 2.916 2.910 3.408 2.916 2.908 5.933 5.214 5.166 5.953 5.214 5.167 Peak area 5159863 6100287 6134592 5159863 6100287 6141851 8217887 9833918 9942019 8217887 9833918 9954276 Plate count 7861 7868 7958 7794 7868 7862 7746 7660 7764 7751 7660 7765 Table.6.Linearity data of the Losartan potassium and Amlodipine S.NO 1. 2. S.NO 1. 2. IJRPB 1(5) sample Losartan potassium Amlodipine Linearity level (µg/ml) 0.1 0.15 0.2 0.25 0.3 0.01 0.015 0.02 0.025 0.03 Peak area 3053242 4539421 6105323 7616656 9188085 4913960 7471465 9978009 12408307 19972978 Slope Y-intercept r² 19288 99780.88 0.9999 16616 61387.68 0.9999 Table.7.Limit of Detection and Limit of Quantification Sample LOD Losartan potassium 0.000633µg/ml Amlodipine 0.000069µg/ml www.ijrpb.com September – October 2013 LOQ 0.0021µg/ml 0.00023µg/ml Page 593
  31. 31. Jyothsna et.al Indian Journal of Research in Pharmacy and Biotechnology Fig 1: Structure of Losartan potassium ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) Fig 2: Structure of Amlodipine Fig.3: Chromatogram of Blank solution Fig 4: Chromatogram of standard solution Fig 5: Chromatogram of marketed formulation IJRPB 1(5) www.ijrpb.com September – October 2013 Page 594
  32. 32. Jyothsna et.al ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) Indian Journal of Research in Pharmacy and Biotechnology LOSARTAN POTASSIUM 10000000 r²=0.9999 8000000 Y=19288X+99780.8 AREA 6000000 4000000 LINEAR 2000000 0 0 50 100 CONC% 150 200 Fig. 6: Linearity of Losartan potassium AMLODIPINE 16000000 14000000 12000000 10000000 8000000 r²=0.9999 AREA Y=16616X+ 61387.68 6000000 4000000 2000000 0 LINEAR 0 50 100 CONC% 150 200 Fig. 7: Linearity of Amlodipine 4. CONCLUSION A new validated RP-HPLC method has been developed for the quantitative and Qualitative determination of Losartan potassium and Amlodipine in tablet dosage forms in bulk and pharmaceutical dosage forms was established. The developed HPLC technique is precise, specific, robust and accurate. Results of analysis of pharmaceutical formulations reveal that the proposed methods are suitable for their analysis with virtually no interference of the usual additives presented in pharmaceutical formulations. This method is simple, reliable, accurate, linear, sensitive, economical and reproducible. Hence it can be concluded that the proposed method was a good approach for obtaining reliable results and found to be suitable for the routine analysis of Losartan potassium and Amlodipine in Bulk drug and Pharmaceutical formulations. 5. ACKNOWLEDGEMENT IJRPB 1(5) www.ijrpb.com The authors would like to thank beloved parents and all my well wishers, one and all who have helped me directly and indirectly in completing this project work. REFERENCES AV Kasture and Madhuri Ramteke, Simultaneous UVspectrophotometric method for the estimation of atenolol and amlodipine besylate in combined dosage form, Indian J Pharm Sci, 68, 2006, 394-6 Chaudhari BG, Patel NM and Shah PB, Stability indicating RP-HPLC method for simultaneous determination of atorvastatin and amlodipine from their combination drug products, Chem Pharm Bull (Tokyo), 55(2), 2007, 241-6. D. N. Vora and A. A. Kadav, Development and validation of a simultaneous HPLC method for estimation of Bisoprolol Fumarate and Amlodipine besylate from tablets, Indian J Pharm Sci, 70(4), 2008, 542–546 September – October 2013 Page 595
  33. 33. Jyothsna et.al Indian Journal of Research in Pharmacy and Biotechnology ICH, Q2A validation of analytical procedure: Methodology International Conference on Harmonization, Geneva, October 1994. ICH, Q2B Validation of analytical procedure: Methodology International Conference on Harmonization, Geneva, March 1996. Loyd R. Snyder, Practical HPLC Method Development, 4th ed, A-Wiley-inter Science publication, 1997, 234265. IJRPB 1(5) www.ijrpb.com ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) R. Sharma, S. Khanna and G. P. Mishra, RP-HPLC method for simultaneous estimation of atenolol, hydrochlorothiazide and losarton in tablet dosage form Chem Sci Trans., 2013, 2(S1), S1-S6. Ramya Gavini, S. B. Puranik, G. V. S. Kumar and K. A. Sridhar, Simultaneous estimation of Amlodipine and Losartan by UV-method in bulk drug and tablet dosage formulation, Archives of Applied Science Research, 4 (5), 2012, 2206-2212. September – October 2013 Page 596

×