• Share
  • Email
  • Embed
  • Like
  • Save
  • Private Content
Cromosomas y genes
 

Cromosomas y genes

on

  • 72,898 views

Cromosomas y genes.

Cromosomas y genes.

Statistics

Views

Total Views
72,898
Views on SlideShare
46,996
Embed Views
25,902

Actions

Likes
7
Downloads
783
Comments
7

88 Embeds 25,902

http://www.juntadeandalucia.es 11128
http://nidiaesparza-ciencias.blogspot.mx 4272
http://nidiaesparza-ciencias.blogspot.com 2929
http://www.iessuel.es 1271
http://biologaygeologa4eso.blogspot.com 1267
http://averroes.ced.junta-andalucia.es 1117
http://biologaygeologa4eso.blogspot.com.es 974
http://nidiaesparza-ciencias.blogspot.com.es 266
http://nidiaesparza-ciencias.blogspot.com.ar 239
http://portafoliisans.wordpress.com 158
http://biogeo1bach201011.blogspot.com 146
http://cmc-2012-so.blogspot.com 142
http://portafolissaborido.wordpress.com 140
http://iessuel.org 135
http://portafolitcirera.wordpress.com 135
http://cienciaenmiescuela280ms.blogspot.com 130
http://cienciaenmiescuela280ms.blogspot.mx 122
http://biologaygeologa4eso.blogspot.com.ar 119
http://cmc-2012-so.blogspot.com.es 116
http://biologaygeologa4eso.blogspot.mx 104
http://www3.gobiernodecanarias.org 93
http://portafoliasala.wordpress.com 88
http://nidiaesparza-ciencias.blogspot.com.br 82
http://biogeo1bach201011.blogspot.mx 77
http://www.slideshare.net 66
http://aulavirtual.educa.madrid.org 48
http://cmc-2012-so.blogspot.mx 40
http://4esobiologiagaudem.blogspot.com.es 37
http://nidiaesparza-ciencias.blogspot.pt 36
http://miauladeciencias.blogspot.com 34
http://nidiaesparza-ciencias.blogspot.in 33
http://cienciaenmiescuela280ms.blogspot.com.es 31
http://agrega-curso.pntic.mec.es 31
http://127.0.0.1 29
file:// 22
http://www.iessuel.org 21
http://miauladeciencias.blogspot.com.es 20
http://biologiacelularfono.blogspot.com 17
http://miauladeciencias.blogspot.mx 17
http://iessuel.es 16
http://4esobiologialupion.blogspot.com.es 12
http://www.nidiaesparza-ciencias.blogspot.mx 12
http://cienciaenmiescuela280ms.blogspot.com.ar 11
http://biogeo1bach201011.blogspot.com.ar 11
http://biogeo1bach201011.blogspot.com.es 11
http://cienciasadp.w.pw 9
http://ecm-dev.gfi.es 7
http://cmc-2012-so.blogspot.com.ar 6
http://nidiaesparza-ciencias.blogspot.co.uk 5
http://bachillerato.moodlehub.com 4
More...

Accessibility

Categories

Upload Details

Uploaded via as Microsoft PowerPoint

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel

17 of 7 previous next Post a comment

  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
  • @alejithagomez2 ??????
    Are you sure you want to
    Your message goes here
    Processing…
  • pura mentiras no crean eso solo es asen manipularlos
    Are you sure you want to
    Your message goes here
    Processing…
  • hideputas de mierda
    Are you sure you want to
    Your message goes here
    Processing…
  • buuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuu
    Are you sure you want to
    Your message goes here
    Processing…
  • auxilio necesito saber que tipos de cromosomas hay
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

    Cromosomas y genes Cromosomas y genes Presentation Transcript

    • Los cromosomas y los genes Los cromosomas son cadenas de ADN superenrolladas, compuestas por moléculas unidas como las cuentas de un collar. Cada cierto número de cuentas constituye un gen, es decir, un determinado trozo de ADN. Los genes portan la información que permitirá crear un nuevo organismo y la transmiten mediante un código químico. Existen genes para el tamaño, el color, la forma, etc. Cada cromosoma contiene numerosos genes.
    • Los cromosomas y los genes Un gen es un fragmento de ADN que lleva la información para un carácter hereditario. El conjunto de genes que determina todos los caracteres hereditarios de una especie recibe el nombre de genoma .
    • En el ADN están impresas las instrucciones que necesita un ser vivo para nacer y reproducirse.
    • Los cromosomas pueden compararse con un lápiz de memoria, un CD o cualquier otro soporte físico de almacenamiento de datos informáticos. Los datos o archivos (la información), podrían compararse con los genes. Al igual que en un CD o lápiz de memoria caben muchos datos, en los cromosomas hay muchísima información (se calcula que hay unos 100.000 genes en la especie humana).
      • No puede haber datos si no hay un soporte físico.
      • No puede haber genes si no hay ADN.
      • El ADN de los cromosomas es el soporte físico de los genes.
      Shakira.mp3 ……………… Gen responsable del color de ojos Bisbal.mp3 ……………… Gen responsable del color del pelo Foto001.jpg ……………... Gen responsable de la forma de la oreja Cromosoma Archivos Genes Comparación: A.D.N.
    • En nuestra lengua, podemos escribir innumerables palabras, frases, libros… Para ello necesitamos las 28 letras del abecedario: A B C D E F G H … H O L A En el lenguaje genético, con cuatro “letras” se construyen innumerables genes ATTCCGGATCCTAGGCTATA….. Gen color ojos En el lenguaje informático, un archivo es una sucesión de ceros y unos 001010100010101011101000… Shakira.mp3 Ordenando letras construimos palabras Las cuatro “letras del abecedario genético”
    • Si tuviésemos la información contenida en el ADN de los dinosaurios podríamos, al menos en teoría, hacer “resucitar” a estas especies de reptiles extinguidos.
    • Pero dejémonos ahora de dinosaurios y volvamos a los cromosomas. Célula en reposo (sin dividirse) Células en división Los cromosomas se ven al microscopio cuando la célula entra en división Núcleo Cromatina Nucleolo Esta fotografía muestra, al microscopio, células de la epidermis de cebolla en división. Los cuerpos oscuros son los cromosomas.
    • Cuando la célula va a comenzar la división, la cromatina se individualiza y adquiere una forma condensada parecida a un bastón. Núcleo Cromatina Nucleolo La cromatina es como un largo hilo de lana Cromosoma Condensación e individualización de la cromatina Un cromosoma es como un ovillo Este punto es el centrómero Puede transportarse mucho mejor un ovillo de lana que la misma cantidad de lana suelta. Del mismo modo, es mucho mejor para la célula repartir el material genético a las células hijas si la cromatina se ha condensado en cromosomas.
    • Duplicación Cada una de las copias es una cromátida Cromátida 1 Cromátida 2 centrómero Cuando la célula va a comenzar la división, el material genético produce una copia exacta de sí mismo, por lo que en vez de un filamento, contiene dos, llamados cromátidas, que están unidos por el centrómero. En la división celular, el material genético (ADN) se reparte por igual entre las células hijas. Para ello es necesario que, previamente, se halla producido la duplicación de este ADN. División celular . Las células hijas necesitan heredar la información genética de la célula madre.
    • Veamos más cosas importantes que debes saber sobre los cromosomas: En casi todas las células, los cromosomas se observan siempre en parejas . Los dos cromosomas de una pareja reciben el hombre de homólogos . Pareja de homólogos 1 Pareja de homólogos 2
      • El número de parejas de homólogos es siempre el mismo en todas las células de una especie. Por ejemplo:
      • Los seres humanos tenemos 23 parejas (en total: 46 cromosomas)
      • La mosca del vinagre tiene sólo 4 parejas (en total: 8 cromosomas)
      Drosophila melanogaster (mosca del vinagre)
    • Veamos más cosas importantes que debes saber sobre los cromosomas: En casi todas las células, los cromosomas se observan siempre en parejas . Los dos cromosomas de una pareja reciben el hombre de homólogos . Pareja de homólogos 1 Pareja de homólogos 2 Metacéntrico Submetacéntrico Acrocéntrico Es posible ordenar los cromosomas por parejas, ya que los homólogos tienen exactamente la misma forma y el mismo tamaño. Aquí puedes ver los nombres de los tipos de cromosomas según la posición que ocupa el centrómero. Tipos de cromosomas
    • El conjunto de características de los cromosomas de la célula de una especie constituyen el CARIOTIPO . Cuando se ordenan por parejas en un gráfico, este recibe el nombre de CARIOGRAMA Cariotipo humano. En total hay 23 parejas de homólogos. Suele expresarse como 2n = 46 ( n = 23 ) 23 parejas de cromosomas Cromosomas sexuales
    • ¿Cómo se heredan los cromosomas? Normalmente (*), cada célula de nuestro cuerpo tiene un total de 46 cromosomas, o 23 pares. Heredamos la mitad de los cromosomas (un miembro de cada par) de nuestra madre biológica y la otra mitad (el miembro homólogo de cada par) de nuestro padre biológico. Los científicos han enumerado los pares de cromosomas de 1 a 22, habiéndole dado al par 23 el nombre de X o Y, según la estructura. Los primeros 22 pares de cromosomas se llaman " autosomas ". Los cromosomas del par 23 se conocen como los " cromosomas sexuales " porque determinan si el bebé será varón o mujer. Las mujeres tienen dos cromosomas "X" y los hombres tienen un cromosoma "X" y un cromosoma "Y". La representación gráfica de los 46 cromosomas, ordenados en pares, recibe el nombre de cariotipo. El cariotipo normal de la mujer se escribe 46, XX , mientras que el cariotipo normal del hombre se escribe 46, XY . (*) La excepción son los gametos (espermatozoides y óvulos), que tienen la mitad (n) de cromosomas (un cromosoma de cada pareja de homólogos) óvulo espermatozoides 2n n n 2n Célula huevo o cigoto
    • LA HERENCIA DEL SEXO Como ya sabemos el sexo en la especie humana está determinado por los cromosomas sexuales X e Y. Las mujeres son homogaméticas (XX) y los hombres heterogaméticos (XY). Si en el momento de la concepción se unen un óvulo X con un espermatozoide X, el zigoto dará una mujer. Si se unen un óvulo X con un espermatozoide Y, dará una hombre. ♂ Hombre ♀ Mujer XX XY X X Y XX XY (i+5)
    • Las células con 2n cromosomas se dice que son DIPLOIDES Las células con n cromosomas se dice que son HAPLOIDES (del griego diplo = doble ; haplos = simple)