Your SlideShare is downloading. ×
0
Genética molecular: Transcripción
Genética molecular: Transcripción
Upcoming SlideShare
Loading in...5
×

Thanks for flagging this SlideShare!

Oops! An error has occurred.

×
Saving this for later? Get the SlideShare app to save on your phone or tablet. Read anywhere, anytime – even offline.
Text the download link to your phone
Standard text messaging rates apply

Genética molecular: Transcripción

14,826

Published on

Transcripción

Transcripción

Published in: Education
0 Comments
5 Likes
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total Views
14,826
On Slideshare
0
From Embeds
0
Number of Embeds
20
Actions
Shares
0
Downloads
199
Comments
0
Likes
5
Embeds 0
No embeds

Report content
Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
No notes for slide

Transcript

  • 1. 1º se abre una parte de la doble cadena de ADN: 2º se copia la información del gen añadiendo letras, de forma complementaria, para formar ARN: ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG Cuando se transcribe el ADN a ARN ocurre esto: ATTCGCGGCATTAATCCGATACCTAGTA CCGCGGATTTAAACATGGATC ATTCGCGGCATTAATCCGATACCTAGTA TACCTAG TAAGCGCCGTAATTAGGCTATGGATCAT ATGGATC TAAGCGCCGTAATTAGGCTATGGATCAT GGCGCCTAAATTTGTACCTAG La doble cadena de ADN NO se terminará abriendo del todo. Sólo se transcribe a ARN la información de algunos genes. ADN ATTCGCGGCATTAATCCGATACCTAGTA CCGCGGATTTAAACATGGATC ATTCGCGGCATTAATCCGATACCTAGTA GGCGCCUAAAUUUG TACCTAG TAAGCGCCGTAATTAGGCTATGGATCAT ATGGATC TAAGCGCCGTAATTAGGCTATGGATCAT GGCGCCTAAATTTGTACCTAG C G U A La letra U (Uracilo) sustituye a la T en el ARN ARN Gen trascrito a ARN Gen que va a transcribirse Transcripción
  • 2. Transcripción Gracias a los ribosomas, en el citoplasma, la información que lleva el ARN es “leída” por los ribosomas para formar proteínas en el proceso llamado TRADUCCIÓN o SÍNTESIS DE PROTEÍNAS

×