• Share
  • Email
  • Embed
  • Like
  • Private Content
qPCR Design Strategies for Specific Applications
 

qPCR Design Strategies for Specific Applications

on

  • 1,046 views

Species-Specific, Strain-Specific, and CNV Assay Design Considerations

Species-Specific, Strain-Specific, and CNV Assay Design Considerations

Statistics

Views

Total Views
1,046
Views on SlideShare
919
Embed Views
127

Actions

Likes
1
Downloads
45
Comments
0

2 Embeds 127

http://www.scoop.it 116
https://twitter.com 11

Accessibility

Categories

Upload Details

Uploaded via as Microsoft PowerPoint

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment
  • Genes involved in development and stress regulation (temperature and salt responsive genes)

qPCR Design Strategies for Specific Applications qPCR Design Strategies for Specific Applications Presentation Transcript

  • Integrated DNA Technologies Elisabeth Wagner Scientific Applications Specialist qPCR Design Strategies for Specific Applications Species-Specific, Strain-Specific, and CNV Assay Design Considerations
  • 1 Learning Outcomes  You will:  Understand the different types of design specifications for species and splice- form specific qPCR and CNV assays.  Identify design considerations for different experimental scenarios and adjust the basic qPCR design parameters accordingly  Learn how to do an alignment of sequences to discover both unique and similar regions  Learn how to design Copy Number Variations assays
  • 2 General Design Strategy Outline for Specific qPCR Design Parameters: 1. NCBI- sequence accession www.ncbi.nlm.nih.gov 2. Clustal O alignment www.ebi.ac.uk/Tools/msa/clustalo/ 3. Identify common or unique target regions 4. PrimerQuest® Tool www.idtdna.com/scitools 5. NCBI Blast http://blast.ncbi.nlm.nih.gov/Blast.cgi 6. OligoAnalyzer® Tool—for analysis of hairpins/dimers www.idtdna.com/scitools
  • 3 General Design Considerations
  • 4 Primer and Probe Design Criteria  Primers:  Tm: similar Tm (+/- 2°C), 60-62°C  Length: 18-30 bases  GC content: 35-65% (50% ideal), avoid runs of >4 G’s  Sequence: avoid hairpins, dimers (self and hetero)  Avoid SNPs (a single mismatch can alter Tm up to 8°C)  Avoid non-specific primers  Probe:  Tm: 4-10°C higher than primers  Length: <30bp for DLP, longer with ZEN™ (enhanced quenching)  GC content: 30-80%, minimize runs of G  Sequence: avoid G base at 5’ end  Location: sense or antisense  Amplicon:  ~70-200bp
  • 5 Know your Gene  Understand your gene of interest  Transcript variants  Exon organization  SNP locations  NCBI Gene database Your gene of interest here Tfrc
  • 6 Obtain Sequences in FASTA Format- NCBI Nucleotide  Go to NCBI:
  • 7 Obtain Sequences in FASTA Format- NCBI Nucleotide
  • 8 Sequence Alignment (i.e., Clustal Omega)  http://www.ebi.ac.uk/Tools/msa/clustalo/  ClustalO
  • 9 Analyze Alignment Output to Determine Optimal Design Regions Export alignment and save as a word document for easier manipulation
  • 10 Designing to Avoid Genomic DNA Amplification  Design primer across exon-exon junctions  Design primers within 2 adjacent exons spanning a large intron  DNase treatment to eliminate gDNA amplification Decoded 1.3
  • 11 Design Strategy 1: qPCR assay to differentiate between 2 similar genes
  • 12 Sample Design: qPCR Assay to Distinguish RCI2A vs. 2B in Arabidopsis Thaliana
  • 13 1. Clustal O Sequence Alignment: RCI2A vs. RCI2B 1. 2.
  • 14 Target Sequence Entry into PrimerQuest®
  • 15 PrimerQuest® Assay Details: • BLAST each primer pair for target specificity • Check for SNP’s (if applicable/annotated, not necessary here) • OligoAnalyzer- Check primers and probes for dimers/hairpins
  • 16 RCI2B Specific Design Strategy:
  • 17 PrimerQuest® Tool 2. Enter Region of Interest into PrimerQuest® Tool
  • 18 PrimerQuest® Assay Details:
  • 19 PrimerQuest® Assay Details:
  • 20 qPCR Assay to Distinguish RCI2A vs. 2B in Arabidopsis Thaliana • BLAST each primer pair for target specificity, select highly specific assay • Check for SNP’s (if applicable/annotated, not necessary here) • OligoAnalyzer- Check primers and probes for dimers/hairpins RCI2A: Primer F: GAGAGCGTTGGTTTGTACTTTG Tm:62°C Primer R: TGGTTAATGGTGGTCCTGT Tm: 62°C Probe: TGGAAATTGTGTTGCCTTGGTGGA Tm: 68°C RCI2B Primer F: GGTTATCTTCCCGGAATCCTTTA Tm : 62°C Primer R: AATCAGTCCCAAAGGGAGAAG Tm : 62°C Probe: TTTCCTCTTGCTCCTCGAAGAACAGC Tm : 68°C
  • 21 Design Strategy 2: qPCR Assay to Distinguish Between 2 Homologous Microbial Sequences
  • 22 Strain Specific qPCR Design for 2 Helicoverpa NPV Strains Helicoverpa zea single nucleopolyhedrovirus strain—virus that infects earworm, which feeds on plants/crops Obtain sequences of interest from NCBI  >Helicoverpa_zea  CGCCCAAAAATAACGTACTTTTAAACTGGTCTTGGATCATTTCGTTCGAAACGGGCCGTGATCTTTTGTTTCGCTTCGTGACCCAAAAAAAACAAATTACGTCATCGACCAAA GTAAAAATTCTTGCGCATGTTTAAACTAGTCTTGGATATTTTCGTTCGAAACGGGCCGTGATCTTTTGTTTCGCTTCGTGACCCAAAAAAACAAATTACGTCATTCGTTTAAAA TATTGCATCATCTTTAAATTCGAAACCCGCCCGCGCTTTCATATGAAACCGTCGGCGAAGATCGATAAATTTTGTTCTAGAACGTTCGATGGTTTGACCCAAAAAACAAATGA CGTCATATAGCGTGCGTCCAATCACAACACGAATCACGCCTTGTCTAAAGATAACATTTCCCGCGCATGTTTAAACTAATCTTGGATCTTTTCGTTCGAAACGGGCCGTGATC TTTTGTTTCAATTCATGATTTAGAAAAAAACGAACATAAAATTTTACCGCGCATTTTTAAACTAGTGTTGGATTTTTTTTGTTTGAAACGAGCCGTGATCTTTTCGTTCGAAAC GGGCCGTGATCTTTTCGTTCGAAACGGGCCGTGATCTTTTGTTTCGCTGACTCGTGACCCAAAAAAACAAATCACGTCATTCGTTTAGAATATTGCATCATCTTTAAATTCGA AACTCGCCCGCGCTTTCATACGAAACCGCCGGCAAAGATCGGTAAAATTTGTTCTAGAACTTTCCACGGCTTGACCCAAAAAAACAAATGACGTCATATGGCGTGATTTTAA ATCTATTTAATCGTCTCTGGCGTACAAAAGTAAATTACACACGAAACGTGCCATGTTAAGTTTGTTTACAATGAAACTGATTGTGTCGATTTTAATATGGACATAAGATTTTT GCAAAAAAATTCCATTAATCGAACGAATGCGACAATAAACAGTTCGTTTGTTATACCAAATCGAAATGCGTTTGTATATTATTCACAATCCATCAATTCAAAACATGCCTCGT CGACGTCGTTCGCGTACGCATAATTATAATGATCGAACAATTGTTTCAATGAAGTGAAACCGGTT  >Helicoverpa_armigera  AACTGTCTGATCTTTGTTGAAACGGGCCGTGATCTTGTTCGACTCGTGACCAAAAAACAAATGACATCATCGACCAAAAATCCCGCGCATGTTTAAACTAGTCTTGGATCTTT CGTTCAAAACATGACGTAATCTTTCGTTCTACTCGTGACCCAAAAAAACAAATTACGTCATTTGTTTAAATTATTGCATCATCTTTAAATTCAAAACTCGCCCGCGCTTTCATAT AAAACCGTCGGCGAAGATCGATAAAATTTGTTTTAGAACATTCCACGGCTTGACCCAAAAAAACAAATGACGTCATATAGCGTGATTTGAAAATCGTCCAATCACAACACGA ATCACGCCTTGTCTAAAGATAACATTTCCCGCGCATGTTTAAAATAGTCTTGGATCTTTTCGTTCGAAACGGGCCGTGATCTTTTGTTTCGACTTATGATTTAGAAAAAAACG AACATAAAATTTTACCGCGCATTTTTAAACTAGTCTAGGATCTTTTCGTTCAAAACGGGCCGTAATCTTTTGTTCAAAACGGGCCGTAATCTTTTCGTTCGAAACGGGCCGTG ATCTTTTGTTTCGCTGACTCGTGACCCAAAAAAACAAATCACGTCATCCGTTTAGGATATTGCATCATCTTTAAATTCAAAACCCGCCCGCGCTTTCATATGAAACCGTCGGC AAAGATCGGTAAAATTTGTTCTAGAACGTTCCACGGCTTGACCCAAAAAACAAATGACGTCATATGGCGTTTAATCAATCTTTGGCGTACAAAAGTAAATTACACACGAAAC GTGCCATGTTAAGTTTGTTTACAATGAAACTGATTGTGTCGATTTTAATATGGACATAAGATTTTTGCAAAAAAATTCCATTAATCGAACGAAAGCGACAATAAACAGTTCGT TTGTTATACCAAATCGAAATACGTTTGTATATTATTCACAATCCATCAATTCAAAACATGCCTCGTCGACGTCGTTCGCGTACGCATAATTATAATGATCGAACAATTGTTTCA ATGAAGTGAAACCGGTT
  • 23 qPCR Assay to Distinguish Related Viral Strains 11
  • 24 Input the Targeted Design Area into PrimerQuest® Tool PrimerQuest® Tool
  • 25 Adjust Parameters for qPCR (Probe Assay)
  • 26 Use the Custom Design Parameters to Target Probe Area Target the probe region using the Excluded Region List
  • 27 Analyze Potential Assays: • BLAST each primer pair for target specificity, select highly specific assay • Check for SNP’s • OligoAnalyzer- Check primers and probes for dimers/hairpins
  • 28 Probe Specificty- Amigera Strain Specific Design TGGCGTGATTTTAAATCTATTTAA |||| | ||| |||||| TGGCGTTTAATCAATCTTTGGCGT Probe mismatch: Probe won’t be able to bind
  • 29 Repeat Process to Obtain Zea Strain Specific Design Zea (top sequence) Identify unique target region for design
  • 30 Analyze Potential Assays
  • 31 Zea Strain Specific Design In this example, the probe again won’t bind, but also the forward primer has multiple mismatches • BLAST each primer pair for target specificity, select highly specific assay • Check for SNP’s • OligoAnalyzer- Check primers and probes for dimers/hairpins
  • 32 Copy Number Variation (CNV) Assays
  • 33 Designing Assays for Copy Number Variation Estivill and Armengol, (2007) PLOS Genetics  Copy Number Variations (CNVs) are important polymorphisms that can influence the expression of genes within and close to a rearranged region.  This allows for transcription levels to be higher or lower than those that can be achieved by control of transcription of a single gene copy.  CNVs are being associated more and more with genetic diseases such as cancer, neurological disorders, and immune diseases.  PrimeTime® qPCR Assays can be designed to specifically evaluate the copy number of genomic DNA targets.
  • 34 Important Considerations for CNV Designs  1. Design an assay that is within a single exon of the gene of interest  Obtain sequence information for a single exon in NCBI Nucleotide  By accession number or BLAST  Exon information also available in NCBI Gene
  • 35 • BLAST each primer pair for target specificity, select highly specific assay • Use OligoAnalyzer® Tool to check primers and probes for dimers/hairpins • Check for SNPs Input Sequence for a Single Exon Using PrimerQuest® Tool
  • 36 Single Copy Reference- Important for CNV Assays Commonly used examples:  Human- RNaseP Primer F: AGATTTGGACCTGCGAGCG Primer R: GAGCGGCTGTCTCCACAAGT Probe: 5’Hex/TTCTGACCT/ZEN/GAAGGCTCTGCGCG/3IABkFQ/  Mouse- TFRC (or TERT) Primer F: CTAAGTCTACAGTGGCTGTATTCC Primer R: GATCATTGATTTCCCTCATGACAAA Probe: /5HEX/TCGTGGAGA/ZEN/CTACTTCCGTGCTACT/3IABkFQ
  • 37  Questions?