Your SlideShare is downloading. ×
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
6. sesi kesehatan dan obat
Upcoming SlideShare
Loading in...5
×

Thanks for flagging this SlideShare!

Oops! An error has occurred.

×
Saving this for later? Get the SlideShare app to save on your phone or tablet. Read anywhere, anytime – even offline.
Text the download link to your phone
Standard text messaging rates apply

6. sesi kesehatan dan obat

6,075

Published on

1 Comment
0 Likes
Statistics
Notes
  • Be the first to like this

No Downloads
Views
Total Views
6,075
On Slideshare
0
From Embeds
0
Number of Embeds
1
Actions
Shares
0
Downloads
134
Comments
1
Likes
0
Embeds 0
No embeds

Report content
Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
No notes for slide

Transcript

  • 1. ISBN 978-602-98295-0-1 PENGEMBANGAN PERANGKAT LUNAK DIAGNOSA PENYAKIT DIABETES MELLITUS TIPE II BERBASIS TEKNIK KLASIFIKASI DATA Rodiyatul FS1, Bayu Adhi Tama2, Megah Mulya3 1,2,3 Fakultas Ilmu Komputer, Universitas Sriwijaya 1 rodiyatulfs@yahoo.co.id, 2bayu@unsri.ac.id, 3megahmulya@unsri.ac.id ABSTRACT Type-2 of Diabetes Mellitus (Type II DM) is the most common type of diabeteswhose patient about 90-95% of all diabetes population. Early Detection of Type IIDM from various risk factors is a way to prevent the complication that causesmortality. Developing software for diagnosis Type II DM could be utilized as analternative and would enhance medical care for the increasing number of patients.In this paper, the classification technique of data mining with C4.5 algorithmclassifier is employed to acquire valuable information and extract pattern frommedical record data. This pattern is used as knowledge base in medical diagnosisprocess. It absolutely helps doctors and other clinicians for making decisionthrough early detection of Type II DM.Keywords. data mining, Type II DM, diagnosis, software PENDAHULUAN Saat ini penyakit Diabetes Mellitus (DM) Tipe II telah menjadi salah satupenyakit kronik yang paling sering diderita di Indonesia. Berdasarkan survei,diperkirakan pada tahun 2020 akan ada 178 juta penduduk berusia diatas 20tahun memiliki prevelansi terkena DM, suatu jumlah yang besar untuk dapatditangani sendiri oleh para ahli DM [4]. Tingginya angka-angka statistik diatas,tentunya patut diantisipasi oleh pihak penyedia layanan kesehatan seperti rumahsakit untuk mencegah timbulnya ledakan pasien DM. Pada zaman modern ini, banyak rumah sakit telah mengimplementasikanteknologi informasi untuk meningkatkan pelayanan medis dan mengatur datawarehouse Ketersediaan instrumentasi dan informatika medis modern (telemedis)seperti adanya suatu perangkat lunak untuk menunjang keputusan seorang dokterdalam mendiagnosa suatu penyakit sangat dibutuhkan. Teknologi data mininghadir sebagai solusi nyata bagi para pengambil keputusan seperti dokter dalamProsiding Seminar Nasional, 13-14 Desember 2010 1188
  • 2. ISBN 978-602-98295-0-1memprediksi pasien yang beresiko terkena terkena penyakit DM Tipe II. Denganmenerapkan teknik klasifikasi data mining, dapat ditemukan informasi yangberharga pada sekumpulan data yang berukuran besar. TEKNIK KLASIFIKASI DATA MINING Klasifikasi adalah proses penemuan pola atau fungsi yang menjelaskan danmembedakan konsep atau kelas data dengan tujuan untuk dapat memprediksikelas dari suatu objek yang labelnya tidak diketahui[3]. Konsep klasifikasi denganpengawasan (supervised classification) adalah untuk membangun sebuah modeldari data yang telah diketahui, atau sering disebut sebagai classifier. Model ataufungsi ini kemudian dapat digunakan untuk memetakan data didalam suatu basisdata kepada suatu atribut target, selanjutnya dapat memperkirakan suatu kelasdari data yang baru Tiap rekord berisi banyak atribut dimana masing-masing atribut memiliki satudari beberapa kemungkinan nilai. Di dalam klasifikasi diberikan sejumlah rekordyang dinamakan sekumpulan data latih yang terdiri dari beberapa atribut, dimanasalah satu atribut menunjukkan kelas untuk rekord. ALGORITMA KLASIFIKASI DATA MINING Pada paper ini digunakan algoritma klasifikasi C4.5 yang melakukanpemilihan atribut terbaik berdasarkan informasi gain. Atribut dengan informasigain tertinggi akan dipilih untuk membuat keputusan. Informasi gain merupakanselisih antara kebutuhan informasi awal (yang hanya bergantung pada jumlah danproporsi tiap kelas di dalam D) dan kebutuhan informasi baru (yang diperolehsetelah melakukan partisi terhadap atribut A). Untuk menghitung gain, digunakanrumus : Gain (A) = Info (D) - InfoA (D)Informasi yg dibutuhkan untuk mengklasifikasi sebuah rekord di D diberikandengan rumus berikut.Prosiding Seminar Nasional, 13-14 Desember 2010 1189
  • 3. ISBN 978-602-98295-0-1 m Info (D)    i 1 pi Log2 (pi) Informasi yg dibutuhkan untuk mengklasifikasi sebuah rekord di D diberikandengan rumus berikut berdasarkan hasil partisi di A. v | Dj | Info A (D)   | D | x Info (D ) j 1 j Psedeucode algoritma C4.5 untuk membangun pohon keputusan adalahsebagai berikut [7] : 1. Cek Sekumpulan Data Latih 2. Pada masing-masing attribut a, hitung informasi gain 3. Ubah a terbaik ( dengan informasi gain tertinggi) menjadi akar 4. Buat simpul keputusan yang berakar dari a terbaik 5. Ulangi proses untuk masing-masing cabang dengan memilih a terbaik berikutnya dan jadikan anak dibawah simpul keputusan terakhir. ANALISIS1. Data Preparation Data utama yang digunakan pada penelitian ini berupa sekumpulan datarekam medis pasien rawat inap RSMH Palembang untuk penyakit DiabetesMellitus Tipe 2 sepanjang tahun 2008 yang berjumlah 435 instances.2. Pembangkitan dan Pengujian Model Klasifikasi Sebelum pembangkitkan model klasifikasi berupa 39 rules, dibentuk sebuahpohon keputusan menggunakan algoritma C4.5. Untuk menguji tingkat akurasimodel klasifikasi digunakan pengujian kualitatif dengan mewawancara dua dokteruntuk mengetahui seberapa besar user-acceptance terhadap model klasifikasi.Dari hasil penilaian, didapatkan 34 rules yang sesuai dengan standar penegakandiagnosa WHO dan PERKENI (Perkumpulan Endokrinologi Indonesia). DisampingProsiding Seminar Nasional, 13-14 Desember 2010 1190
  • 4. ISBN 978-602-98295-0-1itu, dilakukan juga pengujian kuantitatif dengan menggunakan metode confusionmatrix yang menghasilkan tingkat akurasi model sebesar 95,63%.3. Hasil dan Pembahasan Hasil implementasi perangkat lunak dapat dilihat pada beberapa tampilanberikut : Gambar 4.1 Form Pembangkitan Model Pohon Berdasarkan hasil pembangkitan model klasifikasi, maka dapat dilihat bahwaplasmainsulin memiliki gain ratio yang paling tinggi, oleh karena itu atribut inipaling berpengaruh terhadap penyakit diabetes mellitus tipe IIProsiding Seminar Nasional, 13-14 Desember 2010 1191
  • 5. ISBN 978-602-98295-0-1 Gambar 4.2 Form Pembangkitan Model Klasifikasi Gambar 4.3 Form Pengujian Model KlasifikasiProsiding Seminar Nasional, 13-14 Desember 2010 1192
  • 6. ISBN 978-602-98295-0-1 Gambar 4.4 Form Proses Diagnosa KESIMPULAN DAN SARAN Melalui teknik klasifikasi data mining yang digunakan, paper ini telah berhasilmengumpulkan dan menganalisa data rekam medis pasien diabetes mellitus tipeII, dan menghasilkan beberapa rules yang dapat digunakan pihak rumah sakitdalam pengambilan keputusan di bidang kesehatan, khususnya dalammendiagnosa penyakit diabetes mellitus tipe II. Kuantitas training data yang digunakan sebaiknya ditambah untuk mengekstrakkemungkinan munculnya tambahan informasi bernilai lainnya. Disamping itu,sebaiknya dilakukan penelitian lanjutan dengan membandingkan algoritmaklasifikasi yang lain pada proses pembangkitan model klasifikasi sehinggadihasilkan performance yang lebih baik.Prosiding Seminar Nasional, 13-14 Desember 2010 1193
  • 7. ISBN 978-602-98295-0-1 DAFTAR PUSTAKAAmerican Diabetes Association. 2004. Diagnosis and Classification of Diabetes Mellitus. American Journal of Diabetes Care. 27. S5-S10Bramer, Max. Principles of Data Mining, Springer-Verlag London Limited, 2007.Han, J., et al. Data Mining: Concepts and Techniques 2nd Edition, Morgan Kaufmann Publisher, 2006.Indah. 2009. [Online] Tersedia: www.indahmuhariani.com/index.php /2009/02/01. [ diakses terakhir tanggal 10 Februari 2009]Larose, D.T. 2005. Discovering Knowledge in Data : An Introduction to Data Mining. John Wiley & Sons, Inc, New Jersey.Palaniappan, S. and R.Awang. 2008. Intelligent Heart Disease Prediction System Using Data Mining Techniques. International Journal of Computer Sciences and Network security. 8 (8), 343-350.Quinlan.2009.C4.5 Algorithm. [Online] Tersedia : http://en.wikipedia.org/wiki /C4.5_algorithm. [10 Februari 2009]Witten, Ian H. And Eibe Frank. Data Mining: Practical Machine Learning Tools and Techniques 2nd Edition, Morgan Kaufmann Publisher, 2005.World Health Organization. 2002. Laboratory Diagnosis and Monitoring of Diabetes Mellitus. WHO Publication, Switzerland.Prosiding Seminar Nasional, 13-14 Desember 2010 1194
  • 8. ISBN 978-602-98295-0-1 PENGALAMAN MANTAN PENGGUNA DALAM PENYALAHGUNAAN NAPZA SUNTIK DI KOTA PALEMBANG ( Studi Fenomenologi ) Budi Santoso Jurusan Keperawatan Politeknik Kesehatan Palembang Email : sant.budi75@yahoo.com ABSTRACT Drugs injects abuse is abnormal behavior that trespass norm in community.Drugs injects also trigger main problem to individual, family, community andcountries. Until now drugs injects abuse tend to difficult to stopped. Manyprevention of effort and eradiction of drugs haved conducted, but drugs injectsabuse still increase, reffered to in case in Palembang. This studi was aimed toprovide dept understanding and meaning of former user‘s experience in drugsinjects abuse in Palembang. This study was descriptive phenomenology designwith purposive sampling in depth interview and fieldnote for data collecting. Resultof interview was recorded in tape recorder, then transcribed and analyzed withCollaizi‘s method. The resulth of study identified 9 themes as spesific goal is :reason to use drugs injects to classification reason in first time and to continuesuse drugs injects; drugs injects use of respon is individual respon and parentrespon; perception related to impact efect andmore value, negative impact,meaning in use, meaning after recovered, the aother support. This studyconclution that drugs injects abuse have to prevent and early treatment. The nursespecialist community as proffesional in health rule in primary, secondary, andtertier of prevent to drugs injects abuse.Keyword : former user‘s, drugs injects, phenomenology PENDAHULUAN Narkotika, Psikotropika dan Zat adiktif lainnya (NAPZA) secara luasdiketahui sebagai salah satu ancaman paling mengkhawatirkan bagi masyarakat,khususnya generasi muda di lebih 100 negara di dunia ( Asian Harm ReductionNetwork (AHRN, 2001). Berbagai survei menunjukan bahwa NAPZA merupakanancaman bagi kelompok usia muda dan produktif (Badan Narkotika Nasional(BNN), 2006). Penyalahgunaan NAPZA tidak hanya menimbulkan penyimpanganperilaku yang menyalahi norma yang berlaku di masyarakat, namun juga memicumasalah utama yang memberi efek negatif terhadap fungsi organ tubuh (Syarief,Prosiding Seminar Nasional, 13-14 Desember 2010 1195
  • 9. ISBN 978-602-98295-0-12008). Menurut Banks dan Waller (1983, dalam Hawari, 2001) penyalahgunaanNAPZA mengakibatkan komplikasi medik berupa gangguan pernafasan yaituedema paru dan gangguan lever. Walaupun bahaya penyalahgunaan NAPZAsudah sering disosialisasikan, namun masih banyak masyarakat yang tidakmempedulikannya, sehingga jumlah pengguna NAPZA terus meningkat. Jumlah penyalahguna NAPZA, terutama penyalahguna NAPZA suntikmengalami peningkatan yang fantasitis. Berdasarkan survei di 10 kota besar diIndonesia terhadap penyalahguna NAPZA di masyarakat dengan respondenberjumlah 956 orang didapatkan bahwa 56% atau sekitar 572 respondenmerupakan penyalahguna NAPZA suntik (BNN, 2007). Kecenderunganpeningkatan jumlah penyalahguna NAPZA dari tahun ke tahun dengan berbagaijenis dan cara, termasuk melalui suntikan. Berdasarkan data AHRN (2003), jumlahIDU (Injection Drug User) di Indonesia diperkirakan sekitar 30.000 hingga 40.000orang pada tahun 1997, dan pada tahun menyebutkan bahwa sejak tahun 2002sampai November 2008, penderita HIV/AIDS berjumlah 401 orang, 20 %diantaranya penyalahguna NAPZA suntik. Hal ini mengindikasikan bahwapenyalahguna NAPZA suntik merupakan penyumbang terbesar penularanHIV/AIDS. Besarnya angka di atas menunjukkan tingginya epidemi HIV di kalanganIDU yang perlu mendapat perhatian serius dari berbagai kalangan. Penelitimemandang penyalahguna NAPZA suntik sebagai kelompok yang mempunyairisiko tinggi untuk mengalami berbagai masalah kesehatan baik fisik maupunpsikologis, khususnya terinfeksi HIV/AIDS. Masalah kelompok ini tidak hanyaberdampak pada kelompok itu sendiri, tetapi juga pada masyarakat di sekitarnya(Husaini, 2006). Masalah ini merupakan ancaman yang serius bagi masa depanpenyalahguna NAPZA dan membahayakan bagi kelangsungan hidup bangsa dannegara. Perawat komunitas sebagai bagian dari profesi kesehatan, memilikitanggung jawab untuk berperan aktif dalam meningkatkan perilaku hidup sehatmasyarakat. Perawat komunitas memiliki peran untuk membantu komunitaspenyalahguna NAPZA suntik untuk secara bertahap berhenti mengkonsumsiNAPZA secara total melalui usaha-usaha promosi kesehatan. Pender, Murdaugdan Parsons (2002) menyebutkan bahwa perawat komunitas dalam menyusunProsiding Seminar Nasional, 13-14 Desember 2010 1196
  • 10. ISBN 978-602-98295-0-1program anti NAPZA perlu memperhatikan respon-respon individu terhadapsituasi sosial yang melingkupinya seperti pergaulan bebas, gaya hidup, danperaturan pemerintah tentang program penanggulangan NAPZA. Namun belumbanyak tereksplorasi perilaku tersebut dalam perspektif keperawatan komunitas,sehingga upaya antisipasi dirasakan belum optimal. Peneliti akan berupaya untuk memahami dan memaknai gambaranpengalaman mantan pengguna dalam penyalahgunaan NAPZA suntikmenggunakan pendekatan fenomenologi deskriptif. Penelitian bertujuan untukmendapatkan gambaran mengenai arti dan makna pengalaman mantanpengguna dalam penyalahgunaan NAPZA suntik di kota Palembang. Penelitimengidentifikasi alasan menggunakan NAPZA suntik, respon yang timbul setelahmenggunakan NAPZA suntik, persepsi terkait efek samping dan bahaya NAPZAsuntik, makna menggunakan NAPZA suntik, dan dukungan dari pihak terkait. METODE PENELITIAN Desain yang digunakan pada penelitian ini adalah fenomenologi deskriptif.Tiga langkah dalam proses fenomenologi deskriptif, yaitu intuiting, analyzing dandescribing seperti yang diungkapkan oleh Spiegelberg (1975 dalam Streubert &Carpenter,1999). Metode yang digunakan adalah metode Collaizi yang memiliki 9tahap (1978, dalam Streubert & Carpenter,1999). Populasi penelitian yang diteliti adalah mantan pengguna NAPZA suntik dikota Palembang. Pengambilan sampel pada penelitian ini dengan menggunakanteknik purposive sampling yang merupakan pemilihan secara sadar oleh penelititerhadap subjek/elemen tertentu untuk dimasukkan dalam penelitian. Penelitian initersaturasi pada partisipan ke-7 dimana tidak ada lagi kategori atau tema yangdidapatkan. HASIL Partisipan dalam penelitian ini berjumlah 7 mantan pengguna yang beradadi kota Palembang. Keseluruhan partisipan adalah laki-laki dengan rentang usiaantara 19 sampai dengan 34 tahun dan bertempat tinggal di Kota Palembang.Prosiding Seminar Nasional, 13-14 Desember 2010 1197
  • 11. ISBN 978-602-98295-0-1Tingkat pendidikan partisipan bervariasi dari sekolah menengah umum sampaisarjana. Tiga partisipan berstatus menikah dan empat orang lainnya masih lajang.Status pekerjaan ada yang belum bekerja dan bekerja di sektor swasta. Usiapertama kali menyalahgunakan NAPZA bervariasi dari mulai usia 13 sampai 17tahun. Jenis NAPZA yang pertama disalahgunakan 4 partisipan jenis ganja, 2partisipan jenis putaw dan 1 partisipan jenis ineks. Lama mengggunakan NAPZAsuntik bervariasi dari mulai 2 bulan sampai 10 tahun. Penelitian ini menghaslkan 9 tema sesuai tujuan khusus yaitu : alasanmenggunakan NAPZA suntik tergambar dalam dua tema yaitu alasan pertamakalimenggunakan dan alasan tetap menggunakan; respon yang timbul setelahmenggunakan NAPZA suntik teridentifikasi dalam dua tema yaitu respon personaldan respon orang tua; persepsi terkait efek samping dan bahaya NAPZA suntiktergambar dalam dua tema yaitu mempunyai nilai lebih dan.mempunyai dampakburuk; makna yang tergali dari partisipan yaitu makna selama menggunakan danmakna setelah sembuh; dan harapan terhadap dukungan pihak terkaitmemunculkan tema dukungan terhadap kepolisian, petugas kesehatan danpemerinah daerah. PEMBAHASAN Alasan pertama kali menggunakan NAPZA suntik yang teridentifikasi yaitualasan utama dan alasan penunjang. Alasan utama bersumber dari lingkungansekolah yaitu pengaruh teman. Lingkungan sekolah merupakan tempatbertemunya partisipan dengan teman sebayanya, sehingga pengaruh temanmenimbulkan keinginan individu bukan pengguna mengikuti ajakan teman untukmenggunakan NAPZA suntik. Hasil penelitian ini sesuai dengan hasil penelitianTasman (2005) bahwa lingkungan teman sebaya sangat berpengaruh terhadaprisiko penyalahgunaan NAPZA. Hasil penelitian ini juga memperkuat hasilpenelitian Hawari (1990) dan Martono (2008) yang menyebutkan bahwa faktorpenyebab remaja menyalahgunakan NAPZA adalah akibat pengaruh/bujukanteman (peer group) atau berteman dengan penyalahguna NAPZA serta adanyatekanan atau ancaman dari teman. Hal ini juga sesuai dengan pendapat Joewana(2005) bahwa kebutuhan akan pergaulan dengan teman sebaya mendorongProsiding Seminar Nasional, 13-14 Desember 2010 1198
  • 12. ISBN 978-602-98295-0-1remaja untuk dapat diterima sepenuhnya dalam kelompoknya. NAPZA dapatmeningkatkan atau mempermudah interaksi remaja dengan kelompok sebayanya(vehicle of social interaction). Alasan tetap menggunakan NAPZA suntik yang teridentifikasi padapenelitian ini adalah aksesibilitas obat, coba-coba, masalah keluarga, danekonomis. Alasan aksesibilitas obat yaitu kemudahan akses terhadap obat daninformasi. Kemudahan akses terjadi karena kurangnya pengawasan yang selektif,dengan membiarkan NAPZA beredar dilingkungan masyarakat, khususnyalingkungan sekolah ditambah kemudahan mengakses informasi juga menjadialasan partisipan mengunakan NAPZA. Hal ini sesuai dengan pendapat Martono(2006) dan Hikmat (2008) bahwa lingkungan sekolah seperti sekolah terletakdekat tempat hiburan, pembinaan dari sekolah yang kurang maksimal sepertikurang disiplin, sekolah yang kurang memberi kesempatan pada siswa untukmengembangkan diri secara kreatif dan positif merupakan faktor penyebab remajamenyalahgunakan NAPZA. Respon personal yang ditemukan adalah pengetahun tentang NAPZA,perubahan yang terjadi, upaya mengatasi, kambuh, faktor pendukung berhentidan nilai NAPZA. Respon pengetahuan tentang NAPZA yaitu ketidaktahuantentang manfaat, bahaya dan risiko penyalahgunaan NAPZA. Pada proses awalpenyalahgunaan NAPZA suntik hampir semua partisipan tidak mengetahuimanfaat, bahaya dan risikonya. Hal ini disebabkan karena keterbatasan informasitentang NAPZA suntik. Hal ini sesuai dengan hasil penelitian Rahayuwati (2006)tentang pengetahuan dan sikap tentang hubungan narkoba dengan kejadianHIV/AIDS (studi kualitatif pada SMP di Bandung ) yang menyebutkan bahwahampir semua responden tidak mempunyai informasi yang memadai tentangnarkoba. Respon orang tua yang teridentifikasi yaitu perasaan. Perasaanemosional meliputi kecewa, terpukul dan syok. Hal ini sesuai dengan pendapatHikmat (2008) bahwa orang tua akan merasa malu, merasa bersalah, sedih,marah, dan putus asa karena memiliki anak sebagai pengguna NAPZA. Persepsi efek samping yang dirasakan mantan pengguna adalahmempunyai nilai lebih yaitu perasaan, ekonomis dan proses kerja obat. Efeksamping terhadap perasaan yaitu meningkatkan kenyamanan fisik dan pikiran. Halini sesuai dengan pendapat Joewana (2005) yang menyatakan NAPZA suntikProsiding Seminar Nasional, 13-14 Desember 2010 1199
  • 13. ISBN 978-602-98295-0-1jenis heroin (putaw) banyak dikonsumsi dengan alasan untuk dinikmati atau untukmengatasi perasaan yang tidak enak ( ketegangan, kecemasan dan kesedihan).Keberadaan efek samping yang dirasakan saat menggunakan NAPZA suntik baiksedikit maupun banyak, menyebabkan individu akan terus menggunakan NAPZAsuntik. Hal ini sesuai dengan teori Health Belief Model dari Becker (1977, dalamPender, Murdaug, & Parsons, 2002) yang menyebutkan bahwa adanya persepsiefek samping yang menguntungkan akan mendorong individu untuk terusmempertahankan suatu perilaku tertentu. Selain meningkatkan kenyamanan fisikdan pikiran, NAPZA juga mempunyai efek samping ekonomis dan proses kerjaobat lebih cepat. Persepsi bahaya yang dirasakan oleh mantan pengguna adalahmempunyai dampak buruk terhadap kesehatan fisik yaitu menularkan penyakitHIV/AIDS dan Hepatitis. Studi ini menemukan dua partisipan yang sudah terinfeksiHIV. Hal ini sesuai dengan pernyataan Martono (2006) menyebutkan bahwadampak penyalahgunaan NAPZA yang paling membahayakan adalah terinfeksiHIV/AIDS akibat penggunaan jarum suntik tidak steril dan bergantian. Hal inididukung oleh pendapat Costigan (1999) bahwa dampak buruk terhadap masalahkesehatan akibat penggunaan NAPZA suntik dalam jangka panjang adalahpembuluh darah mengempis, abses, tetanus, hepatitis B dan C, jantung, paru,sembelit dan ditingkat komunitas terjadi epidemi HIV. Makna menyakitkan yang teridentifikasi yaitu perasaan sedih, sakit hati,hancur dan susah. Studi ini mengungkap hampir semua partisipan mengatakanbahwa sampai detik ini masih banyak masyarakat memandang seorang penggunaatau mantan pengguna NAPZA dengan pandangan yang negatif, memperlakukanpengguna dan mantan pengguna dengan tidak manusiawi. Seorang partisipanmengatakan bahwa seorang terlibat menyalahgunakan NAPZA itu harus dilihatapa alasannya, apa latar belakangnya, sehingga tidak membuat kesimpulanbahwa seorang pengguna itu semuanya sama. Hal ini sesuai dengan pendapatJoewana (2005) secara sosiokultural, penggunaan zat psikoaktif dipandangsebagai suatu fenomena kultural, penggunaan zat psikoaktif dapat dipandangsebagai suatu perilaku yang normal atau perilaku yang menyimpang, bergantungsiapa yang menggunakan, jenis zat yang digunakan, banyaknya (sampaiintoksikasi atau tidak) dan dalam setting apa.Prosiding Seminar Nasional, 13-14 Desember 2010 1200
  • 14. ISBN 978-602-98295-0-1 Makna setelah sembuh yang teridentifikasi yaitu mempengaruhi sikap,pengetahuan terhadap NAPZA, sebagai petunjuk dan mempunyai cita – cita.Sikap lebih manusiawi dan berempati dalam bekerja merupakan makna yangtersirat dalam diri partisipan, sehingga partisipan akan berbuat dan bertindak lebihbaik dari sebelumnya. Makna pengetahuan terhadap NAPZA tentang efeksamping dan bahayanya merupakan suatu proses belajar pada taraf intelektual(cognitive learning), informasi yang didapatkan merupakan modal dasar bagipartisipan untuk memberkan informasi lebih baik lagi. Selain itu makna sebagaipetunjuk merupakan sarana meningkatkan keimanan bagi partisipan. Dukungan pihak kepolisian yaitu target dan upaya yang dilakukan harustepat target dan upaya. Hal ini sejalan dengan tugas pihak kepolisian yang bekerjasama dengan BNN dalam melaksanakan tugasnya menggunakan strategikerjasama internasional, meningkatkan peran serta masyarakat dan penegakanhukum dengan mengembangkan pelayanan terapi dan rehabilitasi sertamenggalakkan komunikasi, informasi dan edukasi kepada masyarakat. Dukungan terhadap petugas kesehatan yaitu pelayanan yang profesionaldan metode pengobatan yang variatif. Mantan pengguna berdasarkanpengalamannya ingin diberikan pelayanan yang optimal dengan tidak membeda-bedakan atau mendiskriminasikan pengguna NAPZA dengan pasien lainnya. Halini memang sesuai dengan sumpah profesi seorang petugas kesehatankhususnya tenaga keperawatan bahwa dalam memberikan pelayanan kepadapasien tidak membeda-bedakan pangkat, kedudukan dan golongan. Fakta daribeberapa partisipan masih mengeluhkan pelayanan yang diberikan oleh petugaskesehatan, apalagi pelayanan kepada mantan pengguna NAPZA. Dukungan dari pemerintah yaitu segi fasilitas agar lebih care dan adaalternatif, Mantan pengguna mempunyai harapan tehadap pemerintah agarmengembangkan program penanggulangan penyalahgunaan NAPZA denganberbagai program alternatif, fasilitas yang lengkap sehingga pengguna yangmempunyai keinginan berhenti mempunyai pilihan untuk pengobatannya. Hal inisesuai dengan Inpres No.3 tahun 2002 dan Keppres No.17 tahun 2002 tentangtugas BNN yaitu mengkoordinasikan instansi pemerintah terkait dalampenyusunan kebijakan dan pelaksanaannya dibidang pencegahan, ketersediaanProsiding Seminar Nasional, 13-14 Desember 2010 1201
  • 15. ISBN 978-602-98295-0-1dan pemberantasan penyalahgunaan dan peredaran gelap narkotika, psikotropika,prekusor dan zat adiktif lainnya. KESIMPULANPenelitian ini mengungkap alasan mantan pengguna tetap menggunakan NAPZAsuntik didasarkan oleh rasa ingin tahu, informasi yang menantang dan tidaklengkap dan kebutuhan terhadap NAPZA. Alasan menggunakan NAPZA suntikmencerminkan kuatnya pengaruh teman sebaya terhadap pembentukan persepsipengguna terhadap NAPZA suntik. Selain itu dukungan petugas kesehatan yaitupelayanan yang profesional dan variatif dengan pelayanan yang optimal dengantidak membeda-bedakan atau mendiskriminasikan pengguna NAPZA denganpasien lainnya. Dukungan pemerintah daerah terhadap fasilitas agar lebih caredan ada alternatif, pemerintah harus menyediakan fasilitas yang lengkap sehinggapengguna yang mempunyai keinginan berhenti mempunyai pilihan untukpengobatannya. SARANSaran untuk pengambil kebijakan yaitu perlunya media promosi yang dapatmemberikan informasi lengkap dan dapat dipahami oleh masyarakat khususnyaremaja, misalnya informasi penyalahgunaan NAPZA disertai dengan gambarakibat penyalahgunaan NAPZA tersebut. Untuk pelayanan keperawatan perlupeningkatan kompetensi perawat komunitas dalam penyusunan programpencegahan dan penanggulangan NAPZA melalui pendidikan dan pelatihantentang teknik penyusunan program keperawatan komunitas. Penelitian lebih lanjut yaitu studi fenomenologi pengalaman mantanpengguna NAPZA selama menjalani proses rehabilitasi,studi fenomenologipengalaman mantan pengguna dalam upaya berhenti menyalahgunakan NAPZAsuntik, Untuk membandingkan dengan hasil penelitian ini perlu juga diteliti lebihlanjut dengan metode dan partisipan yang berbeda, misalnya partisipanperempuan.Prosiding Seminar Nasional, 13-14 Desember 2010 1202
  • 16. ISBN 978-602-98295-0-1 DAFTAR PUSTAKAAbdul, R.D. (2005). Voicing Concern " Tobacco, Alcohol and Drugs of Abuse ". Malaysia : Universitas Sains Malaysia.AHRN/WHO. (2001). Survey Penyalahgunaan NAPZA di Indonesia. Jakarta : AHRN.AHRN/WHO. (2003). Buku Panduan untuk Pencegahan HIV yang Efektif Diantara Pengguna NAPZA. Jakarta : AHRN.Badan Narkotika Nasional Republik Indonesia. (2002). Kebijakan dan Strategi Badan Narkotika Nasional dalam Pencegahan dan Pemberantasan Penyalahgunaan dan Peredaran Gelap Narkoba. Jakarta: BNN.Badan Narkotika Nasional Republik Indonesia. (2006). Hasil Survei penyalahgunaan NAPZA pada kelompok pelajar dan mahasiswa di Indonesia tahun 2006. Jakarta: Puslitbang dan Info Lakhar BNN.Badan Narkotika Nasional Republik Indonesia. (2008). Survey Ekonomi akibat Penyalahgunaan dan Peredaran Gelap Narkoba di Indonesia. Jakarta: Puslitbang dan Info Lakhar BNNBadan Narkotika Kota Palembang. (2008). Laporan Tahunan Badan Narkotika Kota Palembang Tahun 2008. Palembang : BNK.Creswell, J.W. (1998). Qualitative Inquiri and Research design : choosing among (5th Ed.), United Status America (USA): Sage Publication Inc.Costigan G,.(1999). NAPZA dan Epidemi HIV di Indonesia. Jakarta : UNAIDSDanielson, C.B, et al. (1993). Families, Health and Illness: Perspective and Coping Intervention. St. Louis: Mosby Year Book.Deany, P.,(2000). HIV and Injecting Drug User : A new Challenge to Sustainable Human Development, http://www.who.int/HIV-AIDS/HIV-IDU/html. diperoleh tanggal 7 Februari 2009.Depkes RI (2001). Data Kasus HIV/AIDS di Indonesia. Jakarta. AHRN Indonesia.Depkes RI (2001). Buku Pedoman Praktis Bagi Petugas Kesehatan Mengenai Penyalahgunaan Narkotika, Psikotropika dan Zat adiktif lainnya (NAPZA). Jakarta.Depkes (2005) Kebijakan dan Program Pencegahan & Penanggulangan NAPZA. JakartaProsiding Seminar Nasional, 13-14 Desember 2010 1203
  • 17. ISBN 978-602-98295-0-1Dinas Kesehatan Kota Palembang (2008). Laporan Tahunan Dinas Kesehatan Kota Palembang Tahun 2008, Palembang.Friedman, et al. (2003). Family Nursing: Research, Theory and Practice. (Fifth Edition). New Jersey: Prentice Hall.Hawari, Dadang. (1991). Penyalahgunaan Narkotika dan Zat Adiktif. Jakarta : Fakultas Kedokteran Universitas IndonesiaHawari, Dadang. (2000). Terapi (Detoksifikasi) dan Rehabilitasi (Pesantren) Mutakhir (Sistem Terpadu) Pasien "NAZA" (Narkotika, Alkohol, dan Zat Adiktif lainnya). Jakarta. UI-PressHawari, Dadang. (2001). Penyalahgunaan dan Ketergantungan NAZA, Jakarta : Fakultas Kedokteran Universitas IndonesiaHawari, Dadang.(2002). Penyalahgunaan NAZA. Jakarta : Fakultas Kedokteran Universitas IndonesiaHelvie.C.O.(1998). Advanced Practice Nursing in The Community, Sage Publications Thousand Oaks London. New DelhiHikmat (2008). Generasi Muda : Awas Narkoba. Bandung : AlphabetaHitchcock,JE., Scubert, PE., & Thomas, SA (1999). Community Health Nursing : Caring in action. USA : Delmar PublisherHusaini, A.(2006). Rokok : Pintu Gerbang Narkoba. Jakarta : Pustaka ImanJangkar.net. (2003). Lokakarya Penanggulangan HIV/AIDS pada Kelompok Penyalahguna Narkoba Suntik bagi Kepolisian. diakses dari http :// www. Jangkar.net/workshop / detailrep.asp? = TOR Police & view, tanggal 1 April 2009Joewana, Satya. (2005). Gangguan Mental dan Perilaku akibat Penggunaan Zat Psikoaktif (Penyalahgunaan NAPZA/Narkoba). Jakarta: EGCKamil, Oktavery. (2004). Pencegahan HIV/AIDS pada Kelompok Pengguna Narkoba Suntik. Tesis.FISIP-UI (Tidak Dipublikasikan).Komisi Penanggulangan AIDS. (2007). ODHA dan Pelayanan Kesehatan Dasar. Jakarta. UNAIDSMartono, L.J., (2006). Pencegahan dan Penanggulangan Narkoba di Sekolah. Jakarta : PT. Rosda KaryaMc.Murray, A. (2003). Community Health and Wellness : a Sociological approach. Toronto : MosbyProsiding Seminar Nasional, 13-14 Desember 2010 1204
  • 18. ISBN 978-602-98295-0-1Moleong, L.J., ( 2004). Metodologi Penelitian Kualitatif. Bandung : PT Remaja RosdakaryaPatton. (1990). Qualitative Evalution and Research Methods. Newbury Park,CA: SagePender, N.J, Murdaug, C.L., & Parsons, M.A. (2002). Health promotion in nursing practice. 4th ed. Upper Saddle River: Prentice HallPoerwandari, E.K. (1998) Pendekatan Kualitatif Dalam Penelitian Psikologi. . Jakarta : LPSP3. Fakultas Psikologi Universitas IndonesiaPoerwandari, E.K. (2007). Pendekatan Kualitatif untuk Penelitian Perilaku Manusia. Jakarta : LPSP3. Fakultas Psikologi Universitas IndonesiaPolit,D.F., Beck, C.T., & Hungler,B.P. (2001). Essensial of Nursing Research: Methods, Appraisal and Utilization. St.Louis: Mosby Year Book Inc.Pusat Penelitian Kesehatan Universitas Indonesia (PPK UI). (2002) Hasil Studi Kualitatif pada Kelompok IDU Wanita di Jakarta,Surabaya dan Bandung. JakartaRiehman, Karas (1996). Injecting Drug Use and AIDS in Developing Countries : Determinant and Issues for Policy Consideration, paper prepared for The Policy Research Report on AIDS and Development, World Bank, Policy Research Departement.Sarasvita, et al. (2000). Napza dan Kita : Laporan Rapid Assesment and Response On Injection Drug Users. Tim Jakarta ; 61 hlmSpiegelberg, H. (1978). The Phenomenological Movement: a Historical Introduction. The Hague: Matinus Nijhoff.Streubert, H.J.& Carpenter,D.R. (1999). Qualitative Research in Nursing : Advancing the Humanistic Imperative. Philadelphia : LippincottSyarief, Fatimah. (2008). Bahaya Narkoba di Kalangan Pemuda. JakartaTasman (2005). Hubungan Lingkungan Eksternal Remaja dengan Risiko Penyalahgunaan NAPZA pada siswa di SMA/SMK kec. Beji Depok : Thesis Program Magister Ilmu Keperawatan FIK-UI : tidak dipublikasikanUNAIDS/ WHO (2003), AIDS Epidemisc Update, UNAIDS ; 39 hlmProsiding Seminar Nasional, 13-14 Desember 2010 1205
  • 19. ISBN 978-602-98295-0-1 HUBUNGAN KARAKTERISTIK PEKERJA, PENGGUNAAN APD DAN LAMA KERJA DENGAN KEJADIAN ANEMIA PADA PEKERJA DI STASIUN PENGISIAN BAHAN BAKAR UMUM (SPBU) PALEMBANG TAHUN 2009 Nurhayati Ramli 1), Diah Navianti 1), M.Ihsan Tarmizi 1), Ummi kaltsum 2) 1) Dosen Jurusan Analis Kesehatan Poltekkes kementrian kesehatan Palembang 2) . Staf Laboratorium klinik Prodia Palembang ABSTRAK Timah hitam atau lebih dikenal dengan sebutan timbal biasa digunakansebagai campuran bahan bakar bensin yang dijual hampir di setiap StasiunPompa Bensin Umum (SPBU) di Palembang. Sebagian besar kendaraanbermotor di Palembang masih menggunakan bensin bertimbal. Bensin bertimbalini merupakan salah satu faktor yang dapat menyebabkan kejadian anemiakhususnya bagi pekerja SPBU yang telah bekerja dalam jangka waktu yang lama. Anemia yang merupakan salah satu gejala keracunan timbal terjadi akibatpenurunan sintesis globin walaupun tak tampak adanya penurunan kadar zat besipada serum. Anemia ringan yang terjadi disertai dengan sedikit peningkatan kadarALA (Amino Levulinic Acid) urine. Anemia biasanya terjadi pada orang yangterpapar timbal dalam jangka waktu lama. Misalnya pada penduduk yang tinggaldi sekitar industri yang menggunakan bahan tersebut dan para pekerja. Penelitian ini merupakan penelitian analitik yaitu untuk mengetahuihubungan karakteristik pekerja, penggunaan APD dan lama kerja dengan kejadiananemia pada pekerja di Stasiun Pompa Bensin Umum (SPBU) Palembang tahun2009. Teknik pengambilan 96 sampel ini dilakukan secara cluster randomsampling. Kemudian sampel tersebut diperiksa kadar hemoglobinnya dilaboratorium klinik dengan menggunakan alat spektrofotometer. Analisis data penelitian ini menggunakan uji Chi Square dan uji Tindependent dengan bantuan perangkat lunak software computer. Hasil didapat kadar Hb rata rata adalah 15.69 gr % dengan kadar Hbterendah 10.10 gr% dan kadar Hb tertinggi 27.40 gr%. Status Hb anemia 31 orang(31.6%), status Hb normal 41 orang (41.8%) dan status Hb polisitemia adalahsebanyak 26 orang (26.5 %). Hasil uji lebih lanjut didapat tidak ada hubunganantara jenis kelamin dengan status hemoglobin (p = 0.351), Tidak ada hubunganantara lama kerja dengan status hemoglobin ( p = 0.545). Dan Ada hubunganantara penggunaan APD dengan status hemoglobin pekerja SPBU ( p = 0.020 ).Disarankan adanya upaya managemen pencegahan timbulnya penyakit akibatkerja pada pekerja SPBU dengan menggunakan alat pelindung diri yang sesuia,adanya penyuluhan mengenai bahaya lingkungan kerja dan penyuluhan tentanggizi terhadap pekerja di SPBU.Kata Kunci : Anemia, PekerjaProsiding Seminar Nasional, 13-14 Desember 2010 1206
  • 20. ISBN 978-602-98295-0-1 PENDAHULUAN Di Indonesia, prevalensi anemia bervariasi yaitu 50-70 % pada wanitahamil, 30-40% pada wanita dewasa, 30 - 40 % pada balita, 25 - 30 % pada anaksekolah, 20 - 30% pekerja berpenghasilan rendah (Husaini, 1989).(1) Salah satu faktor penyebab anemia adalah gaya hidup yang kurang sehat,kurang asupan zat yang dibutuhkan untuk pembentukan hemoglobin seperti zatbesi, folat, dan vitamin B12. Ada penyebab anemia yang lain yaitu timah hitam. (2) Timah hitam secara umum dikenal dengan sebutan timbal, biasa digunakansebagai campuran bahan bakar bensin. Fungsinya selain meningkatkan dayapelumasan, juga meningkatkan efisiensi pembakaran sehingga kinerja kendaraanbermotormeningkat. Bahan kimia ini bersama bensin dibakar dalam mesin. Sisanya  70%keluar bersama emisi gas buang hasil pembakaran. Berdasarkan data tahun2004, beberapa kota besar misalnya Palembang masih menggunakan bensinbertimbal dengan kadar 0,199 gr/L. (3,5) Timbal lebih tersebar luas dibanding kebanyakan logam toksik lainnya.Kadarnya di lingkungan meningkat karena penambangan, peleburan,pembersihan, dan berbagai penggunaannya dalam industri. (4) WHO menyatakan tidak ada ambang batas paparan timbal di udara karenasifatnya logam berat dan toksik. Kadar Pb dalam darah manusia yang tidakterpapar oleh Pb adalah sekitar 10-25 µg/100 ml. Konsentrasi Pb dalam darahpada kadar 40-50 µg/100 ml mampu menghambat hemoglobin yang padaakhirnya merusak hemoglobin darah.(3) Mukono (1991) meneliti status kesehatan dan kadar Pb Blood (Pb-B)karyawan SPBU (Stasiun Pompa Bensin Umum) di Jawa Timur dan menemukanbahwa pemeriksaan darah lengkap pada karyawan SPBU dengan penjualanbensin kurang dari 8 ribu liter per hari lebih baik dari karyawan SPBU yangmenjual bensin lebih dari 10 ribu liter per hari. Didapatkan pula bahwa reratakadar Pb-B karyawan SPBU sebesar 77,59 µg/100 ml.(6) Suwandi (1995) menemukan bahwa kadar Pb udara di daerah terpaparpada malam hari adalah 0,0299 mg/ml, yang besarnya sepuluh kali lipat kadar Pbdi daerah tidak terpapar pada malam hari 0,0028 mg/ml. Sedangkan rerata kadarProsiding Seminar Nasional, 13-14 Desember 2010 1207
  • 21. ISBN 978-602-98295-0-1Pb Blood (Pb-B) di daerah terpapar adalah 170,44 µg/100 ml, yang besarnya tigakali lipat kadar Pb di daerah tidak terpapar 45,43 µg/100 ml. Juga ditemukansemakin tinggi kadar Pb-B semakin rendah kadar hemoglobin-nya.(6) Aminah (2006) melakukan penelitian kadar Pb dan Hb dalam darahkaryawan sampling dan non sampling di BBTKL PPM (Balai Besar TeknikKesehatan Lingkungan dan Pemberantasan Penyakit Menular) Surabaya, dimanakaryawan sampling memiliki rata-rata kadar Pb darah 7,08 g/L dengan rata-ratakadar Hb darah 14,42 g/dL. Sedangkan semua karyawan non sampling memilikikadar Pb darah 0 g/L dengan rata-rata kadar Hb 13,34 g/dL (sebagian besarkaryawan non sampling berjenis kelamin wanita).(7) Kaltsum (2008) melakukan penelitian kadar Hb pada pekerja SPBU didapatrata rata kadar Hb 15.68 gr%. Kejadian anemia pada pekerja SPBU sebanyak 31orang (32.3%) Dampak yang ditimbulkan oleh timbal adalah dapat meracuni sistempembentukkan sel darah merah sehingga menimbulkan gangguan pembentukkansel darah merah, mempengaruhi sistem saraf, dan intelegensia pertumbuhananak-anak (IQ). Gejala keracunan timbal ini biasanya mual, sakit di perut, dananemia. Keracunan timbal kronik secara terus menerus makin meningkat dalamjaringan yang akan menyebabkan kelumpuhan serta perubahan hematologik sertaleukemia.(3) Anemia yang merupakan salah satu gejala keracunan timbal terjadi akibatpenurunan sintesis globin walaupun tak tampak adanya penurunan kadar zat besipada serum. Anemia ringan yang terjadi disertai dengan sedikit peningkatan kadarALA (Amino Levulinic Acid) urine. Anemia biasanya terjadi pada orang yangterpapar timbal dalam jangka waktu lama. Misalnya pada penduduk yang tinggaldi sekitar industri yang menggunakan bahan tersebut dan para pekerja. (6)Dalam hal ini yang menjadi objek penelitian adalah para pekerja di Stasiun PompaBensin Umum (SPBU). Para pekerja SPBU tersebut rentan terkena anemia dikarenakan keadaan lingkungan kerja mereka yang secara langsungterpapar timbal dari bensin. Selain itu juga ditunjang dari faktor ekonomi yangrendah serta kurangnya asupan gizi bagi pekerja tersebut.Prosiding Seminar Nasional, 13-14 Desember 2010 1208
  • 22. ISBN 978-602-98295-0-1 Faktor-faktor yang dapat mempengaruhi status kesehatan pada pekerja dilingkungan yang terpapar timbal diantaranya jenis kelamin, umur, lama kerja, danpenggunaan alat pelindung diri (APD). (3,7) Rumusan masalah penelitian ini adalah masih ditemukannya kejadianAnemia pada pekerja berpenghasilan rendah, salah satunya adalah pekerjaSPBU. Tujuan penelitian ini adalah untuk mengetahui hubungan karakteristikpekerja, penggunaan APD, dan lama kerja dengan kejadian anemia pada pekerjadi stasiun pompa bensin umum (SPBU) Palembang tahun 2009. METODA PENELITIANLokasi PenelitianPenelitian secara cross sectional ini di lakukan di 18 SPBU yang terpilih menjadisubyek penelitian. Cara pengambilan sampel yang digunakan dalam penelitian iniadalah rancangan stratified random sampling.Jumlah SampelBesar sampel penelitian yang ditetapkan, dihitung dengan menggunakan rumusLemeshow et al. (1997) sebagai berikut : Z21-ά/2 .p (1 – P) n= d2 Perhitungan sampel : (1,96)2 . 0.30 (1 – 0.30) n = -------------------------------- (0,1)2 n = 81 pekerja dibulatkan menjadi 96 pekerja SPBUPengumpulan data Jenis data yang dikumpulkan dan cara pengumpulan data adalah :Prosiding Seminar Nasional, 13-14 Desember 2010 1209
  • 23. ISBN 978-602-98295-0-1 1. Data primer, meliputi data :  Data karakteristik responden, lama kerja, penggunaan APD diperoleh melalui wawancara lansung terhadap responden dengan menggunakan alat bantu kuesioner dan observasi langsung.  Data kadar Hb diperoleh melalui pemeriksaan darah untuk menentukan kadar Hb dengan menggunakan metode cyanmethemoglobin. 2. Data Skunder, meliputi data :  Jumlah SPBU dan lokasi SPBU yang diperoleh dari Hiswanamigas Plaju.Pengolahan data dan cara analisis DataPengolahan Data  Hasil pengukuran Hb responden dengan metode cyanmethemoglobin dibandingkan dengan standar rujukan cyanmethemoglobin , kemudian dibuat menjadi dua katagori yaitu Kadar Hb < rujukan dan kadar Hb ≥ Rujukan.  Seluruh data akan diolah dengan menggunakan software komputer .Analisis Data  Analisa Univariat Analisa ini digunakan untuk mendiskripsikan variabel bebas dan variabel terikat guna mendapatkan gambaran atau karakteristik responden dengan membuat tabel distribusi frekuensi.  Analisa Bivariat Analisa ini dilakukan dengan membuat tabel silang antara masing- masing variabel bebas terhadap variabel terikat guna memperoleh gambaran variabel bebas mana yang diduga ada hubungan dengan kejadian Anemia pada pekerja di SPBU kota palembang. Uji statistik yang digunakan dalam analisis ini adalah Chi square dan uji t independent. HASIL PENELITIAN Kadar Hemoglobin (Hb) pekerja SPBU Hasil analis didapat distribusi statistic kadar Hb pekerja SPBU adalah sebagai berikutProsiding Seminar Nasional, 13-14 Desember 2010 1210
  • 24. ISBN 978-602-98295-0-1 Tabel. 4.1. Distribusi statistik kadar Hb pekerja SPBU di Kota Palembang tahun 2009 Variabel Mean Median SD Min - Maks 95 % CI Kadar Hb 15.69 3.31 10.10 – 27.4 15.03 – 15.45 16.36 Hasil analisis didapatkan rata rata kadar Hb adalah 15.69 gr % ( 95% CI : 15.03 – 16.36), Median 15.45gr % dengan standar deviasi 3.31 gr % . Kadar Hb terendah 10.10 gr % dan kadar Hb tertinggi 27.4 gr %. Dari hasil estimasi interval dapat disimpulkan bahwa 95 % diyakini bahwa rata rata kadar Hb antara 15.03 gr % sampai 16.36 gr %. Status Hemoglobin (Hb) pekerja SPBU Hasil analisis didapat distribusi frekuensi kadar Hb pekerja SPBU adalah sebagai berikut Tabel. 4.2. Distribusi frekuensi Status Hb pekerja SPBU di Kota Palembang tahun 2009 Status Hb Jumlah Persentase Anemia 31 31.6 Normal 41 41.8 Polisitemia 26 26.5 Jumlah 98 100 Distribusi status Hb pekerja SPBU hampir merata, yaitu status anemia sebanyak 31 orang (31.6 %), status Hb normal 41 orang (41.8 %) dan Status Hb polisitemia sebanyak 26 orang (26.5 %). Status Hemoglobin (Hb) pekerja SPBU Hasil analisis didapat distribusi frekuensi kadar Hb pekerja SPBU adalah sebagai berikut Tabel. 4.2. Distribusi frekuensi Status Hb pekerja SPBU di Kota Palembang tahun 2009 Status Hb Jumlah Persentase Normal 41 41.8 Tidak Normal 57 58.2 Jumlah 98 100Prosiding Seminar Nasional, 13-14 Desember 2010 1211
  • 25. ISBN 978-602-98295-0-1 Distribusi status Hb pekerja SPBU hampir merata, yaitu status Hb yang normal sebanyak 41 orang (41.8 %), dan status Hb yang tak normal 57 orang (58.2 %). Jenis Kelamin pekerja SPBU Hasil analisis didapat distribusi frekuensi jenis kelamin pekerja SPBU adalah sebagai berikut Tabel. 4.2. Distribusi frekuensi Jenis kelamin pekerja SPBU di Kota Palembang tahun 2009 Jenis Kelamin Jumlah Persentase Laki laki 74 75.5 Perempuan 24 24.5 Jumlah 98 100 Distribusi jenis kelamin pekerja SPBU yaitu laki laki sebanyak 74 orang (75.5%), dan yang berjenis kelamin perempuan sebanyak 24 orang (24.5 %). Penggunaan Alat Pelindung Diri (APD) Hasil analisis didapat distribusi frekuensi penggunaan APD pekerja SPBU adalah sebagai berikut Tabel. 4.2. Distribusi frekuensi Penggunaan APD pekerja SPBU di Kota Palembang tahun 2009 APD Jumlah Persentase Sesuai 7 7.1 Tidak Sesuai 91 92.9 Jumlah 98 100 Distribusi Penggunaan APD pekerja SPBU yaitu Penggunaan APD yang sesuai sebanyak 7 orang (7.1%), dan yang menggunakan tidak sesuai sebanyak 91 orang (92.9 %). Lama Kerja Pekerja SPBU Hasil analis didapat distribusi statistic lama kerja pekerja SPBU adalah sebagai berikutProsiding Seminar Nasional, 13-14 Desember 2010 1212
  • 26. ISBN 978-602-98295-0-1 Tabel. 4.1. Distribusi statistik Lama kerja pekerja SPBU di Kota Palembang tahun 2009 Variabel Mean Median SD Min - Maks 95 % CI Lama kerja 5.45 5.93 1 – 30 4.26 – 6.64 3.00 Hasil analisis didapatkan rata rata lama kerja adalah 5.45 tahun ( 95% CI : 4.26 – 6.64), Median 3.00 tahun dengan standar deviasi 5.93 tahun . Lama kerja terendah adalah 1 tahun dan lama kerja tertinggi 30 tahun. Dari hasil estimasi interval dapat disimpulkan bahwa 95 % diyakini bahwa rata rata lama kerja antara 4.26 tahun sampai 6.64 tahun. Lama kerja Pekerja SPBU Hasil analisis didapat distribusi frekuensi lama kerja pekerja SPBU adalah sebagai berikut Tabel. 4.2. Distribusi frekuensi Lama kerja pekerja SPBU di Kota Palembang tahun 2009 Lama kerja Jumlah Persentase  3 tahun 56 57.1 > 3 tahun 42 42.9 Jumlah 98 100 Distribusi lama kerja pekerja SPBU yaitu  3 tahun sebanyak 56 orang (57.1 %), dan lama kerja > 3 tahun sebanyak 42 orang ( 42.9 %). Umur pekerja SPBU Hasil analis didapat distribusi statistic umur pekerja SPBU adalah sebagai berikut Tabel. 4.1. Distribusi statistik Umur pekerja SPBU di Kota Palembang tahun 2009 Variabel Mean Median SD Min - Maks 95 % CI Umur 28.31 7.30 18 - 54 26.84 – 27.50 29.77Prosiding Seminar Nasional, 13-14 Desember 2010 1213
  • 27. ISBN 978-602-98295-0-1 Hasil analisis didapatkan rata rata umur pekerja adalah 28.31 tahun ( 95% CI : 26.84 – 29.77), Median 27.50 tahun dengan standar deviasi 7.30 tahun . Umur pekerja termuda adalah 18 tahun dan umur pekerja tertua adalah 54 tahun. Dari hasil estimasi interval dapat disimpulkan bahwa 95 % diyakini bahwa rata rata umur pekerja antara 26.84 tahun sampai 29.77 tahun.Hubungan karakteristik pekerja dengan status hemoglobin pekerja SPBU 1. Jenis Kelamin dengan status hemoglobin Tabel. 4.9.1. Distribusi responden menurut jenis kelamin dan status hemoglobin pekerja SPBU Status HemoglobinJenis Normal Tidak Total OR P valuekelamin normal 95 % CI n % n % N %Laki laki 29 39.2 45 60.8 74 100 0.6 (0.25 – 0.351Perempu 12 50.0 12 50.0 24 100 1.63anJumlah 41 41.8 57 58.2 98 100Hasil analisis hubungan antara jenis kelamin dengan status hemoglobin pekerjaSPBU didapat bahwa ada sebanyak 45 pekerja (60.8 %) dari 74 orang pekerjayang ber jenis kelamin laki laki memiliki status hemoglobin tidak normal.Sedangkan diantara pekerja yang berjenis kelamin perempuan ada 12 pekerja(50.0%) yang mempunyai status hemoglobin yang tidak normal. Hasil uji statistikdiperoleh nilai p = 0.351, maka dapat disimpulkan tidak ada hubungan yangsignifikan antara jenis kelamin dengan status hemoglobin pekerja SPBU di kotaPalembang.2. Umur dengan status hemoglobin Tabel.4.9.1. Distribusi rata rata umur responden menurut status hemoglobin Pekerja SPBU di kota Palembang Variabel Mean SD SE P value N Status Hb - Normal 27.56 8.24 1.29 0.395 41 - Tidak 28.84 6.58 0.87 57 normalProsiding Seminar Nasional, 13-14 Desember 2010 1214
  • 28. ISBN 978-602-98295-0-1Rata rata umur pekerja yang mempunyai status Hb normal adalah 27.56 tahundengan standar deviasi 8.24 tahun. Sedangkan untuk pekerja yang status Hb nyatidak normal, rata rata umurnya adalah 28.84 tahun dengan standar deviasi 6.58tahun.Hasil uji didapat p = 0.395, berarti pada alpha 5 % terlihat tidak ada perbedaanyang signifikan rata rata umur pekerja antara pekerja yang status Hb nya normaldengan pekerja yang status Hbnya tidak normal.Hubungan Penggunaan APD dengan status Hemoglobin pekerja SPBU Tabel. 4.10. Distribusi responden menurut Penggunaan APD dan status hemoglobin pekerja SPBU Status HemoglobinPengguna Normal Tidak Total OR P valuean APD normal 95 % CI n % n % N %Sesuai 6 85.7 1 14.3 7 100 9.60 (1.11-83.1) 0.020Tidak 35 38.5 56 61.5 91 100sesuaiJumlah 41 41.8 57 58.2 98 100Hasil analisis hubungan antara penggunaan APD dengan status hemoglobinpekerja SPBU didapat bahwa ada sebanyak 1 pekerja (14.3 %) dari 7 orangpekerja yang menggunakan APD sesuai memiliki status hemoglobin tidak normal.Sedangkan diantara pekerja yang menggunakan APD tidak sesuai ada 56 pekerja(61.5%) yang mempunyai status hemoglobin yang tidak normal. Hasil uji statistikdiperoleh nilai p = 0.020, maka dapat disimpulkan ada hubungan yang signifikanantara penggunaan APD dengan status hemoglobin pekerja SPBU di kotaPalembang.Dari hasil analisis diperoleh nilai OR = 9.60 (95%CI : 1.11 – 83.1), artinya pekerjayang menggunakan APD yang tidak sesuai memiliki peluang 9.60 kali mempunyaistatus hemoglobin tidak normal dibanding pekerja yang menggunakan APD yangsesuai.Prosiding Seminar Nasional, 13-14 Desember 2010 1215
  • 29. ISBN 978-602-98295-0-1Hubungan lama kerja dengan status hemoglobin pekerja SPBUTabel.4.9.1. Distribusi rata rata lama kerja responden menurut status hemoglobin Pekerja SPBU di kota Palembang Variabel Mean SD SE P value N Status Hb - Normal 5.024 5.42 0.85 0.545 41 - Tidak 5.76 6.29 0.83 57 normalRata rata lama kerja pekerja yang mempunyai status Hb normal adalah 5.04tahun dengan standar deviasi 5.42 tahun. Sedangkan untuk pekerja yang statusHb nya tidak normal, rata rata lama kerjanya adalah 5.76 tahun dengan standardeviasi 6.29 tahun.Hasil uji didapat p = 0.545, berarti pada alpha 5 % terlihat tidak ada perbedaanyang signifikan rata rata lama kerja pekerja antara pekerja yang status Hb nyanormal dengan pekerja yang status Hbnya tidak normal. PEMBAHASANA. Kadar Hemoglobin (Hb) pekerja SPBU Dari hasil penelitian yang dilakukan pada 98 pekerja di SPBU Palembang tahun 2009 didapatkan rata-rata kadar hemoglobin pekerja SPBU adalah 15.69 gr/dL, dengan kadar hemoglobin terendah 10.10 gr/dL dan tertinggi 27.4 gr/dL. Hasil kadar hemoglobin yang didapat memiliki kadar yang sangat jauh. dimana terdapat 2 perbedaan hasil yang rendah dan sangat tinggi. Tingginya kadar hemoglobin ini dapat disebabkan banyak faktor, yaitu karena kadar oksigen di dalam udara terlalu rendah dan waktu pengambilan sample. Jika kadar oksigen di udara rendah, maka jaringan mungkin menerima terlaluProsiding Seminar Nasional, 13-14 Desember 2010 1216
  • 30. ISBN 978-602-98295-0-1 sedikit oksigen. Waktu pengambilan sampel pada penelitian ini beraneka ragam. Mulai dari pagi, siang, dan sore hari. Waktu pengambilan sampel di siang hari juga mempengaruhi tingginya hasil kadar hemoglobin, dimana pekerja yang diambil sampelnya dalam kondisi yang tidak begitu baik. Kondisi yang tidak baik disini adalah pekerja di siang hari tepatnya sekitar pukul 11.00-14.00 melakukan pergantian shift. Pada saat pergantian shift, mereka belum mengkonsumsi makan siang dan kurangnya minum, ditambah dengan keadaan lingkungan yang panas. Terlihat pula kelelahan mereka bekerja dikarenakan aktifitas padat seharian yang banyak mengeluarkan tenaga sehingga pekerja juga sangat kurang mengkonsumsi air putih dan terjadi dehidrasi secara mikro di dalam tubuh.. Penyebab lain tingginya kadar hemoglobin juga dapat dilihat pada saat pemeriksaan di laboratorium. Hasil pemeriksaan kadar hemoglobin penelitian pada hari pertama umumnya seimbang, tetapi pada hari kedua hasilnya terdapat ketidakseimbangan. Hal ini bisa dikarenakan standar hemoglobin yang dibaca berulang-ulang sehingga tutup standar sering terbuka. Jika standar menguap dapat mempengaruhi hasil kadar hemoglobin menjadi tinggi dari hasil yang sebenarnya.B. Status Hemoglobin (HB) pekerja SPBU Distribusi frekuensi status Hb pada pekerja di SPBU Palembang tahun 2009 diperoleh hasil pekerja yang status Hb nya anemia sebanyak 31 orang (31,6%).Prosiding Seminar Nasional, 13-14 Desember 2010 1217
  • 31. ISBN 978-602-98295-0-1 Hasil ini lebih tinggi bila dibandingkan dengan penelitian Husaini (1989) bahwa di Indonesia prevalensi anemia pada pekerja berpenghasilan rendah sebanyak 20-30% (Nyoman M, 2004) Anemia yang terjadi pada pekerja SPBU dapat disebabkan oleh beberapa faktor. Faktor utama diduga dari paparan timbal pada bensin dalam jangka waktu yang lama. Menurut penelitian di lapangan pada saat pengambilan sampel, umumnya pekerja yang anemia telah memiliki dampak dari pekerjaan sebelumnya seperti ada beberapa pekerja SPBU tersebut yang sebelumnya telah bekerja di SPBU juga. Sedangkan faktor lain dapat berasal dari rendahnya faktor ekonomi serta kurangnya asupan gizi bagi pekerja tersebut. Gangguan kesehatan seperti anemia dapat berpengaruh pada produktifitas kaum pekerja SPBU dimana daya tahan fisik pekerja terkendala karena rendahnya kadar hemoglobin dalam darah. Akibatnya para pekerja tidak dapat bekerja dengan optimal misalnya saja para pekerja sering izin tidak dapat bekerja dikarenakan sakit. Anemia merupakan penyakit yang bukan sepele karena jangka panjang dapat mengakibatkan kerusakan syaraf, fungsi otak, serangan jantung bahkan kematian. (http://portalcbn.net.id/cbprtl/cybermed/detail.aspx/.) Selain timbal, di dalam bensin juga ada zat kimia lain yang berbahaya yaitu benzena. Data menunjukkan adanya insiden terjadinya anemia aplastik akibat inhalasi benzene di eropa dan Israel sebanyak dua kasus per 1 juta populasi setiap tahunnya. Di Thailand dan Cina angka kejadiannya sebanyak lima hingga tujuh orang per 1 juta populasi per tahunnya ( Kasper, Braunwald, faunci et al, 2004).Prosiding Seminar Nasional, 13-14 Desember 2010 1218
  • 32. ISBN 978-602-98295-0-1 Pemajanan zat kimia terhadap pekerja beserta lingkungan kerjanya secara terus-menerus akan merupakan beban fisik dan psikologis bagi tenaga kerja yang akhirnya menyebabkan penyakit akibat kerja. Peraturan Menteri Tenaga Kerja Nomor Per. 01/Men/1981 mengenai kewajiban melapor penyakit akibat kerja, mengatur bahwa terdapat 30 jenis penyakit akibat kerja yang berhubungan dengan bahan kimia termasuk benzena. Salah satu bahaya dari benzen adalah leukemia, dimana tanda-tanda awal dari leukemia adalah anemia.(Lu, Frank. 1995). Selain itu dari hasil analisis didapat adanya kejadian polisitemia sebanyak 26 orang (26.5%). Polisitemia adalah keadaan dimana terjadi peningkatan jumlah sel darah merah akibat pembentukan sel darah merah yang berlebihan oleh sumsum tulang. Polisitemia terjadi akibat kekurangan kadar oksigen, dehidrasi dan pada beberapa kasus yang berkaitan dengan neoplasma. (Brown A B, 1975)C. Hubungan Karakteristik responden dengan status Hemoglobin pekerja SPBU Dari hasil uji didapat bahwa tidak ada hubungan antara jenis kelamin dengan status hemoglobin. Hasil ini bertolak belakang dengan penelitian sebelumnya Aminah (2006) di Surabaya bahwa perempuan lebih rentan terkena anemia yang disebabkan oleh keracunan timbal daripada laki-laki. Beberapa penelitian (Husaini dkk) melaporkan dikalangan tenaga kerja wanita 30-40% menderita anemia, dan hasil studi di Tangerang tahun 1999 menunjukan prevalensi anemia pada pekerja wanita 69%.(Aminah, 2006 dan Depkes, 1999).Prosiding Seminar Nasional, 13-14 Desember 2010 1219
  • 33. ISBN 978-602-98295-0-1 Menurut teorinya, perempuan lebih berisiko terkena anemia daripada laki-laki. Disamping dari pengaruh hormon akibat menstruasi dan kehamilan, banyak perempuan yang melakukan diet tidak sehat seperti minum obat-obat pelangsing yang mempunyai efek samping yang buruk serta mengurangi mengkonsumsi makanan yang mengandung vitamin. Aktifitas perempuan juga lebih banyak dibanding laki-laki karena selain bekerja di luar rumah, perempuan juga mengurus rumah tangga.(Wahyuni, sri, 2007) Distribusi jenis kelamin pada pekerja SPBU di kota Palembang didapat bahwa Jumlah pekerja berjenis kelamin perempuan sangat sedikit yaitu 24 orang (24,5%) dari 98 orang pekerja. Dengan proporsi ini maka hubungan antara jenis kelamin dengan status hemoglobin tidak terdeteksi karena jenis kelamin mendekati homogen. Hasil uji juga di dapat tidak ada hubungan antara umur dengan status hemoglobin. Hal ini bertolak belakang dengan teori dari buku kasper, braunwald, fauci et al (2004) yang menyatakan bahwa distribusi umur biasanya biphasik, yang artinya puncak kejadiannya pada remaja dan puncak kedua pada orang lanjut usia. Distribusi umur pada pekerja di SPBU kota palembang, umur rata rata 28.31 tahun. Umur termuda 18 dan umur tertua 54 tahun. Dari distribusi ini, terlihat bahwa rentang usia sangat jauh berbeda dan jumlah usia tua sangat sedikit. Sehingga data cukup homogen di usia produktif. Dengan homogennya umur pekerja ini maka tidak didapat hubungan antara umur dengan status hemoglobin.D. Hubungan Lama kerja dengan status hemoglobin pekerja SPBUProsiding Seminar Nasional, 13-14 Desember 2010 1220
  • 34. ISBN 978-602-98295-0-1 Dari hasil uji didapat bahwa tidak ada hubungan antara lama kerja dengan status hemoglobin pekerja SPBU. Hal ini bertentangan dengan penelitian sebelumnya Aminah (2006) di Surabaya yang menyatakan bahwa lebih lama seseorang bekerja dalam lingkungan yang terpapar timbal akan lebih besar kemungkinan keracunan. Berdasarkan teorinya, semakin lama seseorang bekerja dalam lingkungan yang terpapar timbal maka semakin besar terkena keracunan karena dalam jangka waktu yang lama konsentrasi timbal berlebih akan terakumulasi dalam darah. Namun demikian, tidak hanya lama kerja yang merupakan faktor penyebab anemia dari keracunan timbal, tetapi masih banyak faktor lainnya diantaranya status gizi yang buruk, dan kesejahteraan pekerja SPBU. (Aminah, 2007 dan http://portalcbn.net.id/cbprtl/cybermed/detail.aspx/.). Distribusi lama kerja di dapat, rata rata lama kerja 5.45 tahun. Sedangkan lama kerja terendah adalah 1 tahun dan lama kerja tertinggi adalah 30 tahun. Dari distribusi ini terlihat begitu lebar jarak rentang lama kerja antara sesama pekerja. Dan sebagian besar pekerja mempunyai lama kerja antara 4.26 tahun sampai 6.64 tahun. Dari data ini, maka dapat disimpulkan bahwa proses keterpaparan pekerja oleh bahan bahan toksik di dalam bensin mendekati homogen antara sesama pekerja.E. Hubungan Penggunaan Alat Pelindung Diri (APD) dengan statushemoglobin Hasil analisis didapat Ada hubungan antara penggunaan APD dengan status hemoglobin pekerja SPBU di kota Palembang.Prosiding Seminar Nasional, 13-14 Desember 2010 1221
  • 35. ISBN 978-602-98295-0-1 Dari pengamatan di lapangan, didapatkan 91 orang pekerja SPBU (92.9%) tidak menggunakan alat pelindung diri yang sesuai sedangkan hanya 7 orang (7.1%) yang menggunakan alat pelindung diri yang sesuai. Hasil ini hampir sama dengan penelitian Aminah (2006) di Surabaya dimana seluruh karyawan 100% tidak menggunakan alat pelindung diri. Penyebab utamanya adalah tidak tersedianya alat pelindung diri yang sesuai di SPBU tersebut diantaranya sepatu, sarung tangan, dan masker. Walaupun ada beberapa SPBU yang menyediakan fasilitas tersebut, tetapi para pekerja tidak menggunakannya dengan baik. Tidak diketahui alasannya secara pasti tetapi hal tersebut juga merupakan kesalahan dari pihak atasan karena tidak adanya tindakan tegas bagi para pekerja yang tidak menggunakan alat pelindung diri yang sesuai. Alat pelindung diri sangat penting digunakan pada pekerja SPBU. Lingkungan kerja yang terpapar timbal dari bensin dapat mengakibatkan gangguan kesehatan bagi pekerja SPBU tersebut. Pentingnya alat pelindung diri terutama masker mengingat dimana timbal dapat masuk ke dalam tubuh 85% melalui pernapasan, 14% melalui pencernaan, dan 1% melalui kulit.(KPBB, 1999) Keracunan melalui mulut kemudian masuk ke dalam pencernaan akan menimbulkan tanda-tanda seperti muntah, denyut nadi cepat, hilang kesadaran, kehilangan kestabilan, dan koma. Keracunan melalui kulit merupakan iritan kuat yang dapat menimbulkan bercak merah dan terbakar serta menghilangkan lemak pada lapisan keratin yang menyebabkan kulit kering serta bersisik. Pada keracunan melalui pernapasan, tanda-tanda utamanya ialah perasaan mengantuk, pusing, sakit kepala, vertigo, danProsiding Seminar Nasional, 13-14 Desember 2010 1222
  • 36. ISBN 978-602-98295-0-1 kehilangan kesadaran. Keracunan ini berpengaruh terhadap sel sel hemopoetik darah tepi dan sumsum tulang.(Wisaksono, 2004). KESIMPULAN 1. Tidak ada hubungan antara jenis kelamin dengan status hemoglobin pekerja SPBU di kota Palembang tahun 2009 2. Tidak ada hubungan antara lama kerja dengan status hemoglobin pekerja SPBU di kota Palembang tahun 2009 3. Ada hubungan antara penggunaan alat pelindung diri (APD) dengan status hemoglobin pekerja SPBU di kota Palembang tahun 2009. SARAN 1. Pemilik SPBU diharapkan memberikan fasilitas alat pelindung diri yang sesuai untuk pekerja SPBU guna mencegah timbulnya gangguan kesehatan seperti anemia atau penyakit akibat kerja lain nya. 2. Pekerja SPBU diharapkan mengkonsumsi gizi yang seimbang setiap harinya. 3. Perlu adanya penyuluhan bagi pekerja SPBU oleh petugas kesehatan mengenai bahaya lingkungan kerja, khususnya dampak timbal dan benzen bagi kesehatan. 4. Kepada peneliti lain, perlu dilakukan penelitian lebih lanjut antara lain: a. Pemeriksaan penunjang lain seperti pemeriksaan hitung jumlah eritrosit, retikulosit, dan pemeriksaan sediaan hapus darah. b. Dilakukan pemeriksaan seperti di atas tetapi dengan objek penelitian yang berbeda misalnya pada pedagang asongan, anak-anak jalanan, sopir angkutan umum, dan polisi lalu lintas yang terpapar timbal dari gas buang kendaraan.Prosiding Seminar Nasional, 13-14 Desember 2010 1223
  • 37. ISBN 978-602-98295-0-1 DAFTAR PUSTAKAMurtiyasa, Nyoman. 2004. Faktor Resiko Kejadian Anemia pada Pekerja Wanita. (http://adln.lib.unair.ac.id/go.php/. Diakses 7 Januari 2008).Anonim. 2006. Anemia. (http://portalcbn.net.id/cbprtl/cybermed/detail.aspx/. Diakses 7 Januari 2008).Komite Penghapusan Bensin Bertimbal. 1999. Analisis Dampak Pemakaian Bensin Bertimbal dan Kesehatan. (http://www.kpbb.org/makalah-ind/. Diakses 29 September 2007).Komite Penghapusan Bensin Bertimbal. 2005. Pengujian Kadar Pb pada Bensin Premium TT. (http://www.kpbb.org/makalah_ing/LeadPhaseOutRevised.pdf. Diakses 7 Januari 2008).Lu, Frank C. 1995. Toksikologi Dasar. Edisi Kedua. Penerbit Universitas Indonesia, Jakarta.Sudarmaji, J. Mukono, Corie I.P. 2006. Toksikologi Logam Berat B3 dan Dampaknya Terhadap Kesehatan. Jurnal Kesehatan Lingkungan Vol.2 No.2. (http://www.journal.unair.ac.id/login/journal/filer/KESLING-2-2-03.pdf. Diakses 29 September 2007).Aminah, Noery. 2006. Perbandingan Kadar Pb, Hb, Fungsi Hati, Fungsi Ginjal. Jurnal Kesehatan Lingkungan Vol.2 No.2. (http://www.journal.unair.ac.id/login/jurnal/filer/KESLING-2-2-01.pdf. Diakses 3 Oktober 2007).Depkes RI Pusat Pendidikan Tenaga Kesehatan. 1989. Hematologi. Jakarta.Hadiat, dkk. 2004. Kamus Sains. Balai Pustaka, Jakarta.De Maeyer, E.M. 1993. Pencegahan Dan Pengawasan Anemia Defisiensi Besi. Widya Medika, Jakarta.Sitompul, Johan Intan. 1983. Patohematologi. Penerbit Medipress, Jakarta.Wahyuni, Sri. 2007. Anemia dan Wanita.(http://www.medanbisnisonline.com/rubrik.php. Diakses 4 Juli 2008).Notoatmodjo, Soekidjo. 1996. Ilmu Kesehatan Masyarakat. Penerbit Rineka Cipta, Jakarta.Prosiding Seminar Nasional, 13-14 Desember 2010 1224
  • 38. ISBN 978-602-98295-0-1Firdaus, Lutfi. Bensin. (http://www.chem-is-try.org/?sect=fokus&ext=17. Diakses 7 Januari 2008).Sartono, Drs. 2002. Racun dan Keracunan. Widya Medika, Jakarta.Polar, Heryando. 1994. Pencemaran dan Toksikologi Logam Berat. Penerbit Rineka Cipta, Jakarta.dr U Syamsudin, dr F D Suyatna. 1978. Keracunan Pb.(http://www.kalbe.co.id/files/cdk/files/10KeracunanPb013.pdf/. Diakses 7 Januari 2008).Komite Penghapusan Bensin Bertimbal. 1999. Kebijakan Energi Bersih melalui Penghapusan Bensin Bertimbal (Pb).(http://www.kpbb.org/makalah_ind/Kebijakan%20Energi%20Bersih%20Melalui%2 0Penghapusan%20Bensin%20Bertimbel.pdf. Diakses 7 Januari 2008).Azwar, A. 1988. Pengantar Epidemiologi Edisi Pertama. PT.Bina Rupa Aksara, Jakarta.Imamkhasani, Soemarto. 1990. Keselamatan Kerja dalam Laboratorium Kimia. Penerbit PT.Gramedia, Jakarta.Martin, David W.JR dkk. 1992. Biokimia Harper Edisi 20. Penerbit Buku Kedokteran EGC, Jakarta.Kresno, Siti Boedina. 1988. Pengantar Hematologi dan Imunohematologi.1988. Balai Penerbit FKUI, Jakarta.Wisaksono, Satmoko. 2004. Resiko Pemajanan Benzen terhadap Pekerja dan Cara Pemantauan Biologis. Jakarta.Gandasoebrata, R. 2004. Penuntun Laboratorium Klnik. Dian Rakyat, Jakarta.Tjokronegoro, Arjatmo dkk. 1992. Pemeriksaan Laboratorium Hematologi Sederhana. Balai Penerbit FKUI, Jakarta.Notoatmojo, Soekidjo. 1993. Dasar-dasar Metodelogi Penelitian Kesehatan. Penerbit Rineka Cipta, Jakarta.Widman K.F. 1995. Tinjauan klinis atas hasil Pemeriksaan Laboratorium. Ed 9 UI.JakartaBrown Barbara. 1975. Principles and Procedure. Lea & Febiger. PhiladelphiaProsiding Seminar Nasional, 13-14 Desember 2010 1225
  • 39. ISBN 978-602-98295-0-1 ANALISIS FAKTOR RESIKO PENULARAN HIV/AIDS DI KOTA MEDAN Erledis Simanjuntak Mahasiswa tugas belajar pada Program Doktor Ilmu-Ilmu Lingkungan Di PPS Unsri Palembang ABSTRAK HIV/AIDS merupakan salah satu masalah kesehatan Global. Di seluruhnegara saat ini sedang terancam dengan penyebaran virus yang mematikan ini.Tidak hanya di negara maju, tetapi juga di negara sedang berkembang sepertiIndonesia, termasuk di Kota Medan.Berbagai faktor resiko penyebab HIV/AIDS,seperti: hubungan sex bebas (beresiko), pemakaian jarum suntik narkoba,penularan melalui transfusi darah, dan transmisi dari ibu ke anak. Di samping itufaktor karakteristik juga berperan terhadap resiko penularan HIV/AIDS, sepertiumur, jenis, pekerjaan, dan pendidikan.Desain penelitian ini Kasus Kontrol,dengan 230 sampel (115:115). Data diambil dari pasien HIV/AIDS dan Kontrolyang dirawat inap di Rumah Sakit Umum Pusat Haji Adam Malik Medan tahun2010, yang berdomisili di Kota Medan. Dilakukan Analisis Deskriptif, Bivariat (UjiChi-Square), dan Multivariat (Uji Regressi Logistik), dengan Program SPSS ForWindos 17. Hasil penelitian menunjukkan ada hubungan yang signifikan padatingkat kepercayaan 95 % pada variabel : Pemakai jarum suntik narkoba(P=0,000), Hubungan sex bebas (P=0,000), Kelompok umur 15 – 24 tahun, 25-34 tahun, 35-44 tahun (P=0,000), jenis kelamin Laki-laki (P=0,000), Tidak bekerja,Wiraswasta, Pegawai Swasta (P= 0,000), Pendidikan SD, SLTP (P=0,000), SLTA(P=0,001). Uji Multivariat menunjukkan faktor resiko yang dominan terhadappenularan HIV/AIDS di Kota Medan adalah: Pemakaian jarum suntik narkoba(OR=66,551), hubungan sex bebas (OR=25,419), Pendidikan (OR=2,653),Pekerjaan (OR= 2,288).Kata Kunci : Kesehatan, Faktor Resiko HIV/AIDS, Kasus Kontrol. PENDAHULUAN Kasus HIV/ AIDS dewasa ini telah mengalami peningkatan jumlah secaracepat dari tahun – ketahun. Menurut data yang ada, sampai dengan 30 Juni 2010secara komulatif kasus AIDS yang dilaporkan sejak tahun1978 sejumlah 21.770kasus dari 32 provinsi dan 300 Kabupaten. Kasus terbanyak diperoleh di DKIJakarta, Jawa Barat, Jawa Timur, Papua, Bali, Jawa tengah, Kalimantan Barat,Sulawesi Selatan, Sumatera Utara, Riau dan Sumatera Barat. Rate tertinggiberada di Provinsi Papua (14,34 kali) dari angka Nasional. Rasio Kasus AIDSantara laki-laki dengan perempuan adalah 3:1.Prosiding Seminar Nasional, 13-14 Desember 2010 1226
  • 40. ISBN 978-602-98295-0-1 Sedangkan kasus HIV positf sampai dengan 30 Juni 2010 sejak dilaporkantahun1978 secara komulatif = 44.292. Daerah yang paling banyak terjadi kasusHIV positf adalah DKI Jakarta (9,804 kasus), Jawa Timur (5.973 kasus), JawaBarat (3.798 kasus), Sumatera Utara (3.391 kasus), Papua (2,947 kasus), Bali(2,505 Kasus). Jumlah ODHA (Orang Dengan HIV/AIDS yang masih dalampengobatan Anti Retro Virus tertinggi di DKI Jakarta (7.242 Kasus), Jawa Barat(2.001), Jawa Timur (1.517 Kasus), Bali (984 Kasus), Papua (685 Kasus), JawaTengah (575 Kasus), Sumatera Utara (575 Kasus), Kalimantan Barat (463 Kasus),Kepulauan Riau (426 kasus), Sulawesi Selatan (343 Kasus) (Depkes RI, 2010). Beberapa faktor resiko penularan hiv/aids adalah melalui hubunganseksual, melalui transfusi darah atau produk darah yang sudah tercampur virushiv, melalui jarum suntik yang tidak steril, transplantasi organ pengidap hiv danpenularan dari ibu ke anaknya saat di kandungan (Nursalam , 2007). Hingga saat ini belum ada data yang akurat tentang jumlah kasus, danfaktor risiko yang mempengaruhi berkembangnya penularan HIV diberbagaiwilayah di indonesia, termasuk di Kota Medan. Oleh sebab itu perlu dilakukanpenelitian tentang ― Analisis Faktor Resiko HIV/AIDS Di Kota Medan―. Dengandiketahuinya faktor resiko penularan HIV/AIDS secara jelas, diharapkan dapatmenjadi masukan terhadap pemerintah untuk membuat perioritas programpenanggulangan HIV/ AIDS secara tepat, efektif sesuai dengan sumber dayayang ada. BAHAN DAN METODE PENELITIAN Penelitian ini dilakukan di ini dilakukan di Rumah Sakit Umum Haji AdamMalik Medan.W aktu penelitian selama enam bulan (Mei - September tahun 2010).Desain penelitian ini adalah studi kasus kontrol (case control study). Sampeldalam penelitian terdiri dari dua kelompok yaitu satu kelompok kasus (penderitaHIV/AIDS), dan satu kelompok kontrol (bukan penderita HIV/AIDS) yangberdomisili di Kota Medan. Besar sampel dalam penelitian ini ditentukan denganrumus (Murti, 1996., Sudigdo, 2002) sebagai berikut:Prosiding Seminar Nasional, 13-14 Desember 2010 1227
  • 41. ISBN 978-602-98295-0-1 2    z  z  PQ  n 2    p 1       2  R p 1  R  Q  1  p Keterangan :R = Perkiraan Odds Ratio = 2., = 0,05., Z=1,64., = 0,10., Z= 1,28 2  1,64 2 1   1,28. .  n 2 3 3  2 1        3 2  2  0,82  0,89  n   0,16  n= 115 (jumlah sampel dalam adalah 230, terdiri dari 115 kasus, dan 115Kontrol). Pengambilan sampel dilakukan secara porposif. dengan menggunakanAngket, berupa kuesioner yang diisi langsung oleh responden. Bahan yang dianalisis dalam penelitian ini berupa Data Primer Primer yangdikumpulkan dengan menggunakan Angket. Data dianalisis secara Deskriptif,Analisis Bivariat (Uji Chi-Square), dilakukan perhitungan terhadap Odds Ratio(OR), dengan Confident Interval 95%. Analisis terhadap Odds Ratio dilakukandengan membandingkan Odds pada kelompok kasus dengan Odds padakelompok Kontrol (Sudigdo,2002). Selanjutnya dilakukan Analisis Multivariat (UjiRegressi Logistik), melalui Program SPSS For W indos 17 dengan metodeStepwise (Hastono,2001).Prosiding Seminar Nasional, 13-14 Desember 2010 1228
  • 42. ISBN 978-602-98295-0-1 HASIL DAN PEMBAHASAN Tabel .1. Distribusi Gambaran Karakteristik Sampel Kasus HIV/AIDS dan Kontrol Di Kota Medan Tahun 2010.No Variabel Kasus Kontrol Total n % n % n %1 Umur : 15-24 Tahun 15 13,0 13 11,3 28 12,2 25-34 Tahun 63 54,8 15 13,0 78 33,9 35-44 Tahun 27 23,5 32 27,8 59 25,7 45- 64 Tahun 10 8,7 55 47,8 65 28,3 Jumlah 115 100 115 100 230 1002 Jenis Kelamin: Laki-laki 96 83,5 70 60,9 166 72,2 Perempuan 19 16,5 45 39,1 64 27,8 Jumlah 115 100 115 100 230 1003 Pekerjaan: Tidak Bekerja 51 44,3 20 17,4 71 30,9 Wiraswasta 43 37,4 27 23,5 70 30,4 Pegawai 20 17,4 26 22,6 46 20,0 Swasta PNS 1 0,9 42 36,5 43 18,7 Jumlah 115 100 115 100 230 1004 Pendidikan: SD 9 7,8 2 1,7 11 4,8 SLTP 39 33,9 25 21,7 64 27,8 SLTA 65 56,5 70 60,9 135 58,7 PT/Akademi 2 1,7 18 15,7 20 8,7 Jumlah 115 100 115 100 230 100 1. Umur. Hasil penelitian pada Tabel.3.1. Menunjukkan bahwa proporsi kasusHIV/AIDS ditemukan tertinggi pada Umur 25-34 tahun (54,8%), 35-44 tahun(23,5%). Hasil uji Bivariat (Tabel. 3.3.) Menunjukkan adanya hubungan yangsignifikan antara umur dan HIV/AIDS (p=0,000), dan jika dilihat dari nilai OR, makadapat disimpulkan bahwa Usia yang paling beresiko terhadap HIV/AIDS adalahumur 25-34 tahun (OR=23,100), Usia 15-24 tahun (OR=6,346), 35-44 Tahun(OR=4,641). Usia remaja, dan usia produktif sangat beresiko terhadap penularanHIV/AIDS. Infeksi HIV/AIDS sebagian besar (>80%) diderita oleh kelompok usiaproduktif (15-49 tahun) (Wandoyo, 2007). Banyak faktor yang menyebabkantingginya kasus HIV/AIDS pada kelompok usia remaja, usia produktif . MenurutTanjung (2004), remaja sangat rentan dengan HIV/AIDS, oleh karena usia remajaProsiding Seminar Nasional, 13-14 Desember 2010 1229
  • 43. ISBN 978-602-98295-0-1identik dengan semangat bergelora, terjadi peningkatan libido. Selain itu resiko inidisebabkan faktor lingkungan remaja. Tabel.2. Resiko Kejadian HIV/AIDS Pada Sampel Menurut Umur dan Jenis Kelamin Di Kota Medan Tahun 2010.No Variabel Kasus Kontrol χ² OR N % n % (Nilai P) (CI 95%) 1 Umur :  15-24 Tahun 15 60,0 13 19,1 14,519 6,346  45- 64 Tahun 10 40,0 55 80,9 (0,000) (2,326- Jumlah 25 100 68 100 17,299).  25-34 Tahun 63 86,3 15 21,4 60,656 23,100  45- 64 Tahun 10 13,7 55 78,6 (0,000) (6,600 - Jumlah 73 100 70 100 55,586)  35-44 Tahun 27 73,0 32 36,8 13,633 4,641  45- 64 Tahun 10 27,0 55 63,2 (0,000) (1,991-10,818) Jumlah 37 100 87 100 2 Jenis 14,635 3,248 Kelamin: (0,000) (1,750-6,028).  Laki-laki 96 83,5 70 60,9  Perempuan 19 16,5 45 39,1 Jumlah 115 100 115 100 2. Jenis Kelamin. Dari hasil penelitian menunjukkan bahwa jumlah kasus HIV/AIDS lebihtinggi pada laki-laki sejumlah (83,5%), dibanding dengan perempuan sejumlah(16,5). Resiko laki-laki menderita HIV/AIDS jika dilihat dari nilai OR adalah 3,248kali lebih tinggi dari perempuan (Tabel.2). Hal ini sejalan dengan data prevalensiHIV/AIDS tahun 2003, dari 22 provinsi yang telah ada kasus HIV di Indonesiadiperoleh data bahwa penyebaran HIV/AIDS berdasarkan Gender, laki-laki 57,71%, dan perempuan 42,29 % (Notoadmojo,2007). Menurut Depkes RI (2010),Rasio Kasus AIDS antara laki-laki dengan perempuan adalah 3:1. MenurutWandoyo (2007) bahwa infeksi HIV sebagian besar (>80%) diderita oleh kelompokusia produktif (15-49 Tahun), terutama laki-laki. Akan tetapi jumlah penderitawanita cenderung meningkat. Resiko AIDS yang tertinggi pada pria homoseks,mungkin sekali kerena seringnya hubungan seksual dengan pasangan yangberbeda-beda. ( Noor , 1997).a. PekerjaanProsiding Seminar Nasional, 13-14 Desember 2010 1230
  • 44. ISBN 978-602-98295-0-1 Tabel.1. Memperlihatkan Proporsi Sampel yang tidak bekerja padakelompok Kasus HIV/AIDS (44,3%), wiraswasta (37,4%). PNS (0,9%). Hasil UjiBivariat (Tabel.3.)memperlihatkan Ada hubungan yang signifikan antara jenispekerjaan dengan HIV/AIDS P < 0,005. Bila dilihat dari besarnya nilai OR makaSampel yang tidak bekerja mempunyai resiko tertinggi untuk kemungkinanmenderita HIV/AIDS (OR=107,100), selanjutnya bekerja sebagai wiraswasta(OR=66,889), Pegawai Swasta (OR=32,308 ). Muninjaya (1999), menyebutkanbahwa HIV ditularkan oleh para Traveler (turis, nelayan asing), kepada kelompokPekerja Sex Komersial, kemudian menyebar kepada para pelanggan yangmenggunakan jasa meraka.b. Pendidikan Tabel.3. Resiko Kejadian HIV/AIDS Pada Sampel Menurut Pekerjaan dan Pendidikan Di Kota Medan Tahun 2010.No Variabel Kasus Kontrol χ² OR N % n % (Nilai P) (CI 95%) 1 Pekerjaan : A  Tidak 51 98,1 20 32,3 52,152 107,100 Bekerja (0,000) (13,795-  PNS 1 1,9 42 67,7 831,499) Jumlah 52 100 62 100 B  Wiraswasta 43 97,7 27 39,1 39,135 66,889  PNS 1 2,3 42 60,9 (0,000) (8,691-514,786) Jumlah 44 100 69 100 C  Pegawai 20 95,2 26 38,2 20,878 32,308 Swasta (0,000) (4,089-255,282)  PNS 1 4,8 42 61,8 Jumlah 21 100 68 100 2 Pendidikan: A  SD 9 81,8 2 10,0 15,989 40,500  PT/Akademi 2 18,2 18 90,0 (0,000) (4,876-336,401) Jumlah 11 100 20 100 B  SLTP 39 95,1 25 58,1 15,824 14,040  PT/Akademi 2 4,9 18 41,9 (0,000) (2,996-65,804) Jumlah 41 100 43 100 C  SLTA 65 97,0 70 79,5 10,330 8,357  PT/Akademi 2 3,0 18 20,5 (0,001) (1,866-37,431) Jumlah 67 100 88 100Ada hubungan yang bermakna antara pendidikan dan HIV/AIDS (p < 0,05). NilaiOR tertinggi pada sampel (Tabel.3.) berpendidikan SD (nilai OR = 40,500,),Sampel berpendidikan SLTP (OR =14,040), berpendidikan SLTA (OR =8,357).Prosiding Seminar Nasional, 13-14 Desember 2010 1231
  • 45. ISBN 978-602-98295-0-1Dari hasil analisis tersebut dapat disimpulkan bahwa semakin rendah pendidikansampel, maka semakin tinggi resiko menderita HIV/AIDS. Dalam masyarakat dimana taraf kecerdasan masih rendah, masyarakatbelum berpartisipasi dalam pencegahan penyakit dan baru mencari pemecahanpersoalan bila masalah sudah nyata (Entjang, 2002). tingkat pendidikan individudan masyarakat dapat berpengaruh terhadap penerimaan pendidikan kesehatanHerawani (2002), bahwa. Oleh sebab itu sosialisai (komunikasi, informasi danedukasi,pencegahan HIV/AIDS harus disesuaikan dengan tingkat pendidikanmasyarakat.c. Hubungan Sex Bebas Hasil penelitian Pada Tabel.4. Memperlihatkan bahwa ada hubunganyang signifikan antara hubungan sex bebas dengan HIV/AIDS (P=0,000). Resikosampel yang melakukan hubungan sex bebas 9,966 lebih tinggi menderitaHIV/AIDS dibandingkan dengan Sampel yang tidak melakukan hubungan sexbebas. Menurut data yang diperoleh dari Depkes RI (2010), cara penularanterbanyak HIV/AIDS melalui hubungan heterosexual (51,3%). Dengan semakinbanyaknya perilaku hubungan sex bebas, tempat pelacuran, serta kemiskinanmoral sangat berpotensi menularkan HIV. Adanya kebiasaan berganti-gantipasangan dan melakukan anal sex menyebabkan rentan tertular HIV (Duarsa,2007). Upaya pencegahan dapat dilakukan dengan menghindari hubungan sexberesiko, setia pada pasangan suami/istri. Tabel.4. Resiko Kejadian HIV/AIDS Pada Sampel Menurut Cara Penularan Di Kota Medan Tahun 2010.No Variabel Kasus Kontrol χ² OR N % N % (Nilai P) (CI 95%) 1 Hubungan Sex Bebas:  Ya 56 48,7 10 8,7 44,963 9,966  Tidak 59 51,3 105 91,3 (0,000) (4,733-20,985) Jumlah 115 100 115 100 2 Pemakaian Jarum Suntik Narkoba:  Ya 62 53,9 6 5,2 65,476 21,252  Tidak 53 46,1 109 94,8 (0,000) (8,641 -52,268) Jumlah 115 100 115 100 3 Transfusi Darah  Ya 2 1,7 7 6,1 2,891 0,273  Tidak 113 98,3 108 93,9 (0,089) (0,055-1,344) Jumlah 115 100 115 100Prosiding Seminar Nasional, 13-14 Desember 2010 1232
  • 46. ISBN 978-602-98295-0-13.6. Pemakaian Jarum Suntik Narkoba Ada hubungan pemakaian jarum suntik narkoba, dengan HIV/AIDS (P=0,000). Sampel Pemakai Jarum suntik narkoba kemungkinan 21,252 kali lebihtinggi menderita HIV/AIDS dibandingkan dengan sampel yang tidak menggunakanJarum suntik narkoba. Resiko penggunaan jarum suntik tidak steril/pemakaianbersama pengguna narkoba sekitar 0,5 – 1 % dan terdapat 5-10 % dari totalkasus sedunia. Depkes RI (2010) melaporkan cara penularan HIV/AIDS melaluiPengguna Narkoba Suntik/Panasun (39,6%). Di negara - negara Amerika Latin dilaporkan 7.215 kasus AIDS melandakaum muda berusia 20-49 tahun yang sebagian besar adalah kaum homoseksualdan pengguna obat-obat suntik (Wandoyo, 2007). Di beberapa negara sekitar 50% lebih pengguna narkotik dengan jarum suntik hidup dengan HIV/AIDS. Sekitar50-70 % pengguna narkotik suntik (penasun), telah terinfeksi HIV (Tanjung,2004). Remaja memerlukan perhatian, bimbingan dan pembinaan terhadapseluruh aspek kehidupan mereka, baik secara bio, psiko, social, budaya, danSpiritual.3.7. Melalui Transfusi Barah Hasil Analisis Bivariat hubungan transfusi darah dengan HIV/AIDSdiperoleh nilai p > 0,05 atau nilai p = (0,089), artinya tidak ada hubungan yangbermakna antara transfusi darah dengan HIV/AIDS pada sampel. Hal inikemungkinan karena penyediaan produk darah yang diberikan kepada sampeltelah diperiksa oleh Palang Merah Indonesia, dan bebas HIV. Berdasarkan Hasil akhir Uji Multivariat, diperohasil bahwa ada 4 variabelfaktor resiko yang dominan terhadap kejadian HIV/AIDS pada sampel di KotaMedan Yaitu : Pemakaian jarum suntik narkoba, hubungan sex bebas, pendidikan,dan pekerjaan.3.8. Kesimpulan Faktor resiko yang berhubungan secara signifikan (CI:(95%) terhadapkejadia HIV/AIDS pada sampel di Kota Medan Adalah: Pemakai jarum suntikProsiding Seminar Nasional, 13-14 Desember 2010 1233
  • 47. ISBN 978-602-98295-0-1narkoba, Hubungan sex bebas, Kelompok umur 15 – 24 tahun, 25-34 tahun, 35-44 tahun, jenis kelamin Laki-laki, sampel yang tidak Tidak bekerja mempunyairesiko lebih tinggi disbanding sampel yang bekerja, resiko pada sampel denganpendidikan yang lebih rendah menjadi HIV/AIDS lebih tingggi dibanding dengansampel berpendidikan tinggi. Faktor resiko yang dominan terhadap penularan HIV/AIDS di KotaMedan adalah: Pemakai jarum suntik narkoba, hubungan sex bebas, Pendidikan,dan Pekerjaan. DAFTAR PUSTAKADepkes RI, Dirjen P2M dan PL:2009 Statistik Umum HIV/AIDS di Indonesia. http//www./LP3Y.org/Content/AIDS/Sti.html.Depkes RI, Dirjen P2M dan PL:2010. Kasus HIV/AIDS di Indonesia sampai September 2010. http//www.Puskom Depkes @mail.com.Duarsa, W . 2007. Infeksi Menular Seksual, Balai Penerbit Fk-Ui.Jakarta.Entjang, Indan., 2000. Ilmu Kesehatan Masyarakat, PT.Citra Adiya Bakti, Bandung.Hastono, S.P., 2001. Modul Analisis Data . Fakultas Kesehatan Masyarakat Universitas Indonesia.Irianto, K. 2000. Gizi Dan Pola Hidup Sehat., Penerbit Yrama W idya. Jakarta.Muninjawa, G. 1999. Aids Di Indonesia Masalah Dan Kebijakan Penanggulangannya. Penerbit Buku Kedokteran Egc. Jakarta.Murti, B. 1997. Prinsip Dan Metode Riset Epidemiologi., Gadjah Mada University Press. Yogyakarta.Noor,N.N., 1997. Pengantar Epidemiologi Penyakit Menular. Penerbit Rineka Cipta. JakartaNotoadmodjo, S., 2007. Kesehatan Masyarakat Ilmu Seni., Penerbit Rineka Cipta. Jakarta.Nursalam, M., 2007. Asuhan Keperawatan Pada Pasien Terinfeksi Hiv/Aids. Penerbit Salemba Medika. Jakarta.Sudigdo, S. 2002. Dasar-Dasar Metode Penelitian Klinis. Edisi Kedua. Jakarta.Wadoyo, G.2007. Awas Hiv-Aids. Penerbit Dinamika Media. Jakarta.Tanjung, M., 2004. Kenali Kejahatan Narkoba Hiv-Aids. Lembaga Terpadu Pemasyarakatan Anti Narkoba. Jakarta.Prosiding Seminar Nasional, 13-14 Desember 2010 1234
  • 48. ISBN 978-602-98295-0-1REFINERY PRODUCED WASTEWATER TREATMENT BY PVDF COMPOSITE HOLLOW FIBER ULTRAFILTRATION Erna Yuliwatia,ba Advanced Membrane Technology Research Centre Universiti Teknologi Malaysia b Universitas Bina Darma ABSTRACT The aim of this study is to investigate the effect of surface- modified ofPVDF membranes by adding the hydrophilic additives for refinery producedwastewater treatment. This paper presents the results of a research on directclean water treatment using hollow fiber ultrafiltration equipment. The source ofwater is the synthetic refinery wastewater with mixed liquor suspended solids(MLSS) concentration of 3 g/l. All experiments were conducted at 25 oC and usingvacuum pump. The data were collected during a period of 72 h. Themorphological and performance tests were conducted on PVDF ultrafiltrationmembranes prepared from different additives concentrations. The cross- sectionalarea of the hollow fiber membranes was observed using a field emission scanningelectron microscope (FESEM). The surface wettability of porous membranes wasdetermined by measurement of contact angle. Mean pore size and surfaceporosity were calculated based on the permeate flux. The results also indicatedthat the PVDF composite membranes with lower additives concentration loadingpossessed smaller mean pore size, more apertures inside the membranes withenhanced membrane hydrophilicity. The flux and rejection of refinery wastewaterusing PVDF composite membranes achieved were improved and the system isready for field employment. INTRODUCTION Waterborne outbreaks of enteric diseases are a major public health concern,yet monitoring and identifying the disease-causing microorganism from watersamples remain difficult. Produced water is by far the largest contaminated streamresulting from thermal heavy oil recovery operations and its treatment and reuse isessential for the sustainability of oil sands processing [1]. Organic contaminants inproduced waters are toxic and corrosive leading to environmental and operationalproblems. From an environmental sustainability and perspective, it is necessary torecycle produced water and thus it must undergo proper treatment in order toavoid potentially negative impacts on drinking water supplies and aquaticProsiding Seminar Nasional, 13-14 Desember 2010 1235
  • 49. ISBN 978-602-98295-0-1organisms [2,3]. From an industrial standpoint, the different contaminants in theproduced water may adversely affect equipment leading to scaling and corrosion[4-6]. Many studies have been documented on the use of UF membranes fortreating oily wastewater [7-13]. These membranes were prepared from polymericmaterials such as cellulose acetate (CA), polysulfone (PSf), polyethersulfone(PES) incorporated with inorganic material such as alumina (Al2O3) and titaniumdioxide (TiO2). As these membranes were quite hydrophilic and displayedrelatively smaller pores, water which was free of oil or with reduced oil contentwere recovered as permeate. Polyvinylidene fluoride (PVDF) is one of the most extensively appliedmembrane material in UF system due to its outstanding antioxidation activity,excellent chemical resistance and thermal stability, highly organic selectivity, aswell as good mechanical and membrane forming properties. However, itshydrophobic nature, which often resulted in severe membrane fouling and declinedpermeability, has been a barrier to its application in water and wastewatertreatment [14]. In general, PVDF shows a good solubility in many common organicsolvents such as N,N-dimethylacetamide (DMAc), N,N-dimethylformamide (DMF),N-methyl pyrrolydone (NMP) and dimethylsulfoxide (DMSO). As a semi-crystallinepolymer, PVDF generally exhibits more complicated phase separation behaviourthan amorphous polymer [15]. These advantageous properties, coupled with itshydrophobicity, make it an outstanding membrane material particularly forindustrial wastewater treatment applications involving oily emulsion [16],organic/water separations [17,18], gas absorption and stripping [19,20], andmembrane distillation [21,22]. Although its hydrophobicity is favorable in promotingthe transport of the organic component of an organic/water feed solution, the neatPVDF membrane is liable to be contaminated and resulted in a dramaticdecreased of membrane water flux [23]. Many attempts have been carried out toimprove the hydrophilicity of PVDF membranes through various methods forinstance such as physical blending, chemical grafting, and surface modifications[24]. The effect of hydrophilic additives, i.e. LiCl and PVP, on thethermodynamic/kinetic relations during the phase inversion process in theProsiding Seminar Nasional, 13-14 Desember 2010 1236
  • 50. ISBN 978-602-98295-0-1preparation of PVDF-based membranes was investigated by Fontananova et al.[25]. In this study, the PVDF UF membranes have been fabricated by addition ofLiCl.H2O and TiO2 in various concentrations to modify membrane surfaceproperties and filtration performance. Surface wettability of membranes is usuallyexpressed in terms of contact angle for a liquid drop on the membrane surface tomeasure the tendency for liquid to wet of the membrane surface. Pore size,porosity, and elemental composition analysis of the PVDF UF membranes wereinvestigated. The surface and inner structures of the sample membranes werestudied using field emission scanning electron microscope (FESEM) and energydispersive x-ray (EDX) apparatus. The pretreatment used phytoremediation is anemerging cleanup technology for contaminated wastewater. The performance forrefinery wastewater treatment was characterized by pure water flux and rejectionefficiency of refinery wastewater. EXPERIMENTAL2.1. Materials Ultrafiltration membranes have been prepared using Kynar ®740 PVDFpolymer pellets were purchased from Arkema Inc. Philadelphia, USA. The solventN,N-dimethylacetamide (DMAc, Aldrich Chemical) (Synthesis Grade, Merck,>99%) was used as polymer solvent without further purification. Lithium chloridemonohydrate (LiOH.H2O) and nanoparticles titanium dioxide (TiO2) were used asinorganic additives. Both chemical additives were purchased from Sigma-Aldrichand used as received. Glycerol was purchased from MERCK (Germany) and usedas non solvent for post treatment of membrane. In all cases, tap water was usedas the external coagulation bath medium in the spinning process.2.2. Preparation Of PVDF Spinning Dopes An amount of pre-dried (24 h oven dried at 50 oC) PVDF pellets was weighedand poured into pre-weighed DMAc solvent. The mixture was stirred to ensurethorough wetting of polymer pellets, prior to the addition of appropriate amounts ofLiCl.H2O at 50 oC. TiO2 was then added to the polymer dope mixtures which werecontinuously stirred for 48 h (IKA-20-W) at 500 rpm until a homogenous solutionProsiding Seminar Nasional, 13-14 Desember 2010 1237
  • 51. ISBN 978-602-98295-0-1was formed. The polymer solution was kept in a glass bottle and air bubblesformed in the dope were removed using water aspirator for several hours. The fullydissolved polymer solution was transferred to a stainless steel reservoir, allowedto stand and degassed for 24 h at room temperature prior to spinning process.Solution viscosity was measured using rheometer (Bohlin Instrument Ltd.) atvarious temperatures between 25 and 50 oC.2.3. Membrane Preparation PVDF hollow fiber UF membranes were spun at room temperature by a dry-jet wet spinning method. The spinning solutions were divided into two batches.First batch consisted of different PVDF concentration ranging from 16 to 22 wt.%.The second one was prepared from 19 wt.% PVDF in DMAc at different TiO 2concentration (0, 5, 10, 15, 20 wt.%) and LiCl.H2O was maintained at 5.2 wt % ofthe weight of PVDF, as shown in Table 1 respectively. Table 1. Membrane composition Sample PVDF wt. % TiO2 wt. % LiCl.H2O wt. % PTL-0 19 0 0.98 PTL-5 19 1 0.98 PTL-10 19 1.95 0.98 PTL-15 19 2.85 0.98 PTL-20 19 3.8 0.98 The hollow fiber spinning process by dry-jet wet phase inversion wasexplained elsewhere. The detailed spinning parameters are listed in Table 2. Table 2. The detailed spinning condition Dope extrusion rate (ml/min) 4.20 Bore fluid H2O Bore fluid flow rate (ml/min) 1.40 External coagulant Tap water Air gap distance (cm) 1 cm Spinneret o.d./i.d. (mm) 1.10/0.55 Coagulation temperature (oC) 25Prosiding Seminar Nasional, 13-14 Desember 2010 1238
  • 52. ISBN 978-602-98295-0-1 In general, the polymer solution was pressurized through spinneret withcontrolled extrusion rate, while internal coagulant was adjusted at 1.4 ml/min. Thehollow fiber emerged from the tip of the spinneret was guided through the twowater baths at a take up velocity 13.7 cm/s, carefully adjusted to match free fallingvelocity before landed in a final collection bath to complete the solidificationprocess. The spun hollow fibers were immersed in the water bath for a period of 3days, with daily change of the water, to remove the residual DMAc and theadditives. The hollow fibers were then post-treated using 10 wt.% glycerolaqueous solution as non solvent exchange for 1 day in order to minimize fibershrinkage and pores collapse. After the fibers were dried for 3 days, they wereready for making hollow fiber test modules.2.4. Membrane Characterizations The morphology of the membrane was observed by field emission scanningelectron microscope (FESEM) (JEOL JSM-6700F). The FESEM micrographs weretaken at certain magnifications. It produced photographs at the analytical workingdistance of 10 nm. Surface composition analysis was carried out on energydispersive x-ray (EDX) (JEOL JSM-6380LA). The static contact angle of membrane was measured by the sessile dropmethod using a DropMeter A-100 contact angle system (Maist Vision Inspection &Measurement Co. Ltd.) to characterize the membrane wetting behaviour. A waterdroplet at 3 µL was deposited on the dry membrane using a microsyringe. Amicroscope with a long working distance 6.5x objectives was used to capturemicrographs.2.5 Permeation flux and rejection of refinery wastewater measurements The permeation flux and rejection of PVDF hollow fiber membranes weremeasured by submerged ultrafiltration experimental equipment as shown in Fig. 1.An in-house produced U-shape hollow fiber bundle, with a filtration area of 11.42cm2, was submerged in prepared suspension in membrane reservoir with volumeof 14 L. A cross-flow stream was produced by air bubbling generated by a diffusersituated underneath the submerged membrane module for mechanical cleaning ofthe membrane bundle. The air bubbling flow rates per unit projection membranearea was set constantly at 1.8 L/min in order to maintain proper turbulence. TheProsiding Seminar Nasional, 13-14 Desember 2010 1239
  • 53. ISBN 978-602-98295-0-1filtration pressure was supplied by a vacuum pump. Permeate flow rates werecontinually recorded using flow meter respectively. The rejection test was carried out with distilled water and synthetic refinerywastewater with mixed liquor suspended solid (MLSS) concentration of 3 g/L. Allexperiments were conducted at 25 OC. Firstly, the pure water permeation flux (Jw)was measured using prepared PVDF submerged membrane under reducedpressure (0.5 bar absolute) on the permeate side. Finally, the permeationmeasurement with refinery wastewater (JR) and rejection (R) were measuredunder reduced pressure on the permeate side. Figure 1. Schematic diagram of submerged ultrafiltration Pure water flux was measured after the flux was steady, then calculated as V F= At(1)where F is the pure water flux (L/m2 h), V is the permeate volume (L), A is themembrane surface area (m2), and t is the time (h). Rejection (R) was characterized with a synthetic refinery wastewater afterthe membrane was previously filtered with pure water until the flux became steady.The synthetic refinery wastewater was an in-house synthesized and consisted offresh water, hydraulic oil, diesel fuel, surfactant, and carbon black in propercomposition, based on mixed liquor suspended solid (MLSS) measurement 3 g/Land UV wavelength 2.6 cm-1. It was calculated asProsiding Seminar Nasional, 13-14 Desember 2010 1240
  • 54. ISBN 978-602-98295-0-1 cp R = (1- ) x 100 cf(2)where R is the rejection ultrafiltration process (%), cp is the concentration of thepermeate (%) and cf is the concentration of the feed (%).3. Results and discussions3.1. Effect of additives concentration on the structural and physical properties ofPVDF membranes3.1.1. Morphological studies of PVDF membranes Fig. 2 shows the FESEM micrographs of the PVDF ultrafiltrationmembranes prepared using different concentrations of TiO2 at a constantconcentration of LiCl.H2O. Improvement of membrane morphology occurs withsmall amount addition of TiO2 nanoparticles. TiO2 nanoparticles have high specificareas and good hydrophilicity, which will affect the mass transfer during thespinning process. The cross-section morphology of PVDF UF membranes indicated that thefinger-like macrovoids extended from both inside and outside of the membranesand caused suppression in an intermediate spongy substructure at lower TiO 2concentration, as illustrated in Fig. 2(b-c). However, with further increasing TiO2concentration it was observed that the intermediate and the outer and innermembrane layer have been changed significantly. The long finger-like structurebecame shorter at the both outer and inner layer of membrane and theintermediate layer presented a thicker sponge-like structure, whereas in Fig. 2(d-e). These results can be explained on the basis of the delayed liquid-liquiddemixing process, which could be attributed to the higher viscosity and lowerphase-inversion rate of the spinning dope. Therefore, the kinetic hindrance due toviscosity overcomes the thermodynamic factor and thus resulted in the formationof thick sponge-like layer. Moreover, formation of few drop cavities in the sponge-like layer was also associated to the slow solidification process during phaseinversion. The higher TiO2 concentration induced also an aggregate phenomenon andabsorbed into the substructure of PVDF UF membrane. Those aggregates blockedProsiding Seminar Nasional, 13-14 Desember 2010 1241
  • 55. ISBN 978-602-98295-0-1the pores and caused the decreased of the average pore size. This result wasattributed to the porous structure and possible hydrophilicity of the TiO2nanoparticles. It indicates that hydrophilicity of nanoparticles TiO 2 was directlycorrelated with porosity and might be responsible for the higher liquid uptake. (a) (b) (c)Prosiding Seminar Nasional, 13-14 Desember 2010 1242
  • 56. ISBN 978-602-98295-0-1 (d) (e) Figure 2. FESEM images of prepared PVDF membranes3.1.2. Porosity And Surface Wettability Studies Of PVDF UF Membranes The membranes were characterized in terms of surface wettabilitymeasurement. The results are shown in Fig. 3. Surface wettability is one of theimportant membranes properties which could affect the flux and antifouling abilityof membranes. As presented in Fig. 3, it was found that contact angle of PVDF UFmembranes decreased significantly with increasing TiO2 concentration above 1.95wt.%, then increased with further increasing TiO2 content. The decreased contactangle indicates the decrease in effective hydrophilic area and hydroxyl groupnumber. The hydrophilic TiO2 particles, which contained hydroxyl groups andadsorbed on the membrane surface, were responsible for increased hydrophilicity.Thus, it might be considered that hydrophilicity was the most important factoramong the membrane performances [26].Prosiding Seminar Nasional, 13-14 Desember 2010 1243
  • 57. ISBN 978-602-98295-0-1 100 Contact angle (o) 80 60 40 20 0 0 1 1.95 2.85 3.8 TiO2 content (wt. %) Figure 3. Contact angle with water of the PVDF composite membrane and standard deviation on measurement in different regions of the membrane surface3.2. Effect of Additives Concentration on the Performance of PVDFMembranes As shown in Fig. 4, PTL-10 membranes showed the flux peak value of82.49 L/m2 h when TiO2 concentration were at 1.95 wt.% and decreased withfurther increasing TiO2 concentration. The values of rejection demonstrated thesimilar trend to the flux, which increased to the peak value 98.8 % at 1.95 wt.%TiO2 concentration then decreased with further increasing TiO 2 concentration. Thehydrophilicity TiO2 particles on the membrane surface reduced the interactionbetween contaminants and the membrane surface. The increased membranehydrophilicity and membrane pore size with lower TiO2 concentration (≤1.95 wt.%)could attract water molecules inside the composite membrane; facilitated theirpenetration through the membrane, enhancing the flux and rejection. However,higher TiO2 concentration (> 1.95 wt.%) resulted in the formation of a highlyviscous dope. This slowed down the formation process of PVDF UF membranesand produced a compact sublayer, as shown in Fig. 4. Moreover, the enhancedflux and rejection values were also developed due to air bubbling flow rate per unitprojection membrane area. This was set constantly in order to maintainProsiding Seminar Nasional, 13-14 Desember 2010 1244
  • 58. ISBN 978-602-98295-0-1turbulence, increase mass transfer coefficient, decrease oil droplets andsuspended solid concentrating on the membrane surface, and weakens the effectof polarization. 100 140 120 80 R, (JR /Jw) % 100 J (L/m 2 h) 60 80 60 40 Jw 40 JR R 20 20 JR/ Jw 0 0 0 0.95 1.95 2.8 3.85 TiO2 wt % Figure 4. Effect of the TiO2 concentration on permeation flux and rejection The antifouling properties of PVDF ultrafiltration membranes could beevaluated by the ratio of refinery wastewater flux (JR) and pure water flux (JW). Forthe higher antifouling submerged UF membrane, the feed of refinery wastewaterwould cause a small flux loss and the ratio (JR/JW) would be higher. Fig. 4 alsoshows that initially, the ratio (JR/JW) is increased sharply and reached the highestpeak of 1.95 wt.% TiO2 concentration. However, higher TiO2 concentration,namely, 2.8 and 3.95 wt.% TiO2, resulted the decreased value of the ratio (JR/JW).The membrane surface hydrophilicity was improved significantly and reduced theinteraction between the contaminants and the membrane surface, then effectivelyimproved the antifouling properties. However, the ratio (JR/JW) of PVDF UFmembranes decreased slightly at >1.95 wt.% TiO2 concentration until the foulingphenomenon disappeared at 3.85 wt.% TiO2 concentration. As the hydrophilicadditives content in the membrane increased the decrement of ratio (J R/JW)became gradually less, but it still indicated that the antifouling properties of theProsiding Seminar Nasional, 13-14 Desember 2010 1245
  • 59. ISBN 978-602-98295-0-1PVDF UF membranes were promising by adding of the inorganic additivesLiCl.H2O and TiO2.4. Conclusions PVDF UF membranes were fabricated via a dry-jet wet spinning method.Various concentrations of TiO2 at constant value of LiCl.H2O were used asinorganic additives in the spinning dopes in order to improve the phase-inversionrate and provide porous asymmetric membranes with advanced structure forrefinery produced wastewater treatment. Several characterizations andmeasurement techniques such as membrane structure, surface wettability,porosity, average pore size, and permeability were utilized to evaluate finestructural details of the membrane and membrane performance. Refineryproduced wastewater filtration was conducted through in-house prepared PVDFhollow fiber ultrafiltration membranes. FESEM analysis indicated that 19 wt.%PVDF concentration had suppressed both inner and outer membrane surfacefinger-like macrovoids with slightly denser skin layer which decreased masstransport resistance. Addition of 1.95 wt.% TiO2 nanoparticles resulted in smallernanoparticles which in turn achieved higher hydrophilicity, small pore size, andhigh porosity. Permeability test results illustrated that LiCl.H2O and TiO2nanoparticles affected the PVDF UF membranes performance remarkably.Significantly higher flux and rejection of refinery wastewater were observed.Furthermore, the achieved filtration performance was indicated that approximately18.3 % flux reduction was gradually occurred within the first 18 h before becameconstant until the end of the filtration operation. REFERENCESJ.F. Kong, K. Li, Oil removal from oil-in-water emulsions using PVDF membranes, J. Membr. Sci., 16 (1999), pp. 83-93.S.P. Deshmukh, K. Li, Effect of ethanol composition in water coagulation bath on morphology of PVDF hollow fibre membranes, J. Membr. Sci., 150 (1998), pp. 75-85.K. Jian, P.N. Pintauro, Asymmetric PVDF hollow fiber membranes for organic/water pervaporation separations, J. Membr. Sci., 135 (1997), pp. 41-53.Prosiding Seminar Nasional, 13-14 Desember 2010 1246
  • 60. ISBN 978-602-98295-0-1A.W. Zularisam, A.F. Ismail, and M.R. Salim, Behavior of natural organic matter (NOM) in membrane filtration for surface water treatment: A review, Desalination, 194 (1-3) (2006), pp. 211-231.M. Tomaszewska, Preparation and properties of flat sheet membranes from polyvinylidenefluoride for membrane distillation, Desalination, 104 (1996), pp. 1-11.M. Khayet, T. Matsuura, Preparation and characterization of polyvinylidene fluoride membranes for membrane distillation, Ind. Eng. Chem. Res., 40 (2001), pp. 5710-5718.M. Khayet, C.Y. Feng, K.C. Khulbe, T. Matsuura, Study on the effect of a non- solvent additive on the morphology and performance of ultrafiltration hollow fibre membranes, Desalination, 148 (2002), pp. 321-327.S. Chabot, C. Roy, G. Chowdhury, T. Matsuura, Development of poly(vinylidene fluoride) hollow fiber membranes for the treatment of water/organic vapor mixtures, J. Apply. Polym. Sci., 65 (1997), pp. 1263-1270.W.D. Benzinger, B.S. Parekh, J.L. Eichelberger, High temperature ultrafiltration with Kynar poly(vinylidene fluoride) membranes, Sep. Sci. Technol., 15 (4) (1980), pp. 1193-1204.X.C. Cao, J. Ma, X.H. Shi , Z.J. Ren, Effect of TiO2 nanoparticle size on the performance of PVDF membrane, Apply. Surf. Sci., 253 (2006), pp. 2003- 2010.J. Bush, A. Cruse, W. Marquardt, Modelling submerged hollow-fiber membrane filtration for wastewater treatment, J. Membr. Sci., 288 (2007), pp. 94-111.C.H. Lu, W. H. Wu, R. B. Kale, Microemulsion-mediated hydrothermal synthesis of photocatalytic TiO2 powders, J. Hazard. Mat., 154 (2008), pp. 649-654.M.L. Hami, M.A. Al-Hasyimi, M.M. Al-Doori, Effect of activated carbon of BOD and COD removal in a dissolved air flotation unit treating refinery wastewater, Desalination, 216 (2007), pp.116-122.M.X. Loukidou, A.I.Zouboulis, Comparison of two biological treatment processes using attached growth biomass of sanitary landfill leachate treatment, Environ. Pollut., 111 (2001), pp. 273-281.J. Busch, A.Cruse, W. Marquadt, Modelling submerged hollow fiber filtration for wastewater treatment, J. Membr. Sci., 288 (2007), pp. 94-111.C.J. Jou, G.C. Huang, A pilot study for oil refinery wastewater treatment using a fixed film bioreactor, Adv. Environ. Res., 7 (2002), pp. 463-469.Prosiding Seminar Nasional, 13-14 Desember 2010 1247
  • 61. ISBN 978-602-98295-0-1Z. Yuan, X.D. Li, Porous PVDF/TPU blends asymmetric hollow fiber membranes prepared with the use of hydrophilic additive PVP (K30), Desalination, 223 (2008), pp. 438-447.T.H. Bae, I.C. Kim, T.M. Tak, Preparation and characterization of fouling-resistant TiO2 self-assembled nanocomposite membrane, J. Membr. Sci., 275 (2006), pp. 1-5.A. Bottino, G. Capanelli, S. Munari, A. Turturro, High performance ultrafiltration membranes cast from LiCl doped solution, Desalination, 68 (1998), pp. 167- 177.W.J. Lau and A.F. Ismail, Theoritical studies on the morphology and electrical properties of blended PES/SPEEK nanofiltration membranes using different sulfonation degree of SPEEK, J. Membr. Sci., 334 (2009), pp. 30-42.Z. Wang, Y.W. Lu, S.M. Wang, Study on the preparation and characterizatics of PVDF/CA blend ultrafiltration membrane, J. Membr. Sci., 22 (6) (2002), pp. 4-8.Y.J. Wang, D.J. Kim, Crystallinity, morphology, mechanical properties and conductivity study of in situ formed PVDF/LiClO4/TiO2 nanocomposite polymer electrolytes, Electrochimica Acta, 52 (2007), pp. 3181-3189.A. Bottino, G. Capanelli, S. Munari, A. Turturro,Effect of coagulation medium properties of sulfonated polyvinylidene fluoride membranes, J. Apply. Polym. Sci., 30 (1985), pp. 3009-3022.Z.H. Xu, L. Li, F.W. Wu, S.J. Tan, Z.B. Zhang, The application of the modified PVDF ultrafiltration membranes in further purification of Ginkgo biloba extraction, J. Membr. Sci., 255 (2005), pp. 125-131.E. Fontananova, J.C. Jansen, A. Cristiano, E. Curcio, E. Drioli, Effect of additives in the casting solution on the formation of PVDF membranes, Desalination, 192 (2006), pp. 190-197.Z.P. Fang, Y.Z. Xu, C.W. Xu, Modification mechanism of nanoparticles on polymers, J. Mater. Sci. Eng., 21 (2) (2003), pp. 279-282.Prosiding Seminar Nasional, 13-14 Desember 2010 1248
  • 62. ISBN 978-602-98295-0-1 IDENTIFIKASI GEN mecA PADA ISOLAT KLINIK Staphylococcus aureus DI RUMAH SAKIT MOHAMMAD HOESIN (RSUP MH) PALEMBANG VENNY PATRICIA Departemen Mikrobiologi Klinik, Fakultas Kedokteran/RSUP MH Palembang Universitas Sriwijaya, Palembang ABSTRAKPendahuluan : Resistensi terhadap berbagai antimikroba dan spektrum infeksidari Methicillin Resistant Staphylococcus aureus (MRSA) masih merupakanmasalah kesehatan serius di seluruh dunia. Resistensi bakteri MRSA disebabkanoleh karena bakteri ini memiliki protein mutan penicillin-binding protein 2a (PBP2a)yang disandi oleh gen mecA. Bahan dan Metode: Spesimen yang digunakanpada penelitian ini adalah sampel swab dari semua pasien infeksi bakterial dirawat jalan dan rawat inap di RSUP Dr. Moh. Hoesin Palembang yang diambil daribulan Mei dan Juni 2010. Penelitian ini ditujukan untuk mengidentifikasi gen mecAdengan cara PCR. Hasil : Didapatkan total isolat Staphylococcus aureussebanyak 80 sampel 23 (28,8%) didapatkan isolat murni S. aureus. 5 (6,3%) isolatbercampur dengan infeksi bakteri Pseudomonas aeruginosa, 5 (6,3%) isolatdengan Klebsiella pneumoniae, 3(3.8%) isolate dengan Acinetobactercalcoaceticus, 2 (2.5%) isolat dengan Eschericia coli, 2(2.5%) isolat denganProteus mirabilis, 3(3.8%) isolat dengan Candida glabrata, 2 (2.5%) isolat denganK. pneumoniae dan C. albicans, Masing-masing 1(1.25%) isolat denganEnterococcus agglomerans, Streptococcus bovis dan Streptococcus saprofiticus.Deteksi gen MecA dinyatakan positif dari 51 (63.8%) sampel yangmengindikasikan sebagai MRSA, sedangkan 29 (36.3%) dinyatakan sebagaiMSSA.Kata Kunci : mecA, MRSA, MSSA PENDAHULUAN Dalam kurun waktu ± 50 tahun ini terdapat peningkatan angka penderitapenyakit nfeksi yang disebabkan oleh mikroorganisme resisten terhadap berbagaiagen antibiotic. Dalam hal ini resisten terhadap berbagai antimikroba danspektrum infeksi dari Methicillin Resistant Staphylococcus aureus (MRSA) masihmerupakan masalah kesehatan serius di seluruh dunia. Resistensi bakteri MRSAProsiding Seminar Nasional, 13-14 Desember 2010 1249
  • 63. ISBN 978-602-98295-0-1disebabkan oleh karena bakteri ini memiliki protein mutan penicillin-binding protein2a (PBP2a) yang disandi oleh gen mecA. Penelitian ini ditujukan untukmengidentifikasi gen mecA dari isolat klinik pada sampel pasien di Rumah SakitUmum Moh. Hoesin Palembang(1-5) BAHAN Spesimen yang digunakan pada penelitian ini adalah sampel swab darisemua pasien infeksi bakterial di rawat jalan dan rawat inap di RSUP Dr. Moh.Hoesin Palembang yang diambil dari bulan Mei dan Juni 2010. METODOLOGI Penelitian ini merupakan penelitian deskriptif untuk untuk mengidentifikasigen mecA pada Isolat MRSA. Tahapan penelitian berupa: pengumpulanspesimen, pembiakan S. aureus dan uji kepekaan terhadap antimikroba untukmenentukan galur MRSA, isolasi DNA dan PCR.(6)Prosiding Seminar Nasional, 13-14 Desember 2010 1250
  • 64. ISBN 978-602-98295-0-1 Gambar 1. Bagan Tahap Penelitian Primer Strategies of Multiplex PCR Kompleks ccr Kompleks mec pls Tn554 Primer Sekuen Oligonukleotida (5-3) Amplikon Spesifitas Type I-F GCTTTAAAGAGTGTCGTTACAGG 613 bp SCCmec I Type I-R GTTCTCTCATAGTATGACGTCC Type II-F CGTTGAAGATGATGAAGCG 398 bp SCCmec II Type II-R CGAAATCAATGGTTAATGGACC Type III-F CCATATTGTGTACGATGCG 280 bp SCCmec III Type III-R CCTTAGTTGTCGTAACAGATCG Type IVa-F GCCTTATTCGAAGAAACCG 776 bp SCCmec IVa Type IVa-R CTACTCTTCTGAAAAGCGTCG Type IVb-F TCTGGAATTACTTCAGCTGC 493 bp SCCmec IVb Type IVb-R AAACAATATTGCTCTCCCTC MecA147-F GTG AAG ATA TAC CAA GTG ATT 147 bp mecA MecA147-R ATG CGC TAT AGA TTG AAA GGA T 41 Mei 2010 Gambar 2. Beberapa alternatif Primer yang digunakan untuk PCR Siklus PCR Multipleks Denaturasi 10 siklus 25 Siklus 94 C 94 C 94 C 5 45" 45" 72 C 72 C 72 C 90" 90" 10 65 C 45" 55 C 45" 4 C Amplifikasi dilakukan dalam mesin i-cycler Biorad (Biorad 42 System, USA) Mei 2010 Gambar 3. Siklus PCRProsiding Seminar Nasional, 13-14 Desember 2010 1251
  • 65. ISBN 978-602-98295-0-1Hasil Penelitian Gambar 4. Indentifikasi gen mecA yang ditunjukkan pada 147 bp dari sampel 1-10 Gambar 5. Indentifikasi gen mecA yang ditunjukkan pada 147 bp dari sampel 11-26 Gambar 6. Indentifikasi gen mecA yang ditunjukkan pada 147 bp dari sampel 27-41Prosiding Seminar Nasional, 13-14 Desember 2010 1252
  • 66. ISBN 978-602-98295-0-1 Gambar 7. Indentifikasi gen mecA yang ditunjukkan pada 147 bp dari sampel 42-60 Gambar 8. Indentifikasi gen mecA yang ditunjukkan pada 147 bp dari sampel 61-80 Didapatkan total isolat Staphylococcus aureus sebanyak 80 sampel 23(28,8%) didapatkan isolat murni S. aureus. 5 (6,3%) isolat bercampur denganinfeksi bakteri Pseudomonas aeruginosa, 5 (6,3%) isolat dengan Klebsiellapneumoniae, 3(3.8%) isolat dengan Acinetobacter calcoaceticus, 2 (2.5%) isolatdengan Eschericia coli, 2(2.5%) isolat dengan Proteus mirabilis, 3(3.8%) isolatdengan Candida glabrata, 2 (2.5%) isolat dengan K. pneumoniae danC. albicans, Masing-masing 1(1.25%) isolat dengan Enterococcus agglomerans,Streptococcus bovis dan Streptococcus saprofiticus.Prosiding Seminar Nasional, 13-14 Desember 2010 1253
  • 67. ISBN 978-602-98295-0-1Metode definitif untuk mengetahui resistensi S. aureus terhadap antimikrobagolongan betalaktam pada penelitian ini adalah dengan mendeteksi adanya genmecA dengan menggunakan metode molekuler yaitu PCR. Ekstraksi DNAdilakukan pada semua isolat S. aureus menggunakan metode Chelex Resin DNAEkstraction didapatkan DNA yang menjadi template bagi reaksi PCR. IdentifikasiMRSA dengan mendeteksi keberadaan gen mecA yaitu amplikon sebesar 147 bp.Hasil yang didapatkan menunjukkan isolat S. aureus yang dinyatakanpositif memiliki gen mecA sebesar 51 (63.8%) sampel dan diindikasikan sebagaiMRSA, sedangkan 29 (36.3%) dinyatakan hasil yang negatif dan diindikasikansebagai MSSA.(3-5) MRSA yang juga dikenal dengan sebutan Healthcare Acquired MRSA atauHealthcare Associated MRSA (HA-MRSA), menyebar dengan cepat ke seluruhrumah sakit di dunia dan menunjukkan fenotip multiresisten yaitu resistenterhadap semua antimikroba betalaktam dan terhadap dua atau lebih antimikrobagolongan nonbetalaktam.(7) Obat pilihan untuk terapi infeksi MRSA adalahvankomisin.(8) Prevalensi MRSA di dunia telah banyak diteliti, namun hasilnyasangat bervariasi dari 2% di Belanda dan Swiss sampai prevalensi 70% di Jepangdan Hongkong.(9) Bila dibandingkan dengan penelitian multisenter di beberapakota di Indonesia (2008) didapatkan rerata prevalensi MRSA dari isolate specimenS. aureus lebih dari 30% yaitu Jakarta (54%), Semarang (36%), Surabaya (35%),dan Yogyakarta (31%).(10) Kemungkinan perbedaan ini disebabkan penelitianmultisenter MRSA tersebut meliputi berbagai spesimen klinis isolat S. aureus. KESIMPULANPrevalensi infeksi MRSA di RSUP MH Palembang masih tergolong tinggi, sekitar63,8%. DAFTAR PUSTAKALowy FD. 1998. Staphylococcus aureus infection. N Engl J Med. 339:520-532.Chambers HF.1997. Methicillin resistant in staphylococci: molecular and biochemical basis and clinical implications. Clin Microbiol Rev. 10:781-9.Nevio Cimolai. 2002. Methicillin Resistant Staphylococcus aureus (MRSA) andProsiding Seminar Nasional, 13-14 Desember 2010 1254
  • 68. ISBN 978-602-98295-0-1Community-Associated MRSA: Are all MRSA made equal? Clin J Microbiol. 48: 560-566.Chambers HF. Community-Associated MRSA — Resistance and Virulence Converge. N Engl J Med 2005; 352:1485.Brown D, and Cookson B. 2003. Detection of MRSA, p 11-30. In Fluit Ad C, and Franz-Josef Schitz (editors), MRSA: Current perspectives. Caister Academic Press, Norfolk England.Fey PD, Salim BS, Rupp ME, Hinrichs SH, Boxrud DJ, Davis CC, Kreiswirth BN, Schlievert PM. Comparative molecular analysis of community or hospital- acquired methicillin-resistant Staphylococcus aureus. Antimicrob Agents Chemother 2003; 47: 196-203.Lowy FD. Antimicrobial resistance : the example of Staphylococcus aureus. J Clin Invest 2003; 111:1265-73.Trakulsomboon S, Danchaivijitr S, RongrungruangY, Dhiraputra C, Susaemgrat W, Ito T, Hiramatsu K. First report of Methicillin resistant Staphylococcus aureus reduced susceptibility to vancomycin in Thailand. J Clin Microbiol. 2001; 39:591-95.Saikia L, Nath R, Choudhury B, Sarkar M. 2009. Prevalence and Antimicrobial Susceptibility Pattern of Methicillin Resistant Staphylococcus Aureus in Assam. Indian J Crit Care Med, 13: 156-158Santosaningsih D, Santoso S, Widodo A, Kuntaman, Suata K, Severin J, Verbrugh H. Methicillin Resistant Staphylococcus Aureus (MRSA) among Clinical Isolates in Indonesia, a multicenter survey. Available from: http://www.isssi2008.com.abstract/132.asp.Prosiding Seminar Nasional, 13-14 Desember 2010 1255
  • 69. ISBN 978-602-98295-0-1 FAKTOR – FAKTOR YANG BERHUBUNGAN DENGAN KEJADIAN ATONIA UTERI PADA IBU POST PARTUM DI RUMAH SAKIT UMUM PUSAT Dr. MOHAMMAD HOESIN PALEMBANG TAHUN 2009 Nesi Novita Dosen Jurusan Kebidanan Poltekkes Kemenkes Palembang ABSTRAK World Health Organization (WHO) memperkirakan di seluruh dunia setiaptahun lebih dari 585 ribu ibu meninggal pada saat hamil atau bersalin. Di negaraberkembang ada lima penyebab utama kematian ibu yaitu perdarahan, sepsis,hipertensi akibat kehamilan, aborsi yang tidak aman dan persalinan macet. DiIndonesia penyebab langsung kematian ibu tertinggi karena perdarahan sebesar30% terutama perdarahan post partum yaitu atonia uteri. Tujuan penelitian adalahuntuk mengetahui faktor – faktor yang berhubungan dengan kejadian atonia uteridi Rumah Sakit Umum Pusat Dr. Mohammad Hoesin Palembang tahun 2010.Metode penelitian yang digunakan survei analitik dengan pendekatan crosssectional. Populasi penelitian adalah semua ibu bersalin yang mengalamiperdarahan post partum yang tercatat di rekam medik Rumah Sakit Umum PusatDr. Mohammad Hoesin Palembang tahun 2009. Sampel dalam penelitian inisebanyak 70 orang. Pengumpulan data dilakukan dengan menggunakan checklist.Untuk mengetahui faktor – faktor yang berhubungan dengan kejadian atonia uteridigunakan uji statistik Chi – Square dengan tingkat kemaknaan α = 0,05.Hasil penelitian didapatkan ada hubungan yang bermakna antara paritas danatonia uteri, ada hubungan yang bermakna antara umur dengan atonia uteri, adahubungan yang bermakna antara jarak kelahiran dengan atonia uteri. Saran yangdiberikan pada ibu hamil hendaknya dapat memeriksakan kehamilannya secararutin dan melahirkan pada tenaga kesehatan sehingga kejadian atonia uteri dapatdi deteksi secara dini khususnya pada ibu yang mempunyai risiko untukmengalami atonia uteri.Kata Kunci : kejadian atonia uteri PENDAHULUAN Kematian ibu adalah kematian seorang wanita yang terjadi selamakehamilan sampai dengan 42 hari sesudah berakhirnya kehamilan, disebabkanoleh apapun yang berhubungan dengan kehamilan atau penanganannya, tetapitidak secara kebetulan atau oleh penyebab tambahan lainnya. Angka KematianIbu (AKI) merupakan barometer pelayanan kesehatan ibu di suatu negara. BilaProsiding Seminar Nasional, 13-14 Desember 2010 1256
  • 70. ISBN 978-602-98295-0-1AKI masih tinggi berarti pelayanan kesehatan ibu belum baik, sebaliknya bila AKIrendah berarti pelayanan kesehatan ibu sudah baik (Winkjosastro, 2006). World Health Organization (WHO) memperkirakan di seluruh dunia setiaptahun lebih dari 585 ribu ibu meninggal pada saat hamil atau bersalin. Di negaraberkembang ada lima penyebab utama kematian ibu yaitu perdarahan, sepsis,hipertensi akibat kehamilan, aborsi yang tidak aman dan persalinan macet(Varney, 2008). Hasil Survei Demografi Kesehatan Indonesia (SDKI) pada tahun 2007menyatakan AKI di Indonesia tercatat 248 orang / 100.000 kelahiran hidup. Angkakematian tersebut lebih rendah dari AKI di tahun sebelumnya yang tercatatmencapai di atas 300 orang / 100.000 kelahiran hidup. Sedangkan menurut SDKItahun 2008/2009 menyatakan bahwa AKI di Indonesia adalah 202 orang / 100.000kelahiran hidup atau setiap jam terdapat 2 orang ibu meninggal dunia akibatpersalinan (Depkes, 2008). Angka – angka diatas menunjukkan bahwa AKI diIndonesia masih cukup tinggi walaupun dari tahun ke tahun terdapat penurunan(Untoro, 2008). Millenium Development Goals (MDGs) menargetkan bahwa pada tahun2015 angka kematian ibu di Indonesia tidak lebih dari 104 per 100 ribu kelahiranhidup dan angka kematian bayi juga turun. Target yang lain dari MDGs adalahmeningkatkan promosi kesehatan (Rahmat, 2009). Penyebab langsung kematian ibu tertinggi di Indonesia adalah perdarahansebesar 30%, preeklampsi – eklampsi sebesar 25% dan infeksi / sepsispostpartum sebesar 12%, partus lama sebesar 5%, emboli obstetri 3%, komplikasiaborsi sebesar 8%, sedangkan penyebab tidak langsung kematian ibu sebesar12% (Siswono, 2007). Penyebab umum kematian ibu karena perdarahan disebabkan olehperdarahan post partum karena atonia uteri sebesar 50 – 60%, retensio plasentasebesar 16 – 17%, sisa plasenta sebesar 23 – 24%, laserasi jalan lahir sebesar 4– 5%, kelainan darah sebesar 0,5 – 0,8% dan penyebab lainnya yaitu traumajalan lahir, episiotomi yang lebar, laserasi perineum, laserasi vagina, laserasiserviks, laserasi forniks dan rahim dan ruptur uteri (Rochmat, 2009). Menurut JNPK- KR (2007) atonia uteri adalah suatu kondisi dimanamyometrium tidak dapat berkontraksi dan bila ini terjadi maka darah yang keluarProsiding Seminar Nasional, 13-14 Desember 2010 1257
  • 71. ISBN 978-602-98295-0-1dari bekas tempat melekatnya plasenta (tembuni) menjadi tidak terkendali. Daridata rekam medik Rumah Sakit Umum Pusat Dr. Mohammad Hoesin Palembangtahun 2009 kejadian perdarahan post partum sebanyak 70 orang dari 3.157 ibubersalin, dengan rincian kejadian atonia uteri sebanyak 44 orang, sisa plasentasebanyak 6 orang, retensio plasenta sebanyak 11 orang dan laserasi perineumsebanyak 9 orang. Penelitian ini bertujuan untuk mengetahui faktor – faktor yangberhubungan dengan kejadian atonia uteri di Rumah Sakit Umum Pusat Dr.Mohammad Hoesin Palembang tahun 2009. METODE PENELITIAN Jenis penelitian adalah penelitian survei analitik dengan pendekatan CrossSectional yaitu variabel independen dan variabel dependen dikumpulkan secarabersama – sama (Hidayat, 2009). Penelitian dilaksanakan di Rumah Sakit UmumPusat Dr. Mohammmad Hoesin Palembang . Sampel penelitian adalah semua ibubersalin yang mengalami perdarahan post partum yang tercatat di rekam medikberjumlah 70 orang. Tekhnik pengambilan sampel yaitu non random sampling.Alat pengumpul data dengan menggunakan checklist. Pengolahan data dilakukandengan empat cara yaitu : editing, coding, entry data dan cleaning data. Analisadata yang digunakan adalah analisa univariat dan analisa bivariat. Uji statistikyang digunakan adalah uji Chi – Square dengan tingkat kemaknaan 0,5. HASIL DAN PEMBAHASAN1. Paritas Pada penelitian ini paritas dikelompokkan menjadi dua yaitu paritas risikotinggi (jumlah anak 1 dan > 3 orang) sebanyak 34 orang (48,6%) dan paritas risikorendah (jumlah anak 2 – 3 orang) sebanyak 36 orang (51,4%). Menurut Winkjosastro (2006) paritas merupakan kuantitas atau jumlah anakyang pernah dilahirkan seorang ibu. Kuantitas kelahiran memiliki keterkaitandengan perdarahan setelah kelahiran. Ibu dengan kehamilan lebih dari 2 kali atauyang termasuk paritas tinggi, mempunyai risiko lebih tinggi terjadinya perdarahanpost partum akibat atonia uteri dikarenakan pada multigravida fungsi reproduksiProsiding Seminar Nasional, 13-14 Desember 2010 1258
  • 72. ISBN 978-602-98295-0-1mengalami penurunan (Alia, 2010). Hasil penelitian ini sejalan dengan hasilpenelitian yang dilakukan oleh Erna (2006) yaitu adanya hubungan antara paritasdengan kejadian atonia uteri dengan distribusi cukup besar pada ibu denganparitas tinggi.2. Umur Umur ibu bersalin dalam penelitian ini dikelompokkan menjadi dua yaituumur risiko tinggi jika usia ibu bersalin < 20 tahun dan > 30 tahun sebesar 54,3%dan umur risiko rendah jika usia ibu bersalin 20 – 29 tahun sebesar 45,7% (Tabel1). Insiden atonia uteri meningkat pada primigravida tua pada wanita hamil berusiakurang dari 20 tahun dan lebih dari 35 tahun. Perdarahan post partum yangmengakibatkan kematian maternal pada wanita hamil yang melahirkan pada usia20 tahun 2 – 5 kali lebih tinggi dari pada perdarahan post partum yang terjadi padausia 20 – 29 tahun. Perdarahan post partum meningkat kembali setelah usia 30 –35 tahun (Winkjosastro, 2006). Pada usia 20 tahun fungsi reproduksi wanita belum berkembang sempurna,sedangkan pada usia diatas 35 tahun fungsi reproduksi wanita mengalamipenurunan dibandingkan fungsi reproduksi normal sehingga kemungkinanterjadinya komplikasi post partum terutama perdarahan akan lebih besar(Winkjosastro,2008).Tabel 1. Distribusi Frekuensi Responden berdasarkan Usia di Rumah Sakit Umum Pusat Dr. Mohammad Hoesin Palembang Tahun 2009 No Umur Ibu Frekuensi % 1. Risiko Tinggi 38 54,3 2. Risiko Rendah 32 45,7 Jumlah 70 1003. Jarak Kelahiran Penelitian ini membagi jarak kelahiran menjadi dua yaitu jarak kelahirandekat jika ≤ 2 tahun dan jarak kelahiran jauh jika > 2 tahun. Hasil penelitian dapatdilihat pada tabel 2.Prosiding Seminar Nasional, 13-14 Desember 2010 1259
  • 73. ISBN 978-602-98295-0-1Tabel 2. Distribusi Responden berdasarkan Jarak Kelahiran di Rumah Sakit Umum Pusat Dr. Mohammad Hoesin Palembang Tahun 2009 No Jarak Kelahiran Frekuensi % 1. Jarak Kelahiran Dekat 41 58,6 2. Jarak Kelahiran Jauh 29 41,4 Jumlah 70 100 Jarak kehamilan merupakan jarak kelahiran anak bayi yang mati maupunyang hidup. Jarak melahirkan anak yang satu dengan anak yang berikutnyasebaiknya lima tahun, agar rahim dan kondisi ibu secara umum dapat membaikdengan sendirinya. Jarak kelahiran yang relatif masih dianggap baik terutama bagiibu yang sehat adalah tidak kurang dari dua tahun antara kelahiran satu dengankelahiran berikutnya (Meiwanto, 2007). Hal ini sejalan dengan penelitian yang dilakukan Santoso (2004)menyatakan bahwa ada hubungan antara jarak kelahiran dengan kejadianperdarahan post partum terutama pada ibu yang memiliki jarak kelahiran < 2 tahundikarenakan apabila jarak kelahiran terlalu dekat keadaan ibu khususnya otot –otot uterus belum pulih secara sempurna.4. Kejadian Atonia Uteri Penelitian ini membagi kejadian atonia uteri menjadi dua yaitu ― ya ― jikaterjadi atonia uteri pada ibu bersalin sebesar 62,9% dan ―tidak‖ jika ibu tidakmengalami atonia uteri sebesar 37,1%. Dapat dilihat pada tabel 3.Tabel 3. Distribusi Frekuensi Kejadian Atonia Uteri di Rumah Sakit Umum Pusat Dr. Mohammad Hoesin Palembang Tahun 2009 No Kejadian Atonia Uteri Frekuensi % 1. Atonia uteri 44 62,9 2. Tidak Atonia uteri 26 37,1 Jumlah 70 100Prosiding Seminar Nasional, 13-14 Desember 2010 1260
  • 74. ISBN 978-602-98295-0-1 Atonia uteri adalah suatu kondisi dimana myometrium tidak dapatberkontraksi dan bila ini terjadi maka darah yang keluar dari bekas tempatmelekatnya plasenta menjadi tidak terkendali (JNPKR – KR, 2007).5. Hubungan antara Paritas dengan Kejadian Atonia Uteri Hasil uji statistik dengan Chi – Square didapatkan hasil bahwa atonia uteriproporsi terjadinya lebih besar pada ibu dengan paritas yang berisikodibandingkan dengan ibu bersalin dengan paritas yang tidak berisiko (P value0,002 < α 0,05). Ini berarti ada hubungan yang bermakna antara paritas dengankejadian atonia uteri (Tabel 4). Penelitian ini sesuai dengan hasil kajian tim Akademisi bagian ObginUniversitas Padjajaran Bandung tahun 2003 yang menyatakan bahwa ibubersalin yang mengalami perdarahan sebagian besar karena perdarahan postpartum oleh atonia uteri, dan salah satu faktor yang berhubungan dengan atoniauteri adalah jumlah anak lebih dari 3. Teori yang mendukung hasil penelitian ini adalah teori yang dikemukakanoleh Varney‘s (2008) yaitu kondisi yang berpotensi menyebabkan perdarahan postpartum yang berhubungan dengan atonia uteri antara lain adalah grandemultiparitas.Tabel 4. Hubungan Paritas dengan Kejadian Atonia UteriNo Paritas Atoni Uteri N % P value Atonia Uteri Tidak Atonia Uteri n % n %1. Risiko 28 82,4 6 17,6 34 100 0,0022. Tidak 16 44,4 20 55,6 36 100 risikoJumlah 44 62,9 26 37,1 70 1006. Hubungan antara Umur dengan Kejadian Atonia Uteri Hasil uji statistik Chi – Square didapatkan bahwa atonia uteri lebih besarproporsi terjadinya pada usia yang berisiko dibandingkan dengan usia yang tidakProsiding Seminar Nasional, 13-14 Desember 2010 1261
  • 75. ISBN 978-602-98295-0-1berisiko (P value 0.005 ≤ α 0,005). Ini menunjukkan ada hubungan yangbermakna antara umur dengan kejadian atonia uteri (Tabel 5). Hasil penelitian ini sejalan dengan penelitian Wiludjeng (2005) yangmenyatakan bahwa kasus kematian maternal terjadi paling banyak pada kelompokusia 20 – 30 tahun karena komplikasi pada persalinan salah satunya perdarahanpost partum. Menurut Mulyana (2007) apabila wanita usia kurang dari 19 tahunhamil, apabila kehamilannya berusia 20 minggu segmen bawah uterus terbentukdan mulai melebar serta menipis. Dengan bertambah tuanya kehamilan segmenbawah uterus akan lebih melebar lagi dan serviks mulai membuka. Pada saat inidapat terjadi perdarahan dikarenakan ketidakmampuan segmen bawah rahimberkontraksi secara adekuat.Tabel 5. Hubungan Umur dengan Kejadian Atonia UteriNo Umur Kejadian Atonia Uteri N % P Atonia Uteri Tidak Atonia value Uteri n % n %1. Risiko 30 78,9 8 21,1 38 100 0,005 tinggi2. Risiko 14 43,8 18 56,3 32 100 rendahJumlah 44 62,9 26 37,1 70 1007. Hubungan Jarak Kelahiran dengan Kejadian Atonia Uteri Hasil uji statistik Chi – Square didapatkan bahwa atonia uteri proporsiterjadinya lebih besar pada ibu bersalin jarak kehamilan dekat dibandingkan ibubersalin jarak kehamilan jauh (P value 0,004 < α 0,005). Ini berarti ada hubunganyang bermakna antara jarak kelahiran dengan kejadian atonia uteri.Prosiding Seminar Nasional, 13-14 Desember 2010 1262
  • 76. ISBN 978-602-98295-0-1Tabel 6. Hubungan Jarak Kelahiran dengan Kejadian Atonia UteriNo Jarak Atonia Uteri N % P Kelahiran Atonia Uteri Tidak Atonia value Uteri n % n %1. Dekat 32 78 9 22 41 100 0,0042. Jauh 12 41,4 17 58,6 29 100Jumlah 44 62,9 26 37,1 70 100 Penelitian ini sejalan dengan penelitian Santoso (2004) yaitu ada hubunganjarak kelahiran dengan kejadian perdarahan post partum yang dialami olehkelompok ibu yang memiliki jarak kelahiran < 2 tahun. Pada saat hamil dan bersalin terjadi perubahan pada tubuh dan kandunganibu. Untuk itu dibutuhkan waktu untuk memulihkannya seperti sebelum hamil yangmemerlukan waktu minimal adalah 2 tahun asalkan persalinan tersebut normal.Jika persalinan tidak normal untuk memulihkan kondisi fisik seperti sebelum hamildibutuhkan waktu lebih panjang lagi. Jarak kehamilan yang terlalu pendek akanmeningkatkan risiko kematian perinatal apabila ibu hamil lagi karena kondisikandungan belum pulih (Varney‘s, 2008). KESIMPULANBerdasarkan hasil penelitian dan pembahasan diatas maka dapat diambilkesimpulan1. Dari 70 ibu yang mengalami perdarahan post partum didapatkan ibu bersalin yang mangalami atonia uteri sebanyak 44 (62,9%) dan tidak atonia uteri sebanyak 26 (37,1%). Paritas yang mengalami atonia uteri banyak terdapat pada ibu dengan paritas risiko sebanyak 28 orang (82,4%). Umur yang paling banyak mengalami atonia uteri adalah umur yang berisiko tinggi sebanyak 30 orang (78,9%). Jarak kelahiran yang terbanyakProsiding Seminar Nasional, 13-14 Desember 2010 1263
  • 77. ISBN 978-602-98295-0-1 mengalami atonia uteri adalah jarak kelahiran kurang dari 2 tahun sebanyak 32 orang (78%).2. Ada hubungan yang bermakna paritas dengan kejadian atonia uteri (P value 0,002 < α 0,005).3. Ada hubungan yang bermakna umur dengan kejadian atonia uteri (P value 0,005 ≤ α 0,005).4. Ada hubungan yang bermakna jarak kelahiran dengan atonia uteri (P value 0,004 < α 0,005). SARANSaran yang diberikan berdasarkan penelitian diatas adalah1. Bagi tenaga kesehatan hendaknya lebih meningkatkan pendidikan kesehatan mengenai tanda – tanda bahaya persalinan salah satunya perdarahan post partum khususnya atonia uteri dimulai sejak ibu merencanakan kehamilan sampai akhir kehamilan pada saat ibu melakukan pemeriksaan kehamilan.2. Bagi ibu hamil agar memeriksakan kehamilannya secara rutin dan diupayakan untuk bersalin kepada tenaga kesehatan. DAFTAR PUSTAKAAlia, 2010. Angka Kematian Ibu. Availble : http//antie – alia. Blogspot.com/2010/01/angka kematian ibu.html.Hidayat, Alimul Aziz, 2009. metode Penelitian Kebidanan dan Teknik Analisa Data. Jakarta ; Salemba Medika.JNPK – KR, 2007. Asuhan Persalinan Normal. Jakarta ; EGCMeiwanto, 2007. Hubungan antara Paritas dan Usia Ibu. Available : http//bibilung. Wordpress.com/2007/08/07. Risiko – Jarak – Kehamilan – Terlalu Dekat.Mulyana, 2007. Hubungan antara Paritas dan Usia Ibu. Available : http//download- gratis-kti-skripsi.blogspot.com/2010/04/hubungan – antara – paritas – dan usia – ibu. html .Prosiding Seminar Nasional, 13-14 Desember 2010 1264
  • 78. ISBN 978-602-98295-0-1Rochmat, 2008. Perdarahan Post Partum. Available : http//askep – askeb.cz.cc/2010/01/upaya – peningkatan – kesehatan – ibu. html.Winkjosastro, Hanifa, 2006. Ilmu Kebidanan. Jakarta : Yayasan Bina Pustaka Sarwono Prawirohardjo.Winkjosastro, Muladi, 2008. Pelayanan Obstetri dan Neonatal Emergensi Komprehensif (PONEK). JakartaVarney‘s, 2008. buku Ajar Asuhan Kebidanan. Jakarta ; EGCProsiding Seminar Nasional, 13-14 Desember 2010 1265
  • 79. ISBN 978-602-98295-0-1 PROFIL KANDUNGAN KIMIA DAN POTENSI TUMBUHAN MANGGIS HUTAN (GARCINIA BANCANA MIQ.) SEBAGAI SUMBER SENYAWA ANTIOKSIDAN Muharni Jurusan Kimia,FMIPA Universitas Sriwijaya, Palembang, Indonesia ABSTRAKGarcinia bancana termasuk famili Guttiferae dan di Indonesia dikenal dengannama manggis hutan. Dalam rangka penelitian profil kandungan kimia danaktivitas biologi dari G. bancana asal Indonesia telah berhasil diisolasi enamsenyawa dari bagian kulit batang dan dua senyawa dari bagian daun. Isolasidilakukan dengan teknik-teknik kromatografi dan penentuan struktur molekul darisenyawa ini ditetapkan berdasarkan data spektroskopi meliputi UV, IR, NMR 1-Ddan 2-D. Berdasarkan analisa data spktroskopi ditetapkan kedelapan senyawa ituadalah 1,5-dihidroksi-3,6-dimetoksi-2,7-di-(3-metilbut-2-enil)santon (1), 1,4,6-trihidroksi,3-metoksi,5-(3metilbut-2-enil)santon (2), isosantosimol (3), (-)-epikatekin(4), β-amirin (5), 1,5-dihidroksi-6‘,6‘-dimetilpirano (2‘, 3‘: 2,3) santon (6). lupeol (7)dan apigenin (8). Ke delapan senyawa ini juga telah diukur aktivitasantioksidannya dengan metode DPPH. Tiga diantara senyawa yang ditemukanyaitu isosantosimol (3), (-)- epikatekin (4), dan 1,5-dihidroksi-6‘,6‘-dimetilpirano (2‘,3‘: 2,3) santon (6) menunjukkan aktif antioksidan dengan IC50 berturut-turut 9,8 ;8,1; dan 68 µg/mL.Kata kunci:, Garcinia bancana, antioksidan, DPPH PENDAHULUAN Profil kandungan kimia suatu spesies tumbuhan dalam satu genus umumnyaakan menunjukkan kandungan kimia yang mirip. Ada spesies yang menunjukkankeragaman yang tinggi dengan tingkat evolusi yang rendah, atau ada juga yangmemiliki keragaman yang rendah namun tingkat evolusinya tinggi. Garcinia adalahgenus dari famili Guttiferae dengan profil kandungan kimianya adalah senyawafenol tipe flavonoid, santon dan benzofenon yang memiliki aktivitas biologi yang [1,2]beragam . Salah satu spesiesnya adalah Garcinia bancana dan di Indonesiadikenal dengan nama manggis hutan[4]. Dalam rangka studi kandungan kimia danaktivitas biologi dari tumbuhan G. bancana, telah berhasil diisolasi enam senyawadari kulit batang dan dua senyawa dari bagian daun. Struktur senyawa tersebutditetapkan berdasarkan data spektroskopi meliputi spektrum UV, IR, NMR 1-Ddan NMR 2-D. Senyawa hasil isolasi juga telah dilakukan uji aktivitasProsiding Seminar Nasional, 13-14 Desember 2010 1266
  • 80. ISBN 978-602-98295-0-1antioksidannya dengan menggunakan metode DPPH yang berdasarkan padakemampuan suatu senyawa dalam meredam radikal DPPH. BAHAN DAN METODE1. Bahan Bahan tumbuhan berupa kulit batang dan daun G. bancana dikumpulkandari Hutan Raya Bogor pada bulan April 2009. Spesimen tumbuhan inidiidentifikasi di Herbarium Bogoriensis, Bogor. Bahan kimia yang digunakanterdiri dari : n-heksan, etil asetat, diklorometan, metanol, silika gel Merck 60 GF254(230-400 mesh), silika gel Merck 60 G (70-230 Mesh), plat aluminium berlapissilika gel Merck 60 GF254, 0,25 mm, 20 x 20 cm, metanol p.a, DMSO, DPPH.Peralatan yang digunakan dalam penelitian ini berupa alat gelas dan perangkatinstrumentasi yang biasa digunakan di Laboratorium Kimia Organik Bahan Alam,spektrofotometer UV Beckman DU-700, spektrofotometer Shimadzu FTIR 8400,spektrometer NMR JEOL JNM ECA-500 yang bekerja pada 500 MHz (1H) dan125 MHz (13C), spektrofotometer UV-vis, dan micro melting point apparatus.2. Ekstraksi Kulit Batang G. bancana Serbuk kering kulit batang G. bancana (3 Kg) dimaserasi berturut-turutdiklorometana (22 g) dan ekstrak metanol (32 g).3. Pemisahan dan pemurnian ekstrak MeOH kulit batang G. bancana Ekstrak MeOH (30 g), dianalisis dengan KLT menggunakan pelarut denganberbagai eluen untuk mencari eluen yang tepat untuk kolom vakum cair (KVC).Sampel disiapkan secara preadsorpsi, dimasukkan ke dalam kolom (adsorbensilika gel 230-400 Mesh), secara merata dan dielusi menggunakan eluen secarabergradien (n-heksan, campuran n-heksan-EtOAc = 9:16:4, dan EtOAc). Hasilkromatografi kolom ditampung dengan botol (volume kira-kira 200 mL) dandianalisis dengan KLT dengan penampak noda lampu UV. Eluat dengan polanoda yang sama digabung menjadi satu fraksi, dipekatkan, dan diperoleh limafraksi gabungan F1-F5. Fraksi dengan pola noda yang baik dan berfluorisensiselanjutnya dipisahkan dan dimurnikan.Prosiding Seminar Nasional, 13-14 Desember 2010 1267
  • 81. ISBN 978-602-98295-0-1 Pemisahan fraksi F2 dilanjutkan menggunakan kromatografi kolom terbuka(KKT) dengan fasa diam silika gel (70-230 Mesh), eluen bergradien (n-heksan,campuran n-heksan-EtOAc = 9:17:3, dan EtOAc). Hasil kromatografi ditampungdengan vial (volume kira-kira 10 mL) dan di KLT. Eluat dengan pola noda yangsama digabung menjadi satu fraksi, dan dari hasil penggabungan didapatkanempat fraksi F2.1-F2.4. Fraksi F2.2 dimurnikan dengan teknik KKG, didapatkanempat fraksi gabungan F2.2.1-F2.2.4. Dari F.2.2.2 didapatkan senyawa 1 (18mg). Fraksi F2.1 juga dimurnikan dengan teknik KKT, didapatkan tiga fraksiF2.1.1-F2.1.3 dan dari fraksi F2.1.2 didapatkan senyawa 4 (12 mg). Selanjutnyafraksi F5 juga dipisahkan menggunakan KKT dengan eluen bergradien (n-heksan-EtoAc = 5:51:9, EtOAc dan EtOAc-MeOH = 9:1 dan 8:2), ditampungdengan vial, dan di KLT. Eluat dengan pola noda yang sama digabung menjadisatu fraksi dan didapatkan lima fraksi F5.1-F5.5. Fraksi F5.5 dimurnikan denganteknik rekristalisasi menghasilkan senyawa 3 (15 mg). Pemurnian dengan carayang sama terhadap subfraksi F.5.3 didapatkan senyawa 2 berupa kristal kuning(8 mg).4. Pemisahan dan pemurnian ekstrak CH2Cl2 kulit batang G. bancana Fraksi diklorometana (20 g) kemudian difraksinasi dengan kromatografivakum cair (KVC) (adsorben Si-gel, eluen campuran n-heksana-EtOAcbergradien), menghasilkan 6 subfraksi gabungan F1 – F5. Pemisahan fraksi F2(3,3 g) selanjutnya menggunakan kolom kromatografi terbuka (adsorben Si gel,eluen n-heksana, campuran n-heksana-EtoAc 9:1 dan 8:2) menghasilkan 4subfraksi F2.1 – F2.4. Fraksi F2.1 (0,8 g) kembali dimurnikan dengan kolomkromatografi terbuka (KKT) dan didapatkan 3 subfraksi F2.1.1 ( vial 1 - 9; 100mg); F2.1.2 (vial 10 - 12; 220 mg), dan F.2.1.3 (vial 13 – 21; 155 mg). Darisubfraksi F.2.1.1 didapatkan kristal dan setelah dicuci dengan n-heksanadidapatkan senyawa 5 (52 mg) berupa kristal putih.Fraksi F2.4 (0,5 g) kembali dimurnikan dengan teknik KKT (adsorben Si gel,eluen bergradien n-heksana, campuran n-heksana-EtoAc 9:1; 8:2; 7:3)menghasilkan tiga subfraksi F2.4.1 – F2.4.3. Dari fraksi F2.4.2 didapatkansenyawa 6 (18 mg) berupa kristal kuning.Prosiding Seminar Nasional, 13-14 Desember 2010 1268
  • 82. ISBN 978-602-98295-0-15. Ekstraksi daun G.bancana Serbuk daun G. (700 g) diekstraksi secara maserasi menggunakan pelarutmetanol. Ekstraksi diulangi sebanyak 3 x 5 L @ 3 hari. Maserat yang diperolehdipekatkan pada tekanan rendah menggunakan rotary evaporator menghasilkanekstrak pekat metanol (120 g).6. Pemisahan dan pemurnian senyawa fenol dari ekstrak metanol dari daun G. bancana Ekstrak metanol (30 g) selanjutnya dipisahkan dengan kromatografi vakumcair (KVC) dengan fasa diam Si gel, eluen sistim kepolaran meningkat (n-heksan,campuran n-heksan : EtOAC, 9:1 – 1:1, EtOAc, EtOAC : MeOH = 9: 1 – 1: 1).Eluat yang ditampung dengan botol dan selanjutnya dianalisis dengankromatografi lapis tipis (KLT). Dari hasil KLT diperoleh 8 fraksi F1 - F4. Fraksi F3selanjutnya dipisahkan dengan kromatografi kolom terbuka (KKT) dengan fasadiam Si gel, eluen sistim kepolaran meningkat (campuran n-heksan : EtOAC, 9:1 –7:3), diperoleh 6 subfraksi F3.1- F3.6. Subfraksi F3.2 dimurnikan denganpencucian menggunakan n-heksana menghasilkan isolat murni senyawa 7 (80mg) berupa kristal putih. Pengujian dengan kromatografi lapis tipis (KLT)menunjukkan satu noda. Pemisahan dan pemurnian terhadap fraksi F4 dengancara yang sama diperoleh senyawa 8 (20 mg).7. Karakterisasi dan penentuan struktur senyawa hasil isolasi Terhadap senyawa murni dilakukan penentuan sifat fisika meliputi titik leleh(t.l) dan penentuan struktur molekul dengan metode spektroskopi meliputi UV,IR, NMR 1-D (1H NMR, 13 C NMR, dan DEPT), dan NMR 2-D (HMQC, HMBC,COSY).8. Uji aktivitas antioksidan dengan metode DPPH[4] Larutan DPPH 0,05 mM disiapkan dalam MeOH, dan larutan uji dibuatdengan melarutkan sampel uji dalam dimetilsulfoksida (DMSO) dengankonsentrasi tertentu (200; 100; 50; 25; 12,5; dan 6,25 g/mL). Sebanyak 0,2 mLlarutan sampel ditambah 3,8 mL larutan DPPH 0,05 mM. Campuran larutandihomogenkan dan dibiarkan selama 30 menit ditempat gelap. Serapan diukurProsiding Seminar Nasional, 13-14 Desember 2010 1269
  • 83. ISBN 978-602-98295-0-1dengan spektrofotometer UV-vis pada λmaks 517 nm. Sebagai standar antioksidandigunakan α-tokoferol, asam askorbat, dan BHA dengan konsentrasi perlakuanyang sama seperti sampel. Aktivitas antioksidan ditentukan berdasarkanbesarnya hambatan serapan radikal DPPH melalui perhitungan persentase inhibisiserapan DPPH . HASIL DAN PEMBAHASAN Dari ekstrak metanol kulit batang tumbuhan Garcinia bancana berhasildisolasi enam senyawa. Senyawa 1 berupa kristal kuning dengan titik leleh (t.l)207-209oC dan berdasarkan data spektroskopi diidentifikasi sebagai senyawagolongan santon: 1,5-dihidroksi-3,6-dimetoksi-2,7-di-(3-metilbut-2-enil)santon (1).Senyawa 2 berupa kristal kuning t.l 2002-204 oC, diidentifikasi sebagai 1,4,6-trihidroksi,3-metoksi,5-(3metilbut-2-enil)santon (2), senyawa 3 berupa padatanputih dengan titik leleh 242-243 oCdan []D 183o (c 1,0, MeOH). Dan diidentifikasisebagai senyawa golongan benzofenon yaitu: isosantosimol (3), dan senyawa 4berupa kristal putih dengan t.l. 240-242oC dan []D20 -68o (c 1,0, MeOH) dandiidentifikasi sebagai golongan flavonoid yaitu (-)-epikatekin (4). Sementara itudari ekstrak diklorometana kulit batang G. bancana berhasil diisolasi duasenyawa, yaitu senyawa 5 berupa kristal putih dan didentifikasi sebagai senyawaβ- amirin (5), dan senyawa 6 berupa kristal kuning t.l. 220-222oC, dan diidentifikasisebagai 1,5-dihidroksi-6‘,6‘-dimetilpirano (2‘, 3‘: 2,3) santon (6). Selanjutnya dariekstrak metanol daun tumbuhan G. bancana juga berhasil diisolasi dua senyawa.Senyawa 7 berupa Kristal putih dan diidentifikasi sebagai triterpenoid lupeol (7).Senyawa ini telah pernah dilaporkan sebelumnya dari bagian ranting G.bancana[5].. Senyawa 8 berupa kristal putih, t.l 352oC dan diidentifikasi sebagaisenyawa flavonoid apigenin (8). Kedelapan senyawa ini juga telah diuji aktivitas antioksidannya denganmetode DPPH yang berdasarkan pada kemampuan suatu senyawa dalammeredam radikal bebas DPPH. Dari delapan senyawa yang ditemukan tigadiantaranya isosantosimol (3), (-)-epikatekin (4) dan 1,5-dihidroksi-6‘,6‘-dimetilpirano (2‘, 3‘: 2,3) santon (6) menunjukkan aktivitas antioksidan sepertiditunjukkan pada Tabel 1.Prosiding Seminar Nasional, 13-14 Desember 2010 1270
  • 84. ISBN 978-602-98295-0-1Tabel 1. Nilai IC50 senyawa hasil isolasi (1 sampai dengan 8) dan standar antioksidan (asam askorbat, -tokoferol, dan BHA) dengan metode DPPH.No. Senyawa uji Nilai IC50 (µg/mL)1. 1,5-Dihidroksi-3,6-dimetoksi-2,7-di-(3- > 100 metilbut-2-enil)santon (1)2. 1,4,6-trihidroksi,3-metoksi,5-(3metilbut- > 100 2-enil)santon (5)3. Isosantosimol (3) 9,84. (-)-epikatekin (2) 8,15 β- amirin >1006. 1,5-dihidroksi-6‘,6‘-dimetilpirano (2‘, 3‘: 68 2,3) xanthone (4)7 Lupeol > 1008 Apigenin > 1006. Asam askorbat 10,67. -Tokoferol 18,28. BHA 17,6 Suatu senyawa dikategorikan sangat aktif antioksidan bila memiliki IC50  10(µg/mL), dikategorikan aktif bila memiliki IC50  100 (µg/mL) dan tidak aktif bilamemiliki IC50 > 100 (µg/mL)[6] Berdasarkan data Tabel 1 disimpulkan (-)-epikatekin (4) dan isosantosimol (3) dikategorikan sangat aktif antioksidan denganIC50 berturut-turut 8,1 dan 9,8 µg/mL , sedangkan 1,5-dihidroksi-6‘,6‘-dimetilpirano(2‘, 3‘: 2,3) xanthone (6) dikategorikan aktif dengan IC50 68 µg/mL. Sementara itulima senyawa lainnya tidak aktif dengan IC50 > 100 µg/mL . Dari penelusuranpustaka dilaporkan dari bagian daun G. bancana telah ditemukan dua senyawagolongan flavonoid yaitu kuercetin 3-O--L-ramnosida (9), kaemferol 3-O--L-ramnosida (10). Pada bagian ranting ditemukan enam senyawa yang terdiri dari1,1‘-bifenil -2- (3-metilbut-2-enil)-3-metoksi-4,4‘,5,6-tetraol (11), garsinol (12) danisogarsinol (13), 8-hidroksi-6-metoksi-3-n-pentilisokumarin (14), lupeol (7), danstigmasterol (15). Tiga senyawa yang ditemukan pada ranting yaitu 1,1 ‘-bifenil -2-(3-metil-2-butenil)-3-metoksi-4,4‘,5,6-tetraol (6) , garcinol (7) dan isogarsinol (8),aktif terhadap Staphillococus aureus dengan MIC berturut-turut 32, 16, dan 4μg/mL.[5]Prosiding Seminar Nasional, 13-14 Desember 2010 1271
  • 85. ISBN 978-602-98295-0-1 OH O OH OH HO O OH HO O O . H3CO O OCH3 OH OH OH 1 O O 3 O OH 2 O OH H HO O OCH3 H OH O O H 4 OH HO OH 6 H 7 5 OH OH O OH HO O HO O H3CO HO O ORam HO OH 8 OH O ORam OH OH O HO OH 9 10 11 OH OH OH O OHO O O H HO O O H H3CO C5H11 14 H H O OH O O HO 15 13 12 Gambar 1. Struktur senyawa kimia dari bagian ranting dan daun G. bancana Berdasarkan data ini dapat kita kelompokkan golongan senyawa yangberhasil ditemukan dari tumbuhan G. bancana adalah empat senyawa golonganflavonoid: (-)-epikatekin (3), apigenin (8), kuercetin 3-O--L-ramnosida (9),kaemferol 3-O--L-ramnosida (10), tiga senyawa golongan benzofenon:isosantosimol (2), garsinol (12) dan isogarsinol (13), tiga senyawa golongansanton: 1,5-dihidroksi-3,6-dimetoksi-2,7-di-(3-metilbut-2-enil)santon (1), 1,4,6-trihidroksi,3-metoksi,5-(3metilbut-2-enil)santon (4), dan 1,5-dihidroksi-6‘,6‘-dimetilpirano (2‘, 3‘: 2,3) santon (6), dua senyawa golongan terpenoid: β- amirin(5), dan lupeol (7) , satu senyawa steroid: stigmasterol (15), satu senyawa ‘ ‘fenilpropanoid: 1,1 -bifenil -2- (3-metilbut-2-enil)-3-metoksi-4,4 ,5,6-tetraol (11) dansatu senyawa golongan poliketida yaitu: 8-hidroksi-6-metoksi-3-n-pentilisokumarin(14)[5]. Ke limabelas senyawa ini dapat dikelompokkan menjadi 7 golonganProsiding Seminar Nasional, 13-14 Desember 2010 1272
  • 86. ISBN 978-602-98295-0-1senyawa yaitu flavonoid, benzofenon, santon, triterpenoid, steroid, fenilpropanoid,dan poliketida. Berdasarkan biosintesis senyawa dialam pembentukan senyawa metabolitsekunder ini terjadi melalui tiga jalur yaitu jalur asam mevalonat (pembentukansenyawa golongan terpenoid dan steroid), jalur shikimat (fenil propanoid), jalurasetat malonat (poliketida) , atau merupakan kombinasi jakur shikimat denganasetat malonat (Flavomoid, santon dan benzofenon). Dari data ini terlihat bahwaprofil kandungan kimia dari spesies G. bancana sangat beraneka ragam, namunsetiap kelompok senyawa hanya terdiri dari 1 sampai 3 senyawa. Suatutumbuhan dikatakan memiliki tingkat evolusi yang tinggi bila dalam satu kelompoksenyawa memiliki banyak keragaman struktur 10 – 15 senyawa untuk satukelompoknya. Seperti pada Garcinia mongostana telah ditemukan sekitar 26senyawa santon dan 8 senyawa benzofenon dan dari G. nigrolineata telahdilaporkan adanya 22 senyawa santon, namun tidak ditemukan jenis senyawagolongan lainnya[7]. Berdasarkan kandungan kimianya ini G. mangostana dan G.dulcis dikatakan memiliki tingkat evolusi yang tinggi. Sementara dari G. bancanaditemukan banyak ragam kelompok senyawa namun jumlahnya hanya 1-3senyawa dalam satu kelompoknya. Berdasarkan data ini dapat disimpulkanbahwa kandungan kimia dari G. bancana memiliki tingkat evolusi yang rendahnamun memiliki tingkat keragaman yang tinggi. KESIMPULAN Berdasarkan senyawa yang berhasil diisolasi dan studi pustaka yangdilakukan disimpulkan kandungan kimia dari manggis hutan menunjukkankeragaman yang tinggi dengan tingkat evolusi yang rendah. Manggis hutanmengandung tiga senyawa aktif antioksidan sehingga berpotensi sebagai sumbersenyawa antioksidan.Prosiding Seminar Nasional, 13-14 Desember 2010 1273
  • 87. ISBN 978-602-98295-0-1 DAFTAR PUSTAKA1. Lannang, A. M., Komguem, J., Ngninzeko, F. N., Tangmouo, J. G., Lontsi, D., Ajaz, A., Choudhary, M. I., Ranjit, R., Devkota, K. P., and Sondengam, B. L. 2005. Bangangxanthone A and B, two xanthone from the stem bark of Garcinia polyantha Oliv. Phytochemistry 66, 2351-2355.2. Suksamrarn, S., Suwannapoch, N., Pakhode, E., Thanuhiranler, J., Ratananukul, P., Chimmoi, N.,and Suksambarn, A.2003. Antimycrobacterial activity of prenylated xanthones from the fruits of Garcinia mangostana. Chem.Pharm.Bull,51, 857-8593. Heyne, K., 1987. Tumbuhan berguna Indonesia, Jilid III, Jakarta: Yayasan SaranaWana Jaya. Hal 13874. Selvi, A.T, Joseph, G. S., and Jayaprakasha, G. K. 2003. Inhibition of Growth and Aflatoxin Production in Aspergillus flavus by Garcinia indica Extract and Its Antioxidant Activity. Food Microbiology 20: 455-460.5. Rukachaisirikul, V., Naklue, W., Sukpondma, Y., and Phongpaichit, S. 2005. An Antibacterial Biphenyl Derivative from Garcinia bancana Miq. Chemical and Pharmaceutical Bulletin 53: 342-343.6. Minami, H., Hamaguchi, K., Kubo, M., and Fukuyama, Y. 1998. A Benzophenone and A Xanthone from Garcinia subelliptica. Phytochemistry 49 (6): 1783-1785.7. Bennett, G. J., and Lee, H. H. 1989. Xanthones from Guttiferae. Phytochemistry 28 (4) : 967-998.Prosiding Seminar Nasional, 13-14 Desember 2010 1274
  • 88. ISBN 978-602-98295-0-1 PENGARUH POLIMORFISME -429T/C TERHADAP TERJADINYA KOMPLIKASI RETINOPATI PADA PENDERITA DIABETES MELLITUS PADA POPULASI MELAYU Mgs. Irsan Saleh1, Darma Sastrawan2, Riani Erna2 1 Bagian Farmakologi Fakultas Kedokteran Universitas Sriwijaya Palembang 2 Bagian Ilmu Kesehatan Mata Fakultas Kedokteran Universitas Sriwijaya /Rumah Sakit Moehammad Hoesin Palembang ABSTRAK Diabetik retinopati merupakan komplikasi DM yang sering terjadi dandihubungkan dengan durasi paparan dan tingginya kadar glukosa dalam darah.Mekanisme yang mendasari terjadinya diabetik retinopati belum diketahui secarapasti. Adanya polimorfisme -429T/C pada promoter gen RAGE dikaitkan dengankepekaan seorang penderita DM untuk mengalami komplikasi retinopati.Pendekatan biologi molekuler dengan teknik PCR-RFLP telah digunakan untukmelihat pengaruh polimorfisme -429T/C gen RAGE terhadap terjadinya retinopatidiabetik pada penderita DM pada populasi Melayu di Sumatera Selatan. IsolasiDNA dilakukan dengan chelex-100. Amplifikasi DNA dilakukan dengan PCR danpenentuan adanya polimorfisme dilakukan dengan teknik restriction fragmentlength polymorphism (RFLP) menggunakan enzim restriksi AluI. Genotip TT (willdtype) menghasilkan satu pita DNA dengan ukuran 250 bp sebaliknya individu yangpolimorfik CC (mutan) akan menghasilkan dua pita DNA dengan ukuran 162 bpdan 88 bp. Dari 120 sampel dari populasi Melayu yang terdapat di SumateraSelatan yang terbagi dalam kelompok DM retinopati, DM tanpa retinopati dankontrol normal tanpa DM didapatkan 36,67% sampel tergolong mutan dengangenotip TC dan CC dengan distribusi terbesar pada kelompok DM retinopati(p=0,028). Alel mutan C dijumpai pada 20% sampel DM retinopati, sedangkan DMnon retinopati ada 15% dari sampel dan nilai Odds ratio = 7,85 (7,159-6,829) CI95%, p=0,028. Dengan lain perkataan bahwa resiko penderita untuk menjadiretinopati 7,85 kali lebih besar pada penderita yang memiliki alel mutan C.Key word: retinopati diabetik, gen RAGE, polimorfisme, Melayu PENDAHULUAN Diabetik retinopati adalah semua kelainan pada retina yang disebabkanoleh DM dan prevalensinya berhubungan erat dengan terjadinya hiperglikemiaProsiding Seminar Nasional, 13-14 Desember 2010 1275
  • 89. ISBN 978-602-98295-0-1 1,2,kronis . Diabetik retinopati merupakan penyebab utama terjadinya kebutaanpada penderita diabetes mellitus. Saat ini diperkirakan 2-4% dari populasi 2penduduk dunia atau lebih dari 135 juta individu menderita diabetes mellitus, danWHO memperkirakan pada tahun 2025 akan ada 300 juta orang di dunia 3menderita Diabetes mellitus baik tipe 1 dan tipe 2. Di Indonesia, data pasti mengenai prevalensi retinopati diabetika diIndonesia sampai saat ini belum ada. Tetapi dari beberapa penelitian profesidisebutkan antara 10-32%.6 Di Poliklinik RS Dr Moh Hoesin Palembang sepanjangtahun 2009 didapatkan 275 kasus baru kunjungan penderita DM dengankomplikasi retinopati ke Poliklinik Mata. Mekanisme yang mendasari kelainan mikrovaskuler belum diketahuisecara pasti, tetapi diperkirakan berhubungan dengan lamanya paparanhiperglikemia merupakan faktor resiko utama berkembangnya diabetik 4,5retinopati. Beberapa mekanisme yang menjelaskan hubungan antara lamanyahiperglikemia, berkembangnya DM dengan terjadi komplikasi mikro danmakrovaskuler, dapat dijelaskan sebagai berikut: 1) Meningkatnya glikosilasiprotein nonenzimatik, yang bersifat irrreversibel sehingga terbentuknya AGE(Advanced Gylcation End Product); 2) Hiperaktifitas jalur sorbitol-aldosereduktase; 3) Hiperaktifitas dari Protein Kinase C (PKC) ; 4) Meningkatnya reaksistres oksidatif (ROS)6,7 AGE (Advanced Glycation End Product) dihasilkan dari proses glikosilasiprotein dan lipid yang terjadi selama proses penuaan dan dapat diakselerasipembentukannya oleh diabetes sebagai akibat hiperglikemia yang terjadi.12,13 AGEyang terbentuk pada matriks ekstraseluler menyebabkan perubahan strukturvaskuler dan protein yang bersirkulasi sehingga menimbulkan penyempitan lumenpembuluh darah sedangkan AGE yang terbentuk pada protein intraseluler danDNA akan menyebabkan perubahan-perubahan seluler. AGE selanjutnya akandieliminir oleh tubuh melalui suatu proses pengenalan yang melibatkan makrofag.Adanya gangguan dalam pengikatan AGE oleh reseptor spesifik terhadap AGE(AGE receptor/RAGE). 6Prosiding Seminar Nasional, 13-14 Desember 2010 1276
  • 90. ISBN 978-602-98295-0-1 Gen yang menyandi RAGE terletak di kromosom 6p21.3 pada lokus MHCdan terdiri atas 1,7 Kb flanking region dan tersusun atas 11 ekson. RAGEdiekspresikan dalam jumlah yang kecil pada endotel, sel otot polos, sel mesangialdan monosit pada model hewan dan penderita diabetes ekspresinya meningkatpada retina, sel mesangial, aorta yang sepadan dengan akumulasi AGE. 5,8,9 Penelitian Kumaramanickavel dkk, pada populasi India memperlihatkanbahwa berkembangnya diabetik retinopati bervariasi pada beberapa individu,dansecara signifikan berhubungan dengan adanya polimorfisme Gly82Ser gen RAGEpada penduduk India yang menderita diabetik retinopati. 8 Adanya hubunganpolimorfisme antara Gen RAGE (Gly82Ser, G11704T, A2184G, G2242A, -429T/C,-374T/A) dengan retinopati diabetik juga ditemukan pada populasi Cina danEropa.10,11,12 Penelitian ini secara umum bertujuan untuk mengetahui pengaruhpolimorfisme -429T/C gen RAGE yang mendasari terjadinya retinopati diabetikpada etnik Melayu di Sumatera Selatan sehingga dapat menjadi biomarkerprogresivitas terjadinya komplikasi retina pada penderita diabetes mellitus tipe 2. BAHAN DAN CARAPopulasi dan Sampel Penelitian ini adalah penelitian observasional analitik dengan desain casecontrol. Populasi penelitian adalah berbagai populasi yang terdiri dari seluruh etnisMelayu di Sumatera Selatan dengan pedigree tiga generasi ke atas tanpa adapernikahan lintas etnis/suku, baik yang menderita Diabetes Mellitus tipe 2 denganatau tanpa komplikasi Diabetik retinopati yang datang berobat ke Poliklinik KhususRetina Bagian Ilmu Kesehatan Mata Rumah Sakit Dr.Mohammad HoesinPalembang. Sebagai kontrol adalah keluarga dekat (saudara kandung, orang tua,anak) penderita yang menjadi subjek penelitian. Besar sampel yang digunakan untuk penelitian ini minimal adalah 30 oranguntuk masing-masing kelompok; DM dengan retinopati, DM tanpa retinopati dankelompok orang normal (Non DM) yang memenuhi kriteria inklusi. Terhadapsubyek penelitian diminta mengisi informed consent dilanjutkan denganProsiding Seminar Nasional, 13-14 Desember 2010 1277
  • 91. ISBN 978-602-98295-0-1pengukuran tekanan darah, indeks massa tubuh, gula darah puasa (BSN) dan duajam setelah makan (BSPP), pemeriksaan funduskopi dan dilanjutkan denganisolasi DNA dari leukosit dengan menggunakan chelex-100 ion exchanger. Sampel darah diambil melalui punksi vena antecubiti sebanyak 2 mldimasukkan kedalam tabung yang mengandung anti koagulan ethylene diaminetetra acid (EDTA) untuk isolasi DNA dan PCR.Isolasi DNA Isolasi dilakukan dengan mengunakan metode ekstraksi DNA chelex-100dengan menggunakan Phosphate Buffer Saline (PBS) pH 7,4; Saponin 0,5%dalam PBS; dan chelex 20% dalam dd H2O pH 10,5. Adapun cara kerjanyasebagai berikut: Darah sebanyak 200 ul dimasukkan kedalam tabung steril 1,5mlsteril dan ditambahkan PBS pH 7,4 sebanyak 1 ml kemudian disentrifuge dengankecepatan 5.000 rpm selama 5 menit. Prosedur pencucian ini diulangi 3 kali.Supernatan yang ada selanjutnya dibuang, lalu ditambahkan 500 ul 0,5% Saponindalam PBS dicampur dengan baik mengunakan vortek kemudian diinkubasi dalames selama 5 menit. Selanjutnya dilakukan sentrifuge dengan kecepatan 12.000rpm selama 10 menit. Supernatan yang terbentuk selanjunya dibuang,ditambahkan 50 ul chelex 20% dalam dd H2O pH 10,5 dan ditambahkan 100 ulH2O. Inkubasi dalam air mendidih selama 10 menit selanjutnya disentrifugedengan kecepatan 12.000 rpm selama 10 menit. DNA berada pada bagiansupernatan (DNA containing water) lalu bagian ini dipindahkan dalam tabung sterildan disimpan pada suhu -20 oC.PCR dan RFLPPolymerase Chain Reaction (PCR) DNA genom yang diperoleh dari hasil isolasi diperbanyak denganmenggunakan teknik PCR. Pada penelitian ini digunakan sepasang primeroligonukleotida forward 5‘-GGGGGCAGTTCTCTCCTC-3‘ dan reverse 5‘-TCAGAGCCCCCGATCCTATTT-3‘. Komposisi campuran dengan volume total 25ul yang digunakan saat melakukan PCR adalah PCR mix Go Taq (Promega, USA)Prosiding Seminar Nasional, 13-14 Desember 2010 1278
  • 92. ISBN 978-602-98295-0-1yang terdiri dari 12,5 l ddH2O, dan 3 l DNA cetakan (template) serta primeroligonukleotida reverse (R) dan forward (F) masing-masing 1 . PCR dilakukan pada mesin i-cycler (Biorad). Proses sintesis ini diawalisiklus pertama berupa pemanasan pada suhu 95 oC selama 5 menit diikuti sikluskedua yang berlangsung dalam tiga tahap reaksi yang berulang sebanyak 30siklus pada suhu berbeda yaitu: reaksi denaturasi pada suhu diatas 950C selama30 detik, reaksi annealing pada suhu 600C selama 30 detik , dan ekstensi padasuhu 720C selama 30 detik. Siklus ketiga adalah ekstensi akhir dilakukan padasuhu 72oC selama 7 menit 30 detik.Deteksi produk PCR dengan elektroforesis gel agarose Kualitas DNA hasil amplifikasi dengan teknik PCR dilihat denganmenggunakan teknik elektroforesis gel agarose 2%. Elektroforesis dilakukandidalam apparatus elektroporesis (Horizontal MiniSubDNA Biorad) yang berisiTBE 1x (Tris-Boric acid-EDTA, 10,8 g/L. Tris pH 8.0 yang mengandung 5.5 g/lBoric Acid dan 0.5 M EDTA pH 8.0) dan ditambahkan zat interkalator EthidiumBromide 0.1%. DNA hasil PCR sebanyak 5 µL ditambahkan 3 µ loading dye (0.25%bromophenol blue, 40% b/v sukrosa), kemudian dimasukkan dalam sumuran yangterdapat pada gel. Sebagai penanda ukuran pita-pita DNA hasil elektroporesispada gel digunakan DNA Marker (100 bp DNA ladder sebanyak 1 µL yangdicampur 2 µL loading dye dan 4.5µL 1 x TBE buffer. Gel elektroforesis padategangan listrik 110 volt. Selanjutnya dideteksi dengan menggunakan Gel Doc1000 (Biorad, USA) untuk divisualisasi dengan sinar ultra violet pada panjanggelombang 300 nm dan direkam.Deteksi polimorfisme Gen RAGE Promotor -429T/A dengan RFLP Deteksi polimorfisme gen RAGE dilakukan dengan memotong DNA produkPCR dengan enzim restriksi endonuklease. Adanya polimorfisme pada posisi -429T/C akan menyebabkan terbentuknya situs restriksi baru yang dapat dikenali olehAluI. Produk PCR yang sudah ditambahkan dengan enzim restriksi dielektroforesispada gel agarose 3% dengan tegangan listrik 110 volt.Hasil restriksi dianalis dandihubungkan dengan genotipe masing-masing dengan mengunakan sekuensingotomatis DNA selama 2 jam.Prosiding Seminar Nasional, 13-14 Desember 2010 1279
  • 93. ISBN 978-602-98295-0-1Analisis Data Semua data ditampilkan dalam bentuk tabel frekuensi dan persentaseuntuk mendeteksi perbedaan satu unit / satuan data yang diperoleh, dilakukan ujidengan uji standar uji X2 (Chi Kuadrat), kemudian dilakukan analisis hubunganantara alel gen RAGE baik yang polimorfik maupun yang normal (wild type)dengan lamanya hiperglikemia, tekanan darah, kriteria NPDR, Non retinopatidiabetika, dan PDR dan kelompok kontrol. HASIL PENELITIANKarakteritik UmumUmurRerata umur penderita untuk kelompok DM dengan retinopati 60,6±8,45;kelompok tanpa retinopati 55,37±7,01 dan kelompok kontrol normal rata-rata32,40±11,88. Pada kelompok DM + Retinopati umur termuda 45 tahun dan yangtertua adalah 77 tahun sedangkan pada kelompok DM tanpa retinopati umurtermuda 45 tahun dan tertua 69 tahun, umur kontrol normal termuda 18 tahun danyang tertua adalah 60 tahun. Sebaran sampel Menurut Umur Umur Kelompok Total Persentase DM DM Non Kontrol (%) Retinopati Retinopati Normal 10-20 0 0 5 5 5,6 21-30 0 0 9 9 10 31-40 0 0 11 11 12,2 41-50 9 5 2 16 17,8 51-60 12 8 3 22 24,4 61-70 9 16 0 26 28,9 >71 0 1 0 1 1,1 Pada penelitian ini kelompok DM + retinopati terbanyak pada kelompok usia 51-60 tahun yaitu sebanyak 40%, sedangkan rentang usia 41-50 tahun dan rentang usia 61-70 tahun masing-masing sebanyak 30%. Untuk kelompok DM non retinopati terbanyak pada rentang usia 61-70 tahun sebanyak 53,33%, sedangkan untuk kelompok kontrol terbanyak berusia antara 31-40 tahun sebanyak 36,67%Prosiding Seminar Nasional, 13-14 Desember 2010 1280
  • 94. ISBN 978-602-98295-0-1 Jenis Kelamin Dari penelitian didapatkan jumlah sampel berjenis kelamin laki-laki sebanyak 46 orang (51%) dan perempuan sebanyak 44 orang (49%). Sebaran sampel Menurut Jenis Kelamin Jenis Kelompok Jumlah Persentase kelamin DM DM non Kontrol (%) retinopati retinopati normal Laki-laki 13 14 17 44 48,89 Perempuan 17 16 13 46 51,11 Total 30 30 30 30 100,00 Tingkat Pendidikan Tingkat pendidikan sampel yang paling banyak adalah SMA yaitu 44 orang terbagi dalam kelompok kasus sebanyak 25 orang dan kontrol normal ada 19 orang. Sebaran Sampel Menurut Pendidikan Pendidikan Kelompok Jumlah Persentase DM DM non Kontrol (%) retinopati retinopati normal SD 9 8 1 18 20,00 SMP 1 6 4 11 12,20 SMA 13 12 19 44 48,89 PT 7 4 6 17 18,80 Total 30 30 30 30 100,00 Tempat Tinggal Tempat Kelompok Jumlah Persentase Tinggal DM DM non Kontrol (%) retinopati retinopati normal Dalam kota 20 22 21 63 70 Luar kota 10 8 9 27 30 Total 30 30 30 30 100,00 Pada penelitian ini penduduk dalam kota ada 42 orang dari kelompok kasus atau sekitar 70% berdomisili di dalam kota, sedangkan penduduk luar kota hanya 18 orang (30%) saja.Prosiding Seminar Nasional, 13-14 Desember 2010 1281
  • 95. ISBN 978-602-98295-0-1 Karakteristik Faktor Resiko Riwayat Keluarga Pada penelitian ini terdapat 40 orang yang memiliki riwayat keluarga menderita Diabetes mellitus (44,4%) sedangkan 50 orang (55,6%) lainnya tidak memiliki riwayat keluarga penderita DM. Pada kelompok kasus terdapat 10 orang yang memiliki riwayat keluraga DM sedangkan pada kelompok kontrol 30 orang mempunyai riwayat keluarga penderita DM. Riwayat Keluarga yang Menderita DM Jenis Kelompok Jumlah Persentase kelamin DM DM non Kontrol (%) retinopati retinopati normal Ada 3 7 30 40 44,4 Tidak ada 27 23 0 50 55,6 Total 30 30 30 30 100,00 Durasi dan Lamanya Menderita Diabetes Mellitus Lamanya menderita DM dengan terjadinya Retinopati Durasi DM + Retinopati DM Non Jumlah DM NPDR NPDR NPDR PDR Retinopati (tahun) ringan sedang Berat 5-8 6 4 9 3 27 49 9-12 0 2 2 0 3 7 13-16 0 0 2 0 0 2 >17 0 0 0 2 0 2 Total 6 6 13 5 30 60 Pada penelitian ini jika dihubungkan antara derajat retinopati dengan durasi lamanya menderita DM didapatkan nilai kemaknaan yang signifikan yaitu p=0,008 dengan uju Chi square (α=0,05). Pada penderita DM retinopati didapatkan 22 orang (36,7%) telah mengalami DM selama 5-8 tahun. Onset yang sama pada penderita DM tanpa retinopati dijumpai pada 27 orang (45%) dibandingkan total sampel. Obesitas Rerata indeks massa tubuh (IMT) semua kelompok adalah 22,32±3,34. Setelah dilakukan uji Chi square didapatkan p=0,272 yang menunjukkan bahwa tidak ada perbedaan yang bermakna antara IMT dengan terjadinya DM retinopati.Prosiding Seminar Nasional, 13-14 Desember 2010 1282
  • 96. ISBN 978-602-98295-0-1 Sebaran IMT antara Kelompok kasus dan Kontrol IMT < 18,5 IMT 18,5-25,00 IMT > 18,5 (kg/m2) (kg/m2) (kg/m2) NPDR Ringan 0 6 0 NPDR Sedang 0 5 1 NPDR Berat 1 12 0 PDR 1 2 2 Non Retinopati 2 19 9 Kontrol Normal 2 23 5 Total 6 (6,67%) 67 (74,45) 17 18,88%) Karakteristik Umum Pemeriksaan Penunjang Perbandingan Kadar Gula Darah BSN, BSPP dan Tekanan Darah DM DM Tanpa Normal p value Retinopati Retinopati (n = 30) (n = 30) (n = 30) BSN 210,47±111,4 234,03±111,6 110,93±25,62 0,001 6 9 BSPP 243,57±84,82 255,83±79,74 115,73±21,31 0,001 Sistolik 131,00±20,23 131,00±18,45 110,93±25,62 0,001 Diastolik 80,67±11,43 81,00±8,449 76,67±21,23 0,001 Rerata kadar gula darah puasa pada kelompok non retinopati lebih tinggi dibandingkan dengan kelompok retinopati dan kontrol normal yaitu 234,03±111,69 (p=0,001), kadar gula darah 2 jam setelah makan juga lebih tinggi pada kelompok DM tanpa retinopati yaitu 255,83±79,74 dibandingkan dengan kelompok DM retinopati dan kelompok kontrol normal. Uji one-way Anova didapatkan p value 0,001 antara BSN/BSPP antara kelompok retinopati, tanpa retinopati dan kelompok kontrol normal. Sebaran Tajam Penglihatan dengan Snellen Chart Visus > 0,33 Visus 0,33-0,1 Visus < 0,1 OD OS OD OS OD OS NPDR Ringan 3 3 2 1 1 2 NPDR Sedang 1 2 5 2 0 2 NPDR Berat 5 3 4 7 4 3 PDR 1 0 0 5 4 0 Non Retinopati 57 55 2 3 1 2 Total 67 63 13 18 10 9Prosiding Seminar Nasional, 13-14 Desember 2010 1283
  • 97. ISBN 978-602-98295-0-1 Pada kelompok retinopati penurunan tajam penglihatan tertinggi pada kelompok NPDR Berat dan PDR sebanyak 4 orang dengan tajam penglihatan <0,1, sedangkan pada kelompok non retinopati didapatkan tajam penglihatan tertinggi yaitu > 0,33. Sebaran Subyek Penelitian Berdasarkan Suku Suku DM DM Non Normal Jumlah Retinopati Retinopati Banyuasin 1 0 0 1 Batak 0 1 1 2 Bengkulu 1 0 1 2 Jawa 0 2 2 4 Komering 1 0 0 1 Lahat 3 4 3 10 Muaraenim 2 1 3 6 MUBA 1 0 0 1 MURA 1 0 0 3 OI 1 5 0 10 OKI 2 1 0 6 OKU 3 3 4 10 Padang 0 1 1 2 Palembang 8 6 7 21 Prabumulih 0 1 1 2 Sekayu 5 3 1 9 Total 30 30 30 90 Dari tabel distribusi suku yang termasuk dalam penelitian sebanyak 15 suku yang tinggal di Sumatera Selatan. Suku terbanyak pada penelitian adalah Palembang yaitu 8 orang (26,67%) dari kelompok retinopati diabetik dan 6 orang (20%) dari kelompok non diabetik dan 7 orang (23,33%) dari kelompok kontrol normal Polimorfisme Gen RAGE -429T/C Pada Penderita Retinopati Diabetika Pada pemeriksaan PCR-RFLP pada promotor gen RAGE posisi 429 basa sebelah hulu dari start kodon dijumpai adanya polimorfisme alel wild type timin (T) menjadi alel mutan sitosin (C). Situs ini dapat dikenali oleh enzim restriksi AluI. Enzim AluI adalah enzim restriksi yang dapat menganali setiap sekuen AG↑CT. Pada individu tanpa polimorfisme -429T/C (wild type), gen RAGE tidak memiliki sekuen pengenalan AG↑CT, sedangkan pada individu yang memilikiProsiding Seminar Nasional, 13-14 Desember 2010 1284
  • 98. ISBN 978-602-98295-0-1 polimorfisme akibat mutasi titik ini AGTC→AGCT akan mempunyai satu situs pemotongan yang menyebabkan produk PCR akan terpotong. Dengan demikian produk PCR yang telah diinkubasi dengan enzim restriksi AluI pada individu yang wild type tidak akan terpotong dan menghasilkan satu pita DNA dengan ukuran 250 bp (genotip TT), sebaliknya produk PCR dari individu yang polimorfik -429T/C akan terpotong menjadi dua pita DNA dengan ukuran 162 bp dan 88 bp. Bila individu tersebut memiliki alel wild type dan mutan (heterozigot) maka akan diperoleh pita DNA dengan ukuran 250 bp, 162 bp. Hasil RFLP Gen RAGE -429T/C dengan Elektroforesis Pada Agarose 3% Distribusi Genotip Gen RAGE -429T/C Kelompok Genotip DM DM Non Normal Jumlah Retinopati Retinopati Wild type (TT) 18 (60%) 21 (70%) 27 (90%) 66 (73,33%) Mutan (TC, CC) 12 (40%) 9 (30%) 3 (10%) 24 (36,67%) Total 30 30 30 90 (100%) Dari hasil perhitungan statistik dengan Chi-square dengan α sebesar 0,05terdapat perbedaan bermakna antara distribusi frekuensi antara genotip alel wildtype dengan alel mutan -429T/C gen RAGE dengan p=0,028 Distribusi Frekuensi Alel Gen RAGE -429T/C Kelompok Alel DM DM Non Normal Retinopati Retinopati Alel T 0,8 0,85 0,95 Alel C 0,2 0,15 0,05 Total 1,0 1,0 1,0 Odds ratio = 7,85 (7,159-6,829) CI 95%, p=0,028 Penelitian ini menunjukkan bahwa adanya polimorfisme -429T/C gen RAGE dengan distribusi alel T (wild type) pada kelompok DM retinopatiProsiding Seminar Nasional, 13-14 Desember 2010 1285
  • 99. ISBN 978-602-98295-0-1 sebesar 80% dan pada kelompok non retinopati terdapat 85% dari sampel dan kelompok normal sebesar 95% sampel. Alel mutan C dijumpai pada 20% sampel DM retinopati, sedangkan DM non retinopati ada 15% dari sampel. Dapat disimpulkan bahwa genotip alel wild type berfungsi sebagai protektor. Dengan lain bahwa resiko penderita untuk menjadi retinopati lebih besar 7,85 kali pada penderita yang memiliki alel mutan. KESIMPULAN a. Pada populasi di Sumatera Selatan, ditemukan mutasi-mutasi pada promotor gen RAGE -429T/C sebanyak 40% pada penderita DM tipe 2 dengan retinopati diabetika, sedangkan pada penderita DM tanpa retinopati sebanyak 30% dan pada kelompok normal sebanyak 10%. b. Polimorfisme alel gen RAGE -429T/C pada promotor berpengaruh terhadap kejadian retinopati dengan Odds ratio 7,8. Terdapat hubungan yang bermakna antara polimorfisme gen RAGE -429T/C dengan terjadinya retinopati diabetika pada populasi di Sumatera Selatan DAFTAR PUSTAKAMohamed Q, Gillies MC, Wong TY. Management of Diabetic Retinopathy. JAMA 2007;298:902-916.Fong DS, Lloyd A, Ferris FL, Klein R. Diabetic Retinopathy. Diabetes Care 2004;27:2540-2553.Chalam KV, Lin S, and Mostafa S. Management of Diabetic Retinopathy in the Twenty-first Century. Northeast Florida Medicine 2005; 8-15.Fong DS, Lloyd A, Gardner TW, King GL, Blankenship G, Cavallerano JD, Ferris FL, Klein R. Diabetic Retinopathy. Diabetes care 2003; 26:99-102.Hudson B.I,.Stickland M.H, Grant PJ, Identification of Polymorphisms in the receptor for advanced glycation end product (RAGE) Gene: prevalence in type 2 diabetes and ethnic groups. Diabetes 47: 1155—57 , 1998Helen Vlassara :The AGE-receptor in the pathogenesis of diabetic complications: Diabetes Metab Res Rev 2001; 17: 436–443Kumaramanickavel G, Ramprasad V.L, Sripriyaa S, Kumari N U, George P.P, Sharmab T Association of Gly82Ser polymorphism in the RAGE gene with diabetic retinopathy in type II diabetic Asian Indian patients .Journal of Diabetes and Its Complications 16 (2002) 391–394Prosiding Seminar Nasional, 13-14 Desember 2010 1286
  • 100. ISBN 978-602-98295-0-1Jixiong X , Bilin X , Minggong Y , Shuqin L -429T/C and - 374T/A Polymorphisms of RAGE Gene Promoter Are Not Associated With Diabetic Retinopathy in Chinese Patients With Type 2 Diabetes Diabetes Care, Volume 26, Number 9, September 2003: 2696-2697Petrovic MG, Steblovnik K, Peterlin B, Petrovic D. The -429T/C and -374 T/A Gene Polymorphisms of The Receptor of Advanced Glycation End Produtc Gene are not risk factor for Diabetic Retinopathy In Caucasians With Type 2 Diabetes: Klin Monatsbl Augenheilkd 2003: 220: p 873-876Kankova K MD , Michal B; Dobroslav H ; Eva V. Polymorphisms 1704G/T, 2184A/G, And 2245G/A In The RAGE Gene Are Not Associated With Diabetic Retinopathy In NIDDM: Pilot Study Retina 2002 vol 22(1):p 119-221Yoshioka K, Yoshida T, Takakura Y, Umekawa T, Kogure A, Toda H, et all Relation between Polymorphisms G1704T and G82S of RAGE Gene and Diabetic Retinopathy in Japanese Type 2 Diabetic Patients. Internal Medicine 2005; 44:5Bierhaus A, Hofmann AM, Ziegler R, Nawroth PP :AGEs and their interaction with AGE-receptors in vascular disease diabetes mellitus.The AGE concept I Cardiovascular Research 37 ;1998:586–600Prosiding Seminar Nasional, 13-14 Desember 2010 1287
  • 101. ISBN 978-602-98295-0-1 HUBUNGAN ANTARA FAKTOR SOSIODEMOGRAFI, PENGETAHUAN DANSIKAP AYAH SELAMA MASA MENYUSUI TERHADAP PRAKTIK PEMBERIAN ASI EKSKLUSIF DI DAERAH URBAN JAKARTA SELATAN PADA TAHUN 2007 Suci Destriatania1,2, Judhiastuty Februhartanty2 1 Fakultas Kesehatan Masyarakat UNSRI 2 SEAMEO RCCN UI PENDAHULUAN Pemberian ASI eksklusif diketahui memiliki berbagai manfaat baik untukibu, bayi hingga lingkungan sosial tetapi kenyataannya praktik tersebut tidaklahmudah dilakukan karena membutuhkan dukungan berbagai pihak. Hal ini terlihatdari prevalensinya yang masih rendah termasuk di Indonesia. Data SurveiDemografi Kesehatan Indonesia (SDKI) Tahun 2007 menunjukkan bahwa rata-rata pemberian ASI eksklusif di Indonesia menurun sebesar 8% dari 40% (tahun2003) menjadi 32% (tahun 2007) dimana rata-rata praktik inisiasi daerah urban(41,6%) lebih rendah dibandingkan daerah rural (45,5%)1. Ayah merupakan sumber dukungan yang sangat penting selama periodemenyusui baik sejak pertama bayi dilahirkan hingga 6 bulan pertamakehidupannya. Menurut Bar-Yam dan Darby2 Ayah mempunyai 4 pengaruhpenting diantaranya: membuat keputusan mengenai pola pemberian makan bayiyang biasanya dilakukan sejak awal kehamilan, mendampingi ibu ketika pertamakali menyusui, mempengaruhi durasi menyusui hingga penggunaan susu formula.Partisipasi aktif ayah dalam pengambilan keputusan mengenai pola pemberianmakan bayi disertai sikap positif dan pengetahuan yang baik akan berpengaruhkuat terhadap inisiasi dan durasi menyusui2. Studi Alvarado et al3 menunjukkan bahwa calon ayah yang memilihpemberian ASI sebagai pola makan bagi bayinya memiliki pengetahuan yang lebihbaik. Berdasarkan studi Cohen et al4 diketahui bahwa Fathering Program yangmengedukasi ayah tentang hal-hal seputar menyusui memberikan dampak positifdimana 69% bayi masih disusui hingga 6 bulan pertama. Sayangnya, saat iniayah masih jarang dilibatkan secara rutin dalam program-program edukasiProsiding Seminar Nasional, 13-14 Desember 2010 1288
  • 102. ISBN 978-602-98295-0-1mengenai menyusui sehingga pada akhirnya mereka tidak dipersiapkan untukmendukung dan membantu ibu menyusui. Tanpa pengetahuan yang cukup tentang menyusui maka ayah cenderungakan bersikap negatif terhadap praktik menyusui. Hal tersebut sejalan denganstudi yang dialakukan oleh Freed et al5 dimana calon ayah yang bersikap negatifterhadap praktik menyusui merencanakan pemberian susu formula sebagai polapemberian makan pada bayi mereka. Sebaliknya, ayah yang merencanakanpemberian ASI eksklusif sebagai pola pemberian bayi mereka memilikipengetahuan yang lebih baik dan sikap positif terhadap menyusui. Tujuan studi ini adalah untuk mengetahui hubungan antara karakteristiksosiodemografi ayah, pengetahuan mengenai manajemen laktasi prenatal danpostnatal serta sikap ayah selama masa kehamilan, saat kelahiran dan masamenyusui terhadap praktik pemberian ASI eksklusif di wilayah urban JakartaSelatan pada Tahun 2007. BAHAN DAN METODE Studi ini merupakan analisis data sekunder dengan desain cross sectionaldari studi yang berjudul ―Peran Ayah Dalam Optimalisasi Praktik Pemberian ASI:Sebuah Studi di Daerah Urban Jakarta‖ (Februhartanty, 2008)8. Data dimasukkan dan dianalisis dengan menggunakan program Statistical Package forSocial Sciences (SPSS). Analisis univariat dilakukan untuk mendapatkaninformasi mengenai frekuensi dan persentase dari variabel-variabel yang diamati.Chi square digunakan untuk menganalisis hubungan variabel independen(karakteristik sosiodemografi ayah, pengetahuan dan sikap ayah ) dan dependen(pemberian ASI eksklusif) yang berskala ordinal. Terdapatnya perbedaanbermakna dinyatakan jika p<0,05. Analisis multivariat menggunakan regresilogistik untuk mengetahui faktor dominan yang mempengaruhi praktik pemberianASI eksklusif. Variabel yang masuk ke dalam kandidat model multivariat diperolehdari hasil analisis chi square dengan kriteria nilai p≤0,25. Variabel dengan p>0,05kemudian dikeluarkan dari model dengan prosedur backward stepwise. Sebesar 536 pasangan suami istri yang menyatakan kesediannya untukterlibat dalam studi serta memenuhi kriteria inklusi dan eksklusi diambil sebagaiProsiding Seminar Nasional, 13-14 Desember 2010 1289
  • 103. ISBN 978-602-98295-0-1sampel karena pemilihan sampel acak tidak memungkinkan dilakukan dalam studiini. Sampel yang terlibat dalam studi ini adalah rumah tangga dengan ibu yangsecara umum terlihat sehat, tinggal dalam satu rumah dengan ayah kandung bayi,ibu pernah menyusui bayinya dan ibu melahirkan bayi tunggal cukup bulandengan persalinan normal sedangkan rumah tangga dengan bayi yang memilikikelainan cacat bawaan, bayi pernah diletakkan di inkubator sesaat setelahdilakhirkan selama lebih dari satu hari dan bayi dengan berat lahir rendah tidakdiikutkan dalam studi. Studi dilaksanakan di dua kecamatan yang berada di wilayah JakartaSelatan yaitu Kecamatan Pasar Minggu (Kelurahan Pejaten Timur, Kebagusandan Jati Padang) dan Kecamatan Kebayoran Lama (Kelurahan Pondok Pinang,Cipulir dan Grogol Selatan). Pemilihan kecamatan dan kelurahan dilakukansecara purposif berdasarkan jumlah kunjungan neonatus dan jumlah kelahiranyang tercatat di Kantor Suku Dinas Kesehatan Jakarta Selatan serta PuskesmasKecamatan. Posyandu/RW yang terpilih adalah Posyandu/RW yang memilikijumlah bayi usia 0-6 bulan terbanyak. Informasi mengenai praktik pemberian ASI eksklusif, karakteristiksosiodemografi, meliputi: umur, pendidikan, pekerjaan dan pendapatan,pengetahuan manajemen laktasi prenatal dan postnatal serta sikap pada saatkehamilan, saat kelahiran dan selama menyusui didapatkan melalui wawancaralangsung dengan menggunakan kuesioner terstruktur. HASILKarakteristik Sosiodemografi, Pengetahuan dan Sikap Ayah TerhadapPraktik Pemberian ASI Eksklusif Lebih dari sebagian besar bayi dalam studi ini (70,1%) tidak disusuieksklusif. Rata-rata usia ayah pada saat studi berlangsung adalah 32,95 tahundimana mayoritas ayah berpendidikan menengah (68,5%) artinya ayah berhasilmenamatkan pendidikan di tingkat SMA, akademi dan universitas. Sebesar51,1% bekerja di sektor formal sebagai pegawai negeri sipil dan pegawai swastadan 49,6% memiliki pendapatan di atas UMP DKI Jakarta. Diketahui pula bahwaProsiding Seminar Nasional, 13-14 Desember 2010 1290
  • 104. ISBN 978-602-98295-0-1sebagian besar ayah memiliki anak lebih dari 1orang (61,8%) dan tinggal sebagaikeluarga inti (51,3%). Tabel 1 Karakteristik Sosiodemografi, Pengetahuan dan Sikap Ayah Variabel n % Umur ≤ 32,95 269 50,2 >32,95 267 49,8 Pendidikan Tingkat pendidikan dasar 169 31,5 Tingkat pendidikan menengah 367 68,5 Pekerjaan Tidak bekerja 10 1,9 Bekerja di sektor informal 252 47,0 Bekerja di sektor formal 274 51,1 Pendapatan ≤ UMP DKI Jakarta 265 50,4 > UMP DKI Jakarta 261 49,6 Jumlah anak >1 orang 331 61,8 1 orang 205 38,2 Komposisi rumah tangga Keluarga inti saja 275 51,3 Bukan keluarga inti 261 48,7 Mayoritas ayah memiliki pengetahuan manajemen laktasi prenatal (83,6%)dan postnatal (59,1%) rendah. Masih banyak ayah yang belum mengetahuikolostrum (95,7%) dan keuntungannya (72,8%). Lebih dari sebagian ayah tidakmengetahui keuntungan bayi disusui segera (55,8%), lama pemberian ASIeksklusif (55,2%) dan usia sebaiknya bayi mulai menerima susu formula (63,8%).Hanya 44,6% ayah yang mengetahui solusi tetap memberikan ASI ketika ibukembali bekerja.Prosiding Seminar Nasional, 13-14 Desember 2010 1291
  • 105. ISBN 978-602-98295-0-1 Tabel 2 Pengetahuan Ayah Variabel n % Pengetahuan Manajemen Laktasi Prenatal Tabel 3 Rendah 448 83,6 Hasil Tinggi 88 16,4 Pengetahuan Manajemen Laktasi Postnatal Rendah 317 59,1 Tinggi 219 40,9 Pengetahuan Ayah Mengenai Manajemen Laktasi Prenatal dan Postnatal (n=536) No Pertanyaan Pengetahuan Benar Salah % % Pengetahuan Manajemen Laktasi Prenatal 1. Apa yang anda ketahui mengenai 95,3 4,7 keuntungan menyusui? 2. Apakah kolostrum itu? 4,3 95,7 3. Apakah keuntungan dari kolostrum? 27,2 72,8 4. Menurut anda apakah susu formula sama 95 5 baiknya dengan ASI? 5. Sebutkan setidaknya satu kesulitan 72,8 27,2 menyusui? 6. Apa yang bisa dilakukan seorang suami 67,4 32,6 untuk membantu mengatasi kesulitan 1. menyusui? 98,5 1,5 2. Pengetahuan Manajemen Laktasi 76,5 23,5 3. Postnatal 44,2 55,8 Apa yang anda ketahui mengenai anak 4. sehat? 44,8 55,2 Apa keuntungan rawat gabung? 5. Apakah keuntungan bayi disusui ASI segera 36,2 63,8 setelah dilahirkan? 6. Sampai umur berapa bayi seharusnya hanya 76,5 23,5 diberikan ASI saja? 7. Pada usia berapa sebaiknya bayi menerima 55,4 44,6 susu formula? 8. Apa keuntungan dari menyusui ASI hingga 2 78,7 21,3 tahun? 9. Bagaimana seorang ibu yang bekerja dapat 92 8 tetap menyusui bayinya dengan ASI? Seberapa sering seorang anak seharusnya disusui ASI? Apa tanda-tanda anak yang telah cukup minum ASI?Prosiding Seminar Nasional, 13-14 Desember 2010 1292
  • 106. ISBN 978-602-98295-0-1 Sebagian besar ayah (89,6%) menunjukkan sikap positif pada masakehamilan tetapi hal yang menjadi perhatian adalah bahwa sebesar 88,1% ayahyang cenderung mengikuti nasihat petugas kesehatan. Ayah hendaknyamenyaring kembali informasi yang diberikan oleh petugas kesehatan dan harusmemiliki sikap tegas jika petugas kesehatan menunjukkan sikap negatif ataudengan kata lain tidak mendukung pemberian ASI. Berbeda halnya dengan sikapyang ditunjukkan ayah pada saat kelahiran dimana hanya 37,3% ayah yangmenunjukkan sikap positif terhadap praktik pemberian ASI Terlihat bahwa ayahmenyetujui untuk memberikan madu atau air (62,5%) dan susu formula (74,1%)kepada bayi setelah dilahirkan sebagai pengganti ASI sebelum ASI keluar.Sebesar 85,4% ayah juga berpendapat bahwa apa yang dilakukan petugaskesehatan pada bayinya adalah yang terbaik. Tabel 4 Sikap Ayah Variabel n % Sikap Selama Masa Kehamilan Bersikap negatif 56 10,4 Bersikap positif 480 89,6 Sikap Saat Kelahiran Bersikap negatif 336 62,7 Bersikap positif 200 37,3 Sikap Selama Masa Menyusui Bersikap negatif 204 38,1 Bersikap positif 332 61,9 Walaupun sebagian besar ayah (61,9%) mendukung ibu untuk menyusuitetapi ada beberapa pernyataan sikap yang harus dicermati karena akan dapatmenghambat kesusksesan pemberian ASI eksklusif. Mayoritas ayah setujubahwa susu formula dapat diberikan pada bayi di bawah usia 6 bulan (93,3%) dansebagian besar (66,6%) berpendapat bahwa jika anak menangis merupakanindikasi bahwa kuantitas ASI ibu sedikit atau kurang memenuhi kebutuhan anak.Diketahui pula bahwa sebesar 58% ayah tidak mengizinkan ibu menyusui di mukaumum. Pembagian tanggung jawab yang masih kaku antara suami istri jugaterlihat masih dominan dimana sebesar 73,1% ayah setuju bahwa tugas merekaadalah mencari nafkah dan tugas istri adalah mengurusi segala keperluan rumahtangga dan keluarga.Prosiding Seminar Nasional, 13-14 Desember 2010 1293
  • 107. ISBN 978-602-98295-0-1 Tabel 5 Hasil Pernyataan Sikap Ayah Terhadap Praktik Menyusui Selama Masa Kehamilan (n=536) No Pernyataan Sikap Ayah Setuj Netr Tidak Terhadap Praktik Menyusui u al Setuj % % u% Selama Masa Kehamilan 1. Status gizi selama kehamilan tidak 21,3 13,1 65,7 berhubungan dengan produksi dan 2. kualitas ASI. 93,7 4,7 1,7 3. Suami menemani saat pemeriksaan 98,0 0 1,5 4. kehamilan. 88,1 8,0 3,9 Bapak setuju istri bapak menyusui anak 5. terkecil. 79,5 8,2 12,3 Bapak selalu mengikuti nasihat petugas 6. kesehatan. 48,7 40,5 10,8 Bapak berencana mendukung istri bapak untuk menyusui ASI hingga bayi berusia 1. 2 tahun. 81,3 11,0 7,6 2. Bapak memiliki cukup pengetahuan 84,0 7,5 8,6 mengenai gizi dan kesehatan anak. 3. Saat Kelahiran 64,7 16,0 19,2 Suami menemani istri di dalam ruang 4. persalinan. 62,5 13,4 24,1 Bayi segera disusui ASI setelah 5. dilahirkan dalam waktu 30 menit hingga 1 74,1 7,1 18,8 jam. Jika bayi tidak segera disusui setelah 6. kelahiran, maka ia akan mengalami 85,4 11,0 3,5 kesulitan menyusui. Memberikan madu atau air sebelum ASI 1. keluar setelah melahirkan disarankan. 63,1 8,6 28,4 Saat ASI belum keluar setelah 2. melahirkan maka bayi boleh diberikan 92,9 3,9 3,2 susu formula sebagai pengganti ASI. 3. Apa yang dilakukan petugas kesehatan 84,9 5,6 4,5 terhadap bayi kami adalah yang terbaik. 4. Selama Masa Menyusui 62,3 7,8 29,9 Bayi hanya diberikan ASI saja hingga 5. usia 6 bulan. 58 14,9 27,1 Semakin sering disusui, semakin banyak 6. ASI yang keluar. 93,3 2,6 4,1 Semakin banyak ibu makan, makaProsiding Seminar Nasional, 13-14 Desember 2010 1294
  • 108. ISBN 978-602-98295-0-1 semakin banyak ASI keluar. 7. ASI dapat diperas/dipompa dan diberikan 43,1 23,9 33,0 kepada bayi saat ibunya pergi. 8. Bapak tidak mengizinkan istri bapak 58,4 17,4 24,3 menyusui di muka umum. 9. Untuk bayi usia di bawah 6, ASI adalah 66,6 10,3 23,1 makanan utamanya dan susu formula/ botol/ kaleng digunakan sebagai 10. tambahan saja. 19,6 48 72,4 11. Saat istri bapak kesal, maka ASI istri 89,9 2,8 7,3 bapak menjadi kurang. 12. Suami dapat menjadi salah satu sumber 13,6 11,0 75,4 kekesalan istri. 13. Jika setelah disusui ASI anak bapak 31,3 11,6 57,1 masih menangis, maka itu menandakan ASI istri bapak kurang. 14. Susu formula lebih mudah/praktis 73,1 11,4 15,5 daripada ASI. ASI lebih murah daripada susu 15. formula/botol/kaleng. 39,2 32,8 28,0 Bapak merasa tersisih pada saat istri 16. bapak menyusui. 30,8 18,1 51,1 Suami yang kurang pengetahuannya 17. beranggapan bahwa dukungan suami 91,8 4,9 3,4 tidak penting dalam kesuksesan 18. menyusui. 76,7 13,1 10,3 Tanggung jawab suami adalah mencari nafkah dan tanggung jawab istri adalah mengurusi keluarga dan rumah. Bapak lebih suka momong anak daripada mengerjakan pekerjaan rumah. Suami tidak dapat selalu membantu di rumah karena sudah capek mencari nafkah. Bapak merasa puas dengan kehidupan rumah tangga bapak setelah mempunyai anak. Bapak mengerti bahwa istri bapak tidak dapat selalu melayani kebutuhan bapak karena anak adalah prioritas dalam keluarga.Hubungan antara Karakteristik Sosiodemografi, Pengetahuan dan SikapAyah Terhadap Pemberian ASI Eksklusif Terdapat hubungan yang signifikan antara karakteristik sosiodemografi ayahyaitu jumlah anak (pv 0,002; OR 0,534; CI 95% 0,35-0,80) dan komposisi rumahProsiding Seminar Nasional, 13-14 Desember 2010 1295
  • 109. ISBN 978-602-98295-0-1tangga (pv 0,037; OR 0,671; CI 95% 0,46-0,97). Praktik pemberian ASI eksklusifcenderung lebih tinggi 0,5 kali dan 0,6 kali lebih tinggi pada ayah yang memiliki 1orang anak dan tinggal dengan bukan keluarga inti. Hal serupa juga diketahui bahwa terdapat hubungan yang signifikan antarapengetahuan ayah mengenai manajemen laktasi postnatal (pv 0,015; OR 1,633;CI 95% 1,09-2,43) dan sikap ayah selama masa menyusui (pv 0,047; OR 1,463;CI 95% 1,00-2,13) dengan praktik pemberian ASI. Praktik pemberian ASIeksklusif lebih tinggi 1,4 kali dan 1,6 kali lebih tinggi pada ayah yang memilikipengetahuan mengenai manajemen laktasi postnatal yang tinggi menunjukkansikap positif terhadap praktik menyusui selama masa menyusui.Permodelan Multivariat Praktik Pemberian ASI Eksklusif Analisis multivariat dengan uji regresi logistik dilakukan untuk mengetahuipengaruh karakteristik sosiodemografi, pengetahuan manajemen laktasi prenataldan postnatal serta sikap ayah selama masa kehamilan, saat kelahiran damenyusui terhadap praktik pemberian ASI eksklusif secara bersamaan. Terdapat6 variabel yang terseleksi (p<0,25) untuk masuk dalam model awal analisismultivariat, diantaranya: umur, status pekerjaan, jumlah, komposisi keluarga,pengetahuan manajemen laktasi prenatal, pengetahuan manajemen laktasipostnatal, sikap selama kehamilan dan sikap selama masa menyusui. Variabel-variabel yang tidak signifikan kemudian dikeluarkan dari model menggunakanprosedur backward stepwise. Variabel yang memiliki hubungan yang signifikan dengan praktik pemberianASI eksklusif, yaitu: paritas ayah (pv 0,003; OR 0,537; CI 95% 0,358-0,806) dansikap ayah selama masa menyusui (pv 0,018; OR 1,623; CI 95% 1,086-2,425).Hasil analisis dapat diinterpretasikan bahwa praktik pemberian ASI eksklusif 0,5kali lebih tinggi pada ayah yang memiliki 1 orang anak dibandingkan dengan ayahyang telah memiliki lebih dari 1 orang anak. Praktik pemberian ASI eksklusif jugaakan 1,6 kali lebih tinggi pada ayah yang menunjukkan sikap positif ataumendukung praktik menyusui selama masa menyusui. Dapat dikatakan praktikpemberian ASI eksklusif akan 1,6 lebih tinggi pada ibu yang mendapat dukunganProsiding Seminar Nasional, 13-14 Desember 2010 1296
  • 110. ISBN 978-602-98295-0-1dari ayah untuk menyusui selama masa menyusui dibandingkan ibu yang tidakmendapat dukungan dari ayah untuk menyusui. Tabel 6 Model Akhir Hasil Analisis Multivariat Praktik Pemberian ASI Eksklusif Variabel B p- OR CI 95% value Jumlah Anak -0,622 0,003 0,537 0,358- 0,806 Sikap Selama Masa 0,484 0,018 1,623 1,086- Menyusui 2,425 Konstanta -0,984 0,000 0,374 PEMBAHASANAyah harus dipersiapkan dengan baik agar siap menghadapi peran barunyaterutama dalam hal mendukung ibu untuk menyusui mengingat perannya begitupenting mulai dari membuat keputusan mengenai pola pemberian makan bayi,mendampingi ibu ketika pertama kali menyusui, mempengaruhi durasi menyusuihingga penggunaan susu formula2. Tetapi sayangnya tidak banyak kesempatanyang diberikan pada ayah untuk mempersiapkan dirinya agar dapat membantudan mendukung ibu untuk menyusui. Pengetahuan tentang praktik menyusuidibutuhkan ayah untuk menghadapi mitos dan pemahaman yang salah tentangmenyusui serta dapat membantu ibu dalam mengatasi kesulitan menyusui 5. Hasilstudi menunjukkan bahwa pengetahuan ayah mengenai laktasi postnatalberhubungan signifikan terhadap praktik pemberian ASI eksklusif dimana praktikpemberian ASI eksklusif cenderung 1,4 kali lebih tinggi pada ayah yang memilikipengetahuan postnatal tinggi dibandingkan ayah yang memiliki pengetahuanpostnatal rendah. Studi intervensi yang memberikan edukasi pada ayah mengenaimanajemen laktasi terbukti memberi dampak yang baik terhadap praktikProsiding Seminar Nasional, 13-14 Desember 2010 1297
  • 111. ISBN 978-602-98295-0-1menyusui7,8. Pisacane8 dalam studinya menunjukkan bahwa informasi yangdidapatkan ayah dari sesi pelatihan mengenai manajemen laktasi dapatmeningkatkan peran ayah dalam mendukung kesuksesan menyusui. Ayahdiberikan informasi seperti bagaimana mengatasi volume ASI yang tidak sufisien,masalah-masalah yang terkait dengan payudara serta bagaimana mengenali danmenerima peran pentingnya untuk mencapai kesuksesan praktik pemberian ASI.Prevalensi pemberian ASI eksklusif 6 bulan lebih tinggi pada ayah di kelompokintervensi yang menerima informasi mengenai manajemen laktasi (25%)dibanding ayah pada kelompok kontrol yang hanya diberikan informasi tentangmanfaat ASI saja (15%). Hal serupa juga terlihat pada studi intervensi yangdilakukan di Los Angles Departement of Water and Power (LA DWP) denganmemberikan edukasi pada ayah yang bertujuan agar ayah mengenali danmenerima peran pentingnya terhadap kesuksesan praktik menyusui. Informasiyang diberikan yaitu mengenai perawatan dan penggunaan pompa ASI,penyimpanan ASI perah serta cara mengatasi kesulitan menyusui yang terkaitdengan masalah payudara. Rata-rata durasi menyusu semua bayi yang ayahnyaberpartisipasi dalam program tersebut adalah 8 bulan dimana sebesar 69% bayitersebut masih menerima ASI eksklusif hingga 6 bulan. Peran ayah bukan hanya sebatas pencari nafkah atau penopang ekonomikeluarga tetapi dapat pula menjadi sosok siaga di rumah dan juga teman berbagitanggung jawab dalam hal pengasuhan anak dan penyelesaian tugas rumahtangga. Manfaat keterlibatan ayah dalam hal pengasuhan anak terlihat daridukungan dan kasih sayang yang dirasakan oleh ibu terutama ketika melakukantanggung jawab pengasuhan anak11. Sikap ayah merupakan komponen pentingbagi ibu dalam meneruskan pemberian ASI setelah meninggalkan tempatpersalinan dan mengatasi masalah-masalah yang menghambat praktik menyusui,misalnya: masalah yang berkaitan dengan payudara (puting lecet, payudarabengkak, mastitis, abses payudara)10-11. Data hasil studi menunjukkan bahwa praktik pemberiaan ASI eksklusifberhubungan signifikan dengan sikap ayah selama masa menyusui. Praktikpemberian ASI eksklusif akan 1,6 kali lebih tinggi pada ayah yang bersikap positifterhadap praktik menyusui selama masa menyusui. Studi Giugliani 12Prosiding Seminar Nasional, 13-14 Desember 2010 1298
  • 112. ISBN 978-602-98295-0-1menunjukkan bahwa ibu berniat akan menyusui bayinya jika ayah menunjukkandukungan positif terhadap praktik menyusui. Sebaliknya, ibu akan memilih untukmemberikan susu formula jika ayah tidak mendukung praktik menyusui 2. Korelasiyang kuat antara pemilihan metode pemberian makan dengan sikapmengindikasikan bahwa sikap ayah merupakan proksi yang harusdipertimbangakan terhadap sikap ibu untuk menyusui atau tidak menyusui 13.Partsisipasi aktif ayah dalam pengambilan keputusan pemberian ASI disertaidengan sikap positif dan pengetahuan yang baik mengenai manfaat menyusuidiketahui dapat memberi pengaruh kuat terhadap inisiasi menyusu segera dandurasi menyusui dalam jangka waktu lama4. Dukungan ayah terhadap praktikmenyusui kadang menjadi tidak konsisten karena beberapa alasan, diantaranya:tergganggunya hubungan seksual dengan pasangan, merasa terabaikan oleh ibukarena menyusui bayi, berkurangnya perhatian dari ibu karena sebagian besarwaktunya terfokus pada pengasuhan bayi serta berkurangnya kesempatan untukmembina hubungan dengan bayi2. Hal tersebut dapat berpengaruh negatifterhadap inisiasi dan rata-rata praktik pemberian ASI8. KESIMPULAN Rata-rata praktik pemberian ASI eksklusif 6 bulan masih terbilang rendah.Walaupun sebagian besar ayah memiliki pengetahuan manajemen laktasiprenatal (83,6% ) dan postnatal rendah (59,1%) tetapi sikap mereka terhadappraktik menyusui terutama pada masa kehamilan (89,6%) dan menyusui (61,9%)terbilang positif dibandingkan pada saat kelahiran. Bagaimanapun, sebagianbesar ayah menunjukkan persetujuannya terhadap pemberian makananprelakteal (air, madu, susu formula) kepada bayi sebelum ASI keluar dan percayasepenuhnya pada tenaga kesehatan terkait dengan bayi mereka dimana haltersebut dapat menjadi resiko pemberian susu formula. Jumlah anak yangdimiliki, komposisi rumah tangga, pengetahuan manajemen laktasi postnatal dansikap ayah selama masa menyusui diketahui berhubungan signifikan denganpraktik pemberian ASI eksklusif dimana jumlah anak dan sikap ayah selama masaProsiding Seminar Nasional, 13-14 Desember 2010 1299
  • 113. ISBN 978-602-98295-0-1menyusui merupakan faktor dominan yang berhubungan dengan praktikpemberian ASI eksklusif. SARAN Ayah perlu dipersiapkan dengan baik untuk memberikan dukungan danmengatasi kesulitan-kesulitan yang dihadapi ibu pada masa menyusui. Tanpapengetahuan yang baik maka akan sulit bagi ayah untuk menjalankan perannyatersebut. Oleh karena itu, ayah harus dikikutsertakan dan dilibatkan sedinimungkin dengan menyediakan ruang diskusi bagi ayah pada saat antenatal carekhususnya mengenai ASI eksklusif dan manfaatnya, kolostrum dan manfaatnya,resiko pemberian makanan prelakteal, usia yang tepat dalam memperkenalkansusu formula, kesulitan-kesulitan menyusui dan cara yang dapat dilakukan ayahuntuk membantu mengatasi kesulitan tersebut sehingga ia terus mendukung ibuuntuk menyusui sejak masa prenatal hingga masa postnatal. Selain itu, perluadanya Father Support Group sebagai media atau forum berbagi pengalamandan pengetahuan seputar menyusui sehingga ayah tetap mendukung ibu untukmelanjutkan pemberian ASI sesuai dengan waktu yang direkomendasikan olehWHO. Suasana lingkungan belajar yang saling mendukung dan menghargai antarsesama orang tua yang bertemu secara regular dapat membuat dan interaksiyang tercipta dari lingkungan sosial melalui kesamaan fase hidup, cerita,pengalaman dan perhatian dapat meningkatkan pengetahuan ayah, membuatayah menjadi lebih peka terhadap hal-hal yang berkaitan dengan kesehatan anakserta mengenali peran mereka. DAFTAR PUSTAKAStatistics Indonesia, National Family Planning Coordinating Board, Ministry of Health, and ORC Macro. 2007, Demographic Health Survey. Jakarta, Indonesia; Calverton, Maryland, USA.Bar-Yam, NB and Darby L. 1997. ‗Fathers And Breastfeeding: A Review Of The Literature‘, J Hum Lact, vol. 13, pp. 45–50Alvarado, IR. et al. 2006. ‗Explaratory study: Breastfeeding Knowledge, Attitudes Towards Sexuality and Breastfeeding, and Disposition Towards Supporting Breastfeeding in Future Puerto Rican Male Parents‘, PRHSJ, vol. 25, no. 4.Prosiding Seminar Nasional, 13-14 Desember 2010 1300
  • 114. ISBN 978-602-98295-0-1Cohen, R., Linda L and Wendy, S. 2002. ‗A Description of Male-Focused Breastfeeding Promotion Corporate Lactation Program‘, J Hum Lact, vol. 18, no.1Freed, GL., Kennard FJ., Schanler RJ. 1992. ‗Attitudes of Expectant Fathers Regarding Breast-Feeding‘, Pediatrics, vol. 90, pp. 224-227.Cohen, R., Linda L and Wendy, S. 2002. ‗A Description of Male-Focused Breastfeeding Promotion Corporate Lactation Program‘, J Hum Lact, vol. 18, no.1Pisacane, A. et al. 2005. ‗A Controlled Trial of The Father‘s Role in Breastfeeding Promotion‘, Pediatrics, vol. 116, no. 4, pp. 494-498.Februhartanty, Judhiastuty. 2008. ‗Peran Ayah dalam Optimalisasi Praktik Pemberian ASI: Sebuah Studi di Daerah Urban Jakarta‘. Disertasi Fakultas Kedokteran UI. JakartaColeman, WL., C Garfield and Committee on Psychosocial Aspects of Child and Family Health. 2004. ‗Fathers and Pediatricians: Enhancing Men‘s Roles in the Care and Develepment of Their Children‘, Pediatrics, vol. 113, pp. 1406-1411.Arora, S. et al. 2000. ‗Major Factors Influencing Breastfeeding Rates: Mothers Perception of Fathers Attitude and Milk Supply‘, Pediatrics, vol. 106, no. 5, pp. e67.Stremler, J and Dalia Lovera. 2004. ‗Insight From a Breastfeeding Peer Support Pilot Program for Husbands and Father of Texas WIC Participants‘, J Hum Lact, vol. 20, no. 4, pp. 417-422.Giugliani, ER. et al. 1994. ‘Are fathers prepared to encourage their partners to breast feed? A study about fathers knowledge of breast feeding‘, Acta Paediatr, vol. 83, no. 11, pp. 1127-31.Scott, JA., I Shaker and M Reid. 2004. ‗Parental Attitudes Towards Breasfeeding: Their Association with Feeding Outcome at Hospital Discharge‘, Birth 2004, vol. 31, no. 2, pp. 125-131.Prosiding Seminar Nasional, 13-14 Desember 2010 1301
  • 115. ISBN 978-602-98295-0-1 Konsep Diri Orang Tua yang memiliki Anak Retardasi Mental di Yayasan Pembinaan Anak Cacat Palembang Ira Kusumawaty, Era Faradisa (Politeknik Kesehatan Palembang) ABSTRAKPrevalensi retardasi mental di Indonesia saat ini diperkirakan telah mencapai 1-3% jumlah penduduk. Penanganan retardasi mental tidaklah mudah, khususnyaanak yang mengalami retardasi mental berat, diperlukan perawatan, bimbinganserta pengawasan sepanjang hidupnya. Tanggapan negatif masyarakat tentanganak retardasi mental menimbulkan berbagai macam reaksi orang tua yangmemiliki anak retardasi mental. Kondisi ini dapat mempengaruhi konsep diri orangtua yang memiliki anak retardasi mental. Penelitian ini bertujuan untuk mengetahuigambaran konsep diri orang tua dengan anak retardasi mental di YayasanPembinaan Anak Cacat Palembang. Metode penelitian yang digunakan adalahdeskriptif kuantitatif, penelitian dilaksanakan bulan Juni 2010. Populasi penelitianini adalah seluruh orang tua yang mempunyai anak retardasi mental danpengambilan sampel dilakukan dengan teknik accidental sampling. Hasil analisisunivariat menunjukkan bahwa 68,8% responden memiliki konsep diri positif dan31,3% responden memiliki konsep diri negatif. Responden dengan citra tubuhpositif dan negatif masing-masing 50%, ideal diri realistis dan tidak realistismasing-masing sebanyak 50%, harga diri tinggi dan rendah masing-masing 50%,78,1% responden puas terhadap peran dan tidak puas 21,9% responden, 75%responden memiliki identitas diri jelas dan 25% responden tidak memiliki identitasdiri yang jelas. Pengembangan konsep diri positif sangat diperlukan bagi orang tuasebagai bentuk penerimaan kondisi anaknya yang mengalami retardasi mental,sehingga proses pertumbuhan dan perkembangannya dapat berlangsung optimal.Kata Kunci : Orang tua, Konsep Diri, Retardasi MentalDaftar Bacaan: 14 ( 1995-2010 ) PENDAHULUANA. Latar Belakang Tidak semua individu dilahirkan dalam keadaan normal. Beberapa diantaranya memiliki keterbatasan baik secara fisik maupun psikis yang telah dialami sejak awal masa perkembangan. Salah satu hambatan perkembangan yang dialami oleh seorang anak adalah retardasi mental. Lumbantobing (2001) dalam Utami (2009) berpendapat bahwa retardasi mental adalah suatu keadaan perkembangan mental yang terhenti atau tidak lengkap, ditandai olehProsiding Seminar Nasional, 13-14 Desember 2010 1302
  • 116. ISBN 978-602-98295-0-1 adanya kelemahan (impairment) keterampilan atau kecakapan (skills) selama masa perkembangan sehingga berpengaruh pada semua tingkat intelegensia, yaitu kemampuan kognitif, bahasa, motorik, dan sosial. Retardasi mental merupakan masalah dunia dengan implikasi yang besar terutama bagi negara berkembang. Diperkirakan angka kejadian retardasi mental berat sekitar 0,3% dari seluruh populasi, dan hampir 3 % mempunyai IQ di bawah 70%. Sebagai sumber daya manusia tentunya mereka tidak bisa dimanfaatkan, karena 0,1% dari anak-anak ini memerlukan perawatan, bimbingan serta pengawasan sepanjang hidupnya (Swaiman, 1989 dalam Soetjiningsih, 1995). Prevalensi penderita keterbelakangan mental di Indonesia saat ini diperkirakan telah mencapai satu sampai dengan tiga persen dari jumlah penduduk seluruhnya dan jumlah tersebut dimungkinkan akan terus bertambah dari tahun ke tahun (Hendriani.dkk, 2006). Masalah keterbelakangan mental, seperti dikemukakan oleh Budhiman dalam Hendriani.dkk (2006), memang perlu mendapatkan perhatian mengingat sejumlah tulisan sejak periode 1981 telah mengemukakan bahwa keterbelakangan atau retardasi mental merupakan masalah yang cukup besar di Indonesia, meskipun tetap diakui tidak ada data yang lengkap dan pasti tentang jumlah mereka di negara ini. Ketidaklengkapan data tersebut dimungkinkan karena tidak semua penderita dapat tercatat. Selama ini pencatatan sebatas dilakukan pada penderita yang datang berobat atau memeriksakan diri, serta mereka yang terdaftar di sekolah luar biasa. Terlepas dari bagaimanapun kondisi yang dialami, pada dasarnya setiap manusia memiliki hak yang sama untuk memperoleh kebahagiaan dalam hidupnya. Setiap orang berhak untuk tumbuh dan berkembang dalam lingkungan yang kondusif dan suportif, termasuk bagi mereka yang mengalami keterbelakangan mental. Akan tetapi realita yang terjadi tidaklah selalu demikian. Di banyak tempat, baik secara langsung maupun tidak, individu berkebutuhan khusus ini cenderung disisihkan dari lingkungannya. Penolakan terhadap mereka tidak hanya dilakukan oleh individu lain di sekitar tempat tinggalnya, namun beberapa bahkan tidak diterima dalam keluarganya sendiri. Beragam perlakuan pun dirasakan oleh mereka. Mulai dari penghindaran secara halus, penolakan secara langsung, sampai dengan sikap-sikap danProsiding Seminar Nasional, 13-14 Desember 2010 1303
  • 117. ISBN 978-602-98295-0-1 perlakuan yang cenderung kurang manusiawi. Padahal apa yang sebenarnya terjadi dalam diri mereka hanyalah hambatan pada perkembangan intelektualnya (Werner, 1987 dalam Hendriani.dkk, 2006). Tanggapan negatif masyarakat tentang anak retardasi mental menimbulkan berbagai macam reaksi orang tua yang memiliki anak retardasi mental. Anak yang retardasi mental disembunyikan dari masyarakat karena orang tua merasa malu mempunyai anak keterbelakangan mental. Di sisi lain, ada pula orang tua yang memberikan perhatian lebih pada anak retardasi mental. Orang tua yang menyadari memiliki anak retardasi mental berusaha memberikan yang terbaik pada anaknya dengan meminta bantuan pada ahli yang dapat menangani anak retardasi mental. Orang tua yang memahami dan menyadari akan kelemahan anak retardasi mental merupakan faktor utama untuk membantu perkembangan anak dengan lingkungan (Suryani, 2005 dalam Utami 2009). Di Yayasan Pembinaan Anak Cacat Palembang terdapat dua sekolah untuk anak retardasi mental, yaitu SLB-C untuk anak retardasi mental ringan dan SLB-C1 untuk anak retardasi mental sedang dan berat. Jumlah anak retardasi mental yang bersekolah di YPAC setiap tahun mengalami peningkatan dilihat dari data tahun 2010 sebanyak 144 siswa, tahun 2009 sebanyak 135 siswa, dan tahun 2008 sebanyak 124 siswa. Terdiri dari : di SLB-C tahun 2010 sebanyak 65 siswa, tahun 2009 sebanyak 64 siswa, dan tahun 2008 sebanyak 59 siswa. Konsep diri memiliki peranan penting dalam menentukan perilaku individu yaitu sebagai cermin bagi individu dalam memandang dirinya. Individu akan bereaksi terhadap lingkungannya sesuai dengan konsep dirinya, menurut Burns (1993) dalam Yudi (2008), pembentukan konsep diri memudahkan interaksi sosial sehingga individu yang bersangkutan dapat mengantisipasi reaksi orang lain. Menurut Hurlock (1978) dalam Rahman (2009), konsep diri yang positif akan berkembang jika seseorang mengembangkan sifat-sifat yang berkaitan dengan good self esteem, good self confidence, dan kemampuan melihat diri secara realistik. Sifat-sifat ini memungkinkan seseorang untuk berhubungan dengan orang lain secara akurat dan mengarah pada penyesuaian diri yangProsiding Seminar Nasional, 13-14 Desember 2010 1304
  • 118. ISBN 978-602-98295-0-1 baik. Seseorang dengan konsep diri yang positif akan terlihat optimis, penuh percaya diri dan selalu bersikap positif terhadap segala sesuatu. Sebaliknya, konsep diri yang negatif menurut Hurlock (1978) dalam Rahman (2009) akan muncul jika seseorang mengembangkan perasaan rendah diri, merasa ragu, kurang pasti serta kurang percaya diri. Seseorang dikatakan mempunyai konsep diri negatif jika ia meyakini dan memandang bahwa dirinya lemah, tidak berdaya, tidak dapat berbuat apa-apa, tidak kompeten, gagal, malang, tidak menarik, tidak disukai dan tidak memiliki daya tarik terhadap hidup. Jadi konsep diri merupakan persepsi seseorang terhadap dirinya secara menyeluruh. Konsep diri penting dalam mengarahkan interaksi seseorang dengan lingkungannya mempengaruhi pembentukan konsep diri orang tersebut. Wall (1993) dalam Utami (2009) berpendapat bahwa fenomena dalam masyarakat masih banyak orang tua khususnya ibu yang menolak kehadiran anak yang tidak normal, karena malu mempunyai anak yang cacat, dan tak mandiri. Orang tua yang demikian akan cenderung menyangkal keberadaan anaknya dengan menyembunyikan anak tersebut agar jangan sampai diketahui oleh orang lain. Anak retardasi mental sering dianggap merepotkan dan menjadi beban bagi pihak lain. Tindakan orang tua yang demikian ini akan memperparah keadaan anak yang mengalami retardasi mental. Hal tersebut berdampak pada orang tua sehingga memiliki konsep diri yang negatif.B. Rumusan Masalah Berdasarkan latar belakang di atas, maka rumusan masalahnya adalah belum diketahuinya gambaran konsep diri pada orang tua dengan anak retardasi mental yang bersekolah di Yayasan Pembinaan Anak Cacat Palembang tahun 2010.C. Pertanyaan Penelitian 1. Bagaimana gambaran konsep diri pada orang tua dengan anak retardasi mental di Yayasan Pembinaan Anak Cacat Palembang tahun 2010 ?Prosiding Seminar Nasional, 13-14 Desember 2010 1305
  • 119. ISBN 978-602-98295-0-1 2. Bagaimana gambaran citra tubuh, ideal diri, harga diri, peran dan identitas diri pada orang tua dengan anak retardasi mental di Yayasan Pembinaan Anak Cacat Palembang tahun 2010 ?D. Tujuan Penelitian 1. Tujuan Umum Diketahuinya gambaran konsep diri pada orang tua dengan anak retardasi mental di Yayasan Pembinaan Anak Cacat Palembang tahun 2010. 2. Tujuan Khusus Diketahuinya gambaran citra tubuh, ideal diri, harga diri, peran, identitas diri pada orang tua dengan anak retardasi mental di Yayasan Pembinaan Anak Cacat Palembang tahun 2010. METODE PENELITIANA. Desain Penelitian Metode penelitian yang digunakan adalah metode penelitian deskriptif, yaitu suatu metode penelitian yang dilakukan dengan tujuan utama untuk membuat gambaran atau deskripsi tentang suatu keadaan secara objektif. Metode penelitian deskriptif digunakan untuk memecahkan atau menjawab permasalahan yang sedang dihadapi pada situasi sekarang (Notoatmodjo, 2005)B. Populasi Penelitian Populasi adalah keseluruhan dari objek penelitian atau objek yang diteliti (Notoatmodjo, 2005). Populasi penelitian ini adalah semua orang tua yang mempunyai anak retardasi mental yang bersekolah di SLB-C1 Yayasan Pembinaan Anak Cacat Palembang Tahun 2010 yang berjumlah 79 orang.C. Sampel Penelitian Sampel merupakan bagian populasi yang akan diteliti atau sebagian jumlah dari karakteristik yang dimiliki oleh populasi (Hidayat, 2008). SampelProsiding Seminar Nasional, 13-14 Desember 2010 1306
  • 120. ISBN 978-602-98295-0-1 penelitian ini adalah orang tua yang mempunyai anak retardasi mental yang bersekolah di SLB-C1 Yayasan Pembinaan Anak Cacat Palembang Tahun 2010 yang berjumlah 32 responden, dengan kriteria responden sebagai berikut : 1. Bersedia menjadi responden 2. Responden tidak dalam keadaan sakit 3. Orang tua yang mempunyai anak retardasi mental yang bersekolah di SLB-C1 Yayasan Pembinaan Anak Cacat Palembang tahun 2010.D. Lokasi Penelitian Penelitian ini dilaksanakan di Yayasan Pambinaan Anak Cacat Palembang, di Jln. Mr. R. Sudarman Ganda Subrata No. 2727 Sukamaju, Sako Palembang 30164.E. Waktu Penelitian Penelitian ini dilaksanakan pada tanggal 14 - 26 Juni 2010.F. Etika Penelitian 1. Pengumpulan data terhadap orang tua yang mempunyai anak retardasi mental dilakukan oleh peneliti sendiri dengan terlebih dahulu memberikan informed consent. 2. Peneliti menjaga kerahasiaan data atau keterangan yang diperoleh hanya dipergunakan utuk keperluan ilmiah.G. Teknik Pengumpulan Data Instrumen yang digunakan dalam pengumpulan data adalah kuesioner. Kuesioner terdiri dari 30 pernyataan yang menggambarkan konsep diri, yaitu : citra tubuh, ideal diri, harga diri, peran, dan identitas diri, dimana masing- masing komponen konsep diri digambarkan melalui pernyataan positif dan negatif dengan jawaban SS = Sangat Setuju, S = Setuju, TS = Tidak Setuju, dan STS = Sangat Tidak Setuju (Skala Likert).H. Pengolahan DataProsiding Seminar Nasional, 13-14 Desember 2010 1307
  • 121. ISBN 978-602-98295-0-1 Dalam proses pengolahan data terdapat langkah-langkah yang harus ditempuh, di antaranya (Hastono, 2001) : Editing, coding, processing, cleaning.I. Analisa Data Analisa data yang dilakukan adalah analisa univariat, yaitu analisa proporsi/presentase dari variabel konsep diri, citra tubuh, ideal diri, harga diri, peran, dan identitas diri. Hasil analisa univariat disajikan dalam bentuk tabel distribusi frekuensi. HASIL PENELITIANA. Hasil Penelitian1. Karakteristik Responden a. Umur Tabel 5.1. Distribusi frekuensi responden berdasarkan umur di Yayasan Pembinaan Anak Cacat Palembang Tahun 2010 No. Umur Frekuensi Jumlah % 1. 22-40 tahun 17 53,1 2. 41-60 tahun 15 46,9 Total 32 100 b. Agama Tabel 5.2. Distribusi frekuensi responden berdasarkan agama di Yayasan Pembinaan Anak cacat Palembang Tahun 2010 No. Agama Frekuensi Jumlah % 1. Islam 26 81,3 2. Kristen 4 12,5 3. Budha 2 6,3 Total 32 100 c. PendidikanProsiding Seminar Nasional, 13-14 Desember 2010 1308
  • 122. ISBN 978-602-98295-0-1 Tabel 5.3. Distribusi frekuensi responden berdasarkan pendidikan di Yayasan Pembinaan Anak Cacat Palembang Tahun 2010 No. Pendidikan Frekuensi Jumlah % 1. SD 3 9,4 2. SMA 26 81,3 3. D3 1 3,1 4. S1 2 6,3 Total 32 100 d. Jenis Kelamin Anak Tabel 5.4. Distribusi frekuensi berdasarkan jenis kelamin anak di Yayasan Pembinaan Anak Cacat Palembang tahun 2010 No. Jenis Kelamin Anak Frekuensi Jumlah % 1. Laki-laki 21 65,6 2. Perempuan 11 34,4 Total 32 1002. Konsep Diri Orang Tua di Yayasan Pembinaan Anak Cacat Palembang Tahun 2010 a. Citra Tubuh Distribusi frekuensi responden berdasarkan citra tubuh dapat dilihat pada tabel berikut : Tabel 5.5. Distribusi frekuensi responden berdasarkan citra tubuh di Yayasan Pembinaan Anak Cacat Palembang Tahun 2010 No. Citra Tubuh Frekuensi Jumlah % 1. Positif 16 50 2. Negatif 16 50 Total 32 100 b. Ideal DiriProsiding Seminar Nasional, 13-14 Desember 2010 1309
  • 123. ISBN 978-602-98295-0-1 Tabel 5.6. Distribusi frekuensi responden berdasarkan Ideal diri di Yayasan Pembinaan Anak Cacat Palembang Tahun 2010 No. Ideal Diri Frekuensi Jumlah % 1. Realistis 16 50 2. Tidak Realistis 16 50 Total 32 100 c. Harga Diri Tabel 5.7. Distribusi frekuensi responden berdasarkan harga diri di Yayasan Pembinaan Anak Cacat Palembang Tahun 2010 No. Harga Diri Frekuensi Jumlah % 1. Tinggi 16 50 2. Rendah 16 50 Total 32 100 d. Peran Tabel 5.8 Distribusi frekuensi responden berdasarkan peran di Yayasan Pembinaan Anak Cacat Palembang Tahun 2010 No. Peran Frekuensi Jumlah % 1. Puas 25 78,1 2. Tidak Puas 7 21,9 Total 32 100 e. Identitas Diri Tabel 5.9. Distribusi frekuensi responden berdasarkan identitas diri di Yayasan Pembinaan Anak Cacat Palembang Tahun 2010 No. Identitas Diri Frekuensi Jumlah % 1. Jelas 24 75 2. Tidak Jelas 8 25 Total 32 100 Berdasarkan hasil penelitian aspek-aspek konsep diri di atas, dihasilkan gambaran konsep diri orang tua di Yayasan Pembinaan Anak Cacat Palembang Tahun 2010 yang dapat dilihat pada tabel berikut :Prosiding Seminar Nasional, 13-14 Desember 2010 1310
  • 124. ISBN 978-602-98295-0-1 Tabel 5.10. Distribusi frekuensi responden berdasarkan konsep diri di Yayasan Pembinaan Anak Cacat Palembang Tahun 2010 No. Konsep Diri Frekuensi Jumlah % 1. Positif 22 68,8 2. Negatif 10 31,3 Total 32 100 PEMBAHASANA. Hasil Penelitian1. Gambaran Citra Tubuh pada Orang Tua Berdasarkan data yang diperoleh dari hasil penelitian mengenai gambaran citra tubuh pada orang tua di Yayasan Pembinaan Anak Cacat Palembang Tahun 2010, sebagian responden memilki citra tubuh positif dan sebagian memiliki citra tubuh negatif dengan persentase masing-masing 50%. Menurut Suliswati,dkk (2005) bahwa cara individu memandang diri mempunyai dampak yang penting pada aspek psikologisnya. Individu yang stabil, realistis, dan konsisten terhadap citra tubuhnya akan memperlihatkan kemampuan mantap terhadap realisasi yang akan memacu sukses didalam kehidupan. Citra tubuh harus realistis karena semakin dapat menerima dan menyukai tubuhnya, individu akan lebih bebas dan merasa aman dari kecemasan.2. Gambaran Ideal Diri pada Orang Tua Berdasarkan data yang diperoleh dari hasil penelitian mengenai gambaran ideal diri pada orang tua di Yayasan Pembinaan Anak Cacat Palembang Tahun 2010, sebagian responden memilki ideal diri yang realistis dan sebagian memiliki ideal diri yang tidak realistis dengan persentase masing- masing 50%. Ideal diri seseorang dapat dipengaruhi oleh adanya kecenderungan individu menetapkan ideal pada batas kemampuannya, faktor budaya akan mempengaruhi individu menetapkan ideal diri, ambisi dan keinginan untuk melebihi dan berhasil, kebutuhan yang realistis, keinginan untuk mengklaimProsiding Seminar Nasional, 13-14 Desember 2010 1311
  • 125. ISBN 978-602-98295-0-1 diri dari kegagalan, perasan cemas dan rendah diri sebagaimana yang diungkapkan oleh Keliat (1998) dalam Salbiah (2003). Menurut Suliswati.dkk (2005), individu cenderung menetapkan tujuan yang sesuai dengan kemampuannya, kultur, realita, menghindari kegagalan dan rasa cemas. Ideal diri harus cukup tinggi supaya mendukung respek terhadap diri, tetapi tidak terlalu tinggi, terlalu menuntut, samar-samar atau kabur. Ideal diri berperan sebagai pengatur internal dan membantu individu mempertahankan kemampuannya menghadapi konflik atau kondisi yang membuat bingung. Ideal diri penting untuk mempertahankan kesehatan dan keseimbangan mental.3. Gambaran Harga Diri pada Orang Tua Berdasarkan data yang diperoleh dari hasil penelitian mengenai gambaran harga diri pada orang tua, sebagian memiliki harga diri tinggi dan sebagian memiliki harga diri rendah dengan persentase masing-masing 50%. Harga diri tinggi terkait dengam ansietas yang rendah, efektif dalam kelompok dan diterima oleh orang lain. Sedangkan harga diri rendah terkait dengan hubungan interpersonal yang buruk dan resiko terjadi depresi dan skizofrenia. Gangguan harga diri dapat digambarkan sebagai perasaan negatif terhadap diri sendiri termasuk hilangnya percaya diri dan harga diri sebagaimana diungkapkan oleh Salbiah (2003). Harga diri diperoleh dari diri sendiri dan orang lain yaitu dicintai, dihormati, dan dihargai. Individu akan merasa harga dirinya tinggi bila sering mengalami keberhasilan, sebaliknya individu akan merasa harga dirinya rendah bila sering mengalami kegagalan, tidak dicintai atau tidak diterima lingkungan.4. Gambaran Peran pada Orang Tua Berdasarkan data yang diperoleh dari hasil penelitian mengenai gambaran peran pada orang tua di Yayasan Pembinaan Anak Cacat Palembang Tahun 2010, sebagian besar responden puas akan peran mereka sebagai orang tua dengan persentase 78,1%. Menurut Suliswati.dkk (2005), faktor yang mempengaruhi penyesuaian diri individu terhadap peran, yaitu :Prosiding Seminar Nasional, 13-14 Desember 2010 1312
  • 126. ISBN 978-602-98295-0-1 a) Kejelasan prilaku dan pengetahuan yang sesuai dengan peran b) Tanggapan yang konsisten dari orang-orang yang berarti terhadap perannya c) Kecocokan dan keseimbangan antar peran yang diembannya d) Keselarasan norma budaya dan harapan individu terhadap perilaku. e) Pemisahan situasi yang akan menciptakan penampilan peran yang tidak sesuai. Gambaran kepuasan responden terhadap peran mereka menunjukkan bahwa keadaan dan status sosial mereka sebagai orang tua yang memiliki anak retardasi mental tidak banyak mempengaruhi peran mereka didalam kehidupan.5. Gambaran Identitas Diri pada Orang Tua Berdasarkan data yang diperoleh dari hasil penelitian mengenai gambaran identitas diri pada orang tua di Yayasan Pembinaan Anak Cacat Palembang Tahun 2010, sebagian besar responden memiliki identitas yang jelas dengan persentase 75%. Gambaran kejelasan identitas diri pada responden menunjukkan bahwa sebagian besar orang tua memandang berbagai aspek dalam dirinya sebagai suatu keselarasan, menilai diri sendiri sesuai dengan penilaian masyarakat, menyadari hubungan masa lalu, sekarang, dan yang akan datang serta mempunyai tujuan yang bernilai yang dapat dicapai/direalisasikan sebagaimana ciri-ciri individu yang memiliki identitas diri yang positif yang diungkapkan oleh Suliswati.dkk (2005).6. Gambaran Konsep Diri pada Orang Tua Berdasarkan data yang diperoleh dari hasil penelitian mengenai gambaran konsep diri pada orang tua di Yayasan Pembinaan Anak Cacat Palembang Tahun 2010, sebagian besar responden memiliki konsep diri yang positif dengan persentase 68,8%. Gambaran konsep diri yang positif pada sebagian besar responden menunjukkan bahwa dengan kondisi mereka sekarang dengan memiliki anak yang retardasi mental tidak terlalu mengganggu citra tubuh, ideal diri, harga diri, peran, dan identitas diri mereka. Hal ini juga bisa didukung olehProsiding Seminar Nasional, 13-14 Desember 2010 1313
  • 127. ISBN 978-602-98295-0-1 pengetahuan dari responden yang mana sebagian besar responden memiliki tingkat pendidikan SMA, bahkan ada yang berpendidikan sarjana. Sebagaimana diungkapkan oleh Rahman (2009) bahwa usia, inteligensia, pendidikan, status sosial ekonomi, hubungan keluarga, orang lain serta kelompok yang secara emosional mengikat individu mempengaruhi pembentukan dan perkembangan konsep diri seseorang. Dengan memiliki konsep diri yang positif bahwa menunjukkan adanya penerimaan diri yang baik, mengenal dirinya sendiri dengan baik, dapat memahami dsan menerima fakta-fakta yang nyata tentang dirinya, mampu menghargai dirinya sendiri, mampu menerima dan memberikan pujian secara wajar, adanya kemauan memperbaiki diri ke arah yang lebih baik serta mampu menempatkan diri di dalam lingkungan sebagaimana diungkapkan oleh Yudi (2008). Dilihat dari beberapa teori terkait di atas dapat disimpulkan bahwa konsep diri mempunyai peranan penting dalam menentukan perilaku seseorang. Oleh karena itu, penanaman konsep diri yang positif akan menjadi modal dasar yang sangat dibutuhkan dalam perkembangan kepribadian seseorang.B. Keterbatasan Penelitian Penelitian ini merupakan gambaran untuk melihat konsep diri pada orang tua di Yayasan Pembinaan Anak Cacat Palembang Tahun 2010. Adapun keterbatasan dalam penelitian ini adalah sebagai berikut : 1. Penelitian ini adalah penelitian deskriptif yang hanya menggambarkan konsep diri responden berdasarkan jawaban responden terhadap kuesioner yang diberikan. Hasil penelitian ini sangat tergantung dari pemahaman penafsiran dari peneliti sehingga bersifat subjektif. 2. Waktu yang digunakan pada saat pengumpulan data berbarengan dengan siswa sekolah sudah selesai melaksanakan ujian sekolah sehingga banyak yang meliburkan diri.sehingga orang tua yang berkunjung menjadi terbatas.Prosiding Seminar Nasional, 13-14 Desember 2010 1314
  • 128. ISBN 978-602-98295-0-1 Kondisi ini mempengaruhi jumlah responden untuk menjadi sampel penelitian. KESIMPULAN DAN SARANA. Kesimpulan Dengan memperhatikan hasil penelitian berdasarkan data-data yang telahdisajikan beserta pembahasan gambaran konsep diri pada orang tua di YayasanPembinaan Anak Cacat Palembang, dapat disimpulkan hal-hal sebagai berikut :1. Sebagian orang tua di Yayasan Pembinaan Anak Cacat Palembang Tahun 2010 memiliki citra tubuh positif dan sebagian memilki citra tubuh negatif dengan persentase masing-masing 50%.2. Sebagian orang tua di Yayasan Pembinaan Anak Cacat Palembang Tahun 2010 memiliki ideal diri yang realistis dan sebagian memilki ideal diri yang tidak realistis dengan persentase masing-masing 50%.3. Sebagian orang tua di Yayasan Pembinaan Anak Cacat Palembang Tahun 2010 memiliki harga diri tinggi dan sebagian memilki harga diri rendah dengan persentase masing-masing 50%.4. Sebagian besar orang tua di Yayasan Pembinaan Anak Cacat Palembang Tahun 2010 puas dengan peran mereka sebagai orang tua dengan persentase 78,1%.5. Sebagian besar orang tua di Yayasan Pembinaan Anak Cacat Palembang Tahun 2010 memiliki identitas diri yang jelas dengan persentase 75%.6. Gambaran konsep diri pada orang tua secara keseluruhan melalui analisa data dari citra tubuh, ideal diri, harga diri, peran, dan identitas diri pada orang tua di Yayasan Pembinaan Anak Cacat Palembang Tahun 2010 adalah positif dengan persentase 68,8%.B. Saran Dari kesimpulan di atas, peneliti mengajukan beberapa saran, yaitu : 1. Bagi Yayasan Pembinaan Anak Cacat Palembang, agar dapat meningkatkan asuhan psikososial yang diberikan dengan lebih banyak menyelenggarkan kegiatan-kegiatan yang dapat membangun konsep diriProsiding Seminar Nasional, 13-14 Desember 2010 1315
  • 129. ISBN 978-602-98295-0-1 positif pada orang tua, seperti seminar-seminar motivasi dan pengembangan diri yang melibatkan peran serta aktif orang tua. Serta, diharapkan kelas untuk anak retardasi mental dengan anak autis dibedakan. 2. Bagi para orang tua di Yayasan Pembinaan Anak Cacat Palembang, agar dapat terus menanamkan pentingnya konsep diri yang positif dengan menumbuhkan kesadaran akan penghargaan terhadap diri sendiri dan memanfaatkan potensi diri yang dimiliki untuk hal yang positif seperti ikt aktif dalam setiap kegiatan sekolah dan kegiatan sosial kemasyarakatan melalui bimbingan pengelola YPAC Palembang. 3. Bagi peneliti selanjutnya, agar hasil penelitian ini dapat dijadikan referensi dan penelitian ini diharapkan dilakukan dalam bentuk penelitian kualitatif agar informasi yang diperoleh lebih mendalam. DAFTAR PUSTAKADinda. 2008. Retardasi Mental (online) (http://medicafarma.blogspot.com, diakses 8 Maret 2010).Haris. 2010. Retardasi Mental (online) (http://harismasterpsikology.ngeblogs.com, diakses 8 Maret 2010).Hastono, S.P.2001. Analisa Data. Fakultas Kesehatan Masyarakat Universitas Indonesia, Jakarta.Hendriani, W. 2006. Penerimaan Keluarga Terhadap Individu yang Mengalami Keterbelakangan Mental (online) (http://journal.unair.ac.id, diakses 3 Maret 2010).Hidayat, A.A. 2008. Metode Penelitian Keperawatan dan Teknik Analisis Data. Salemba Medika, Jakarta.Murwani, A. 2008. Pengantar Konsep Dasar Keperawatan. Fitramaya, Yogyakarta.Notoatmodjo, S. 2005. Metodologi Penelitian Kesehatan. Rineka Cipta, Jakarta.Rahman,R.M. Konsep Diri (online) (http://medicafarma.blogspot.com, diakses 8 Maret 2010).Salbiah. 2003. Konsep Diri (online) (http://www.scribd.com, diakses 8 Maret 2010).Soetjiningsih. 1995. Tumbuh Kembang Anak. EGC, Jakarta.Suliswati et al. 2005. Konsep Dasar Keperawatan Kesehatan Jiwa. EGC, Jakarta.Prosiding Seminar Nasional, 13-14 Desember 2010 1316
  • 130. ISBN 978-602-98295-0-1Utami, Y.R. 2009. Penyesuaian Diri dan Pola Asuh Orang Tua yang Memiliki Anak Retardasi Mental (online) (http://docs.google.com, diakses 3 Maret 2010).Widiastuti, M. 2009. Retardasi Mental (online) (http://mlymutz.blogspot.com, diakses 8 Maret 2010).Yudi. 2008. Konsep Diri (online) (http://kmplnnad.net, diakses 8 Maret 2010).Prosiding Seminar Nasional, 13-14 Desember 2010 1317
  • 131. ISBN 978-602-98295-0-1RANCANGAN DAN TANGGAP DARURAT TERHADAP BAHAYA KEBAKARAN DI RUMAH SAKIT Dr. ERNALDI BAHAR PALEMBANG TAHUN 2009 Fison Hepiman* Rico Januar Sitorus** Hamzah Hasyim** * Mahasiswa Fakultas Kesehatan Masyarakat Universitas Sriwijaya ** Dosen Fakultas Kesehatan Masyarakat Universitas Sriwijaya ** Dosen Fakultas Kesehatan Masyarakat Universitas Sriwijaya ABSTRACT Hospital is one of place that to continue dangerous of fire, to decrease andprevent loss of material and sacrifice, necessary a fire emergency response andpreparedness. The objective of this research to get information aboutaccomplishment of fire emergency response and preparedness in Dr. ErnaldiBahar Hospital Palembang. This research is descriptive study by qualitative approximation. Method ofresearch by depth interview, focus group discussion, ang observation. Source ofinformation in this research totally seven people and two key informant. Based of result of the research, fire emergency response and preparednessin Dr. Ernaldi Bahar Hospital still need to be improved. There is no fire emergencyresponse team, fire safety facilities that available just portable fire extinguisher,and number of that fire extinguisher portable is not comply to the regulation,frequency of training and simulation is often, and there is no evacuation procedureavailable. Suggestion of this research to make fire emergency response team sooner.Give a espionage about fire safety procedure for new employee and all visitors inHospital. For fire extinguisher that available, especially portable fire extinguisherneed to be repaired sooner in construction in order to comply to the regulation.Fire safety training and simulation need to more often, especially for newemployee.Key Words : emergency response and preparedness, fire safety, hospital PENDAHULUAN Penyelenggaraan kesehatan dan keselamatan kerja di rumah sakitsangatlah perlu mendapat perhatian yang serius. Sebagai konsekuensi dari fungsirumah sakit maka potensi munculnya bahaya kesehatan dan keselamatan kerjatidak dapat dihindari, seperti bahaya pemajanan radiasi, bahan kimia toksik,bahaya biologis, temperatur ekstrim, bising, debu, termasuk juga bahayakebakaran.1Prosiding Seminar Nasional, 13-14 Desember 2010 1318
  • 132. ISBN 978-602-98295-0-1 Kasus kebakaran yang pernah melanda Kozlovichi Mental Asylum (RumahSakit Jiwa Kozlovichi) di Provinsi Grodno, Belarus pada Oktober 2003mengakibatkan 30 pasiennya meninggal dunia.2 Kejadian di Indonesia pernah melanda Rumah Sakit Jiwa Grogol, JakartaBarat pada November 2008. Kejadian kebakaran tersebut membuat panik sekitar30 petugas yang harus mengevakuasi sekitar 160 pasien gangguan jiwa.3 Rumah sakit merupakan salah satu tempat yang juga tidak lepas dariberbagai kemungkinan bahaya kecelakaan ataupun kebakaran, oleh karena ituperlu juga dibuat suatu sistem rancangan dan tanggap darurat terhadap bahayakebakaran yang baik, melakukan identifikasi dan menyediakan peralatan tanggapdarurat yang sesuai, serta melakukan uji coba secara periodik.4 Rumah Sakit Dr Ernaldi Bahar semula dikenal dengan nama Rumah SakitJiwa Palembang yang menjadi tempat perawatan bagi pasien-pasien sakit jiwa.Implementasi prosedur tanggap darurat di RS. Dr Ernaldi Bahar tentu berbedadengan penerapan di rumah sakit umum atau tempat-tempat lain, mengingatpasien di rumah sakit ini ini mayoritas adalah orang-orang yang perlu mendapatperhatian khusus (sakit jiwa). Untuk itu perlu dibuat suatu upaya atau prosedurrancangan dan tanggap darurat khusus dalam kondisi seperti ini. Karena suaturencana atau rancangan tanggap darurat harus berisikan informasi yangmemungkinkan siapa saja untuk bisa menguasai keadaan darurat, sepertimembunyikan alarm.5 Tujuan penelitian ini untuk memperoleh informasi gambaran pelaksanaanrancangan dan tanggap darurat terhadap bahaya kebakaran di RS. Dr ErnaldiBahar Tahun 2009. METODE PENELITIAN Penelitian ini adalah penelitian deskriptif dengan pendekatan kualitatif.Metode penelitian dengan wawancara mendalam, FGD dan observasi. Sumberinformasi dalam penelitian ini berjumlah tujuh orang ditambah dengan dua oranginforman ahli.Prosiding Seminar Nasional, 13-14 Desember 2010 1319
  • 133. ISBN 978-602-98295-0-1 HASIL PENELITIAN1. Komitmen dan kebijakan Pihak RS Dr. Ernaldi Bahar sejauh ini sudah memiliki komitmen dan kebijakan tertulis yang juga sudah disosialisasikan.2. Rencana/rancangan dalam menghadapi keadaan darurat kebakaran Di RS Dr. Ernaldi Bahar masih banyak sekali ditemukan karyawannya sendiri yang merokok di area rumah sakit, bahkan di tempat-tempat yang sudah jelas ada tanda larangan merokok, serta belum dibentuk tim atau regu khusus penganggulangan kebakaran.3. Pendidikan dan latihan penanggulangan kebakaran Pendidikan dan pelatihan penanggulangan kebakaran di Rumah Sakit Dr. Ernaldi Bahar sudah pernah dilakukan, namun kegiatan tersebut sangat jarang dilakukan, ditakutkan banyak karyawan-karyawan baru yang belum mengerti hal-hal yang berkaitan dengan kebakaran.4. Penanggulangan keadaan darurat kebakaran Prosedur penanggulangan keadaan darurat kebakaran memang sudah ada dan sudah pernah dilakukan sosialisasi, namun hal tersebut sangat jarang dilakukan dan atau diujikan kembali. Berdasarkan hasil observasi terhadap tabung APAR yang ada di ruangan- ruangan pasien ataupun di beberapa instalasi rumah sakit, memang telah terdapat segel dari pihak Dinas Pemadam Kebakaran bahwa APAR tersebut telah dilakukan pengecekan dan pengisian ulang, dan dilengkapi juga dengan tanggal masa kadaluarsa dari APAR tersebut. Hanya peletakan APAR itu sendiri yang banyak sekali ditemukan masih tidak sesuai dengan peraturan yang ada.5. Pemindahan dan penutupan Langkah-langkah evakuasi seandainya terjadi kebakaran memang sudah dibuat oleh komite K3, hanya mungkin perlu sosialisasi lebih lanjut. Namun untuk sarana prasarana evakuasinya perlu untuk dilengkapi lagi, seperti peta jalur evakuasi yang belum ada.Prosiding Seminar Nasional, 13-14 Desember 2010 1320
  • 134. ISBN 978-602-98295-0-1 PEMBAHASAN1. Komitmen dan kebijakan Komitmen dan kebijakan terhadap rancangan dan tanggap darurat terhadap bahaya kebakaran dapat dilihat dari upaya pihak rumah sakit yang telah membuat suatu prosedur penanggulangan kebakaran, tersedianya sarana penanggulangan kebakaran yaitu APAR, dan sudah pernah diadakannya pelatihan penanggulangan kebakaran. Hasil penelitian Hanafi (2008) menyatakan bahwa upaya pencegahan dan penanggulangan kebakaran berupa Rencana Tanggap Darurat Kebakaran perlu dilakukan di setiap tempat kerja.2. Rencana/rancangan dalam menghadapi keadaan darurat kebakaran Upaya pencegahan terhadap sumber kebakaran yang mungkin disebabkan oleh listrik tampaknya belum terlalu maksimal dijalankan. Menurut salah seorang informan, beberapa bulan lalu pernah terjadi kebakaran yang disebabkan korsleting listrik, meskipun kejadian tersebut tidak terlalu banyak mengakibatkan kerugian karena dapat segera ditanggulangi. Hasil penelitian Angela (2006)6 menyatakan bahwa kebakaran dapat terjadi akibat aliran listrik hubungan singkat, gesekan rol mesin dan gesekan mekanis mesin sehingga perlu diamati secara ketat.5 RS Dr. Ernaldi Bahar belum dibentuk tim atau regu khusus penanggulangan kebakaran. Menurut Ardianus (2009) tim atau regu khusus penanggulangan kebakaran di suatu tempat kerja perlu dibentuk, dan sebagai ujung tombaknya adalah satpam yang juga perlu dibekali dengan pelatihan mengenai penanggulangan kebakaran. Selain itu hal tersebut juga sudah diatur dalam ketentuan perundangan yaitu Keputusan Menteri Tenaga Kerja RI No.186 Tahun 1999 mengenai pembentukan Unit Penanggulangan Kebakaran.3. Pendidikan dan latihan penanggulangan kebakaran Pihak rumah sakit sebenarnya sudah pernah beberapa kali mengadakan pelatihan penanggulangan kebakaran, khususnya cara penggunaan APAR. Namun frekuensi pelatihan yang diberikan masih sangat jarang dilakukan, apalagi terhadap karyawan-karyawan baru.Prosiding Seminar Nasional, 13-14 Desember 2010 1321
  • 135. ISBN 978-602-98295-0-1 Menurut Ardianus (2009), menyatakan bahwa pendidikan dan latihan dalam penanggulangan kebakaran itu penting sekali dilakukan. Mengingat saat terjadinya kebakaran bisanya timbul kepanikan. Pelatihan dasar yang paling penting adalah tata cara penggunaan APAR.4. Penanggulangan keadaan darurat kebakaran RS Dr. Ernaldi Bahar sudah memiliki prosedur penanggulangan keadaan darurat kebakaran, meliputi uraian tugas, tindakan yang perlu diperhatikan pada waktu terjadinya kebakaran, kemudian juga metode evakuasi dan pengamanan. Prosedur tersebut memang sudah dibuat dengan baik, namun untuk di setiap ruangan belum memiliki petunjuk teknis penanggulangan keadaan darurat kebakaran, termasuk juga nomor telepon darurat. Sarana dan prasarana yang tersedia di Rumah Sakit Dr. Ernaldi Bahar dalam menghadapi kebakaran adalah APAR. Sarana dan prasarana lain seperti hydrant, sprinkler, dan alarm kebakaran belum dimiliki. Pemeliharaan terhadap sarana berupa APAR ini dilakukan setiap satu tahun sekali. Untuk pemasangan dan tata letak APAR di Rumah Sakit Dr. Ernaldi Bahar ini juga kurang sesuai dengan Peraturan Menteri Tenaga Kerja dan Transmigrasi Nomor 4 Tahun 1980. Karena dari hasil observasi lapangan ditemukan bahwa hampir seluruh APAR yang terpasang tidak dilengkapi dengan tanda pemasangan sesuai ketentuan peraturan tersebut di atas.5. Pemindahan dan penutupan Upaya pemindahan dan penutupan atau evakuasi di RS Dr. Ernaldi Bahar belum tersedia peta atau jalur petunjuk evakuasi seandainya suatu saat terjadi kebakaran. Menurut Jusuf (2008), evakuasi harus selalu disetujui oleh pejabat tertinggi dari jajaran manajemen atau apabila tidak ada ditempat bisa diwakili oleh pejabat dibawahnya, sesuai jenjang organisasi yang telah ditetapkan. KESIMPULAN1. RS Dr. Ernaldi Bahar telah menetapkan komitmen dan kebijakan keselamatan dan kesehatan kerja. Tetapi untuk komitmen dan kebijakan dalam upaya rancangan dan tanggap darurat kebakaran masih perlu mendapat perhatian.Prosiding Seminar Nasional, 13-14 Desember 2010 1322
  • 136. ISBN 978-602-98295-0-12. Dari aspek rencana atau rancangan dalam menghadapi kebakaran, dilihat dari program atau upaya pencegahan sudah dilakukan. Namun masih banyak sekali pelanggaran terhadap peraturan yang dibuat, terutama larangan merokok di area rumah sakit.3. Dari aspek pendidikan dan latihan penanggulangan kebakaran sudah pernah dilakukan. Namun untuk frekuensi pelatihan tersebut ternyata jarang dilakukan dan belum diberikan kepada seluruh karyawan.4. RS Dr. Ernaldi Bahar sudah memiliki prosedur tertulis seandainya terjadi kasus kebakaran. Namun upaya sosialisasi untuk prosedur tersebut masih kurang. Dilihat dari aspek sarana dan prasarana yang dipersiapkan dalam penanggulangan keadaan darurat, saat ini yang tersedia hanya APAR. Namun jumlah APAR tersebut masih kurang, pemasangannya tidak dilengkapi dengan tanda pemasangan. Dan untuk pemeriksaan APAR yang ada hanya dilakukan satu tahun sekali.5. RS Dr. Ernaldi Bahar sudah memiliki petunjuk evakuasi yang harus dilakukan saat terjadi kebakaran yang termasuk dalam prosedur penanggulangan kebakaran. Namun untuk peta jalur evakuasi ataupun petunjuk dimana titik kumpul (assembly point) belum ada. SARAN1. Untuk terlaksananya suatu rancangan dan tanggap darurat yang baik, disarankan agar segera dibentuk tim atau regu khusus penanggulangan kebakaran.2. Perhatian terhadap upaya pencegahan bahaya kebakaran perlu ditingkatkan lagi, termasuk dalam pengawasan pasien gangguan jiwa yang juga berpotensi sebagai sumber penyebab terjadinya kebakaran.3. Disarankan agar pendidikan dan pelatihan terhadap upaya penanggulangan kebakaran agar lebih sering dilakukan.4. Kelengkapan sarana dan prasarana dalam penanggulangan kebakaran juga perlu dilengkapi. Selain APAR yang juga perlu dilengkapi karena ada ruangan yang belum memiliki APAR, alat-alat yang belum ada seperti alarm kebakaran, hydrant, sprinkler juga perlu untuk segera dilengkapi.Prosiding Seminar Nasional, 13-14 Desember 2010 1323
  • 137. ISBN 978-602-98295-0-15. Persiapan evakuasi seandainya terjadi kebakaran disarankan untuk segera dilengkapi, seperti peta jalur evakuasi dan titik kumpul (assembly point). Selain itu juga simulasi terjadinya kebakaran juga perlu dilakukan secara berkala. DAFTAR PUSTAKA1.Nasri, Sjahrul M. 2000, ‘Risiko tinggi di tempat kerja rumah sakit‘, in Kumpulan Makalah Seminar K3 RS Persahabatan Tahun 2000 & 2004. UI-Press, Jakarta, pp. 119-133.2. Wikipedia, 2006, ‗Kozlovichi Mental Asylum’. [online], Dari: www.en.wikipiedia.org. [11 Juni 2009].3. Ferdianto, Riky. 2008, ’RS Jiwa Grogol Terbakar, 160 Pasien Panik’. [online], Dari: www.tempointeractive.com. [25 Mei 2009].4. Suardi, Rudi. 2005, Sistem Manajemen Keselamatan dan Kesehatan Kerja Panduan Penerapan Berdasarkan OHSAS 18001 dan Permenaker 05/1996. Penerbit PPM, Jakarta.5. Budiono, A.M. Sugeng., R.M.S Jusuf & Adriana Pusparini. 2008, Bunga Rampai Hiperkes & KK. Badan Penerbit Universitas Diponegoro, Semarang.6. Angela, Theresia Audrey. 2006, ‗Studi Kasus: Evaluasi Sistem Penanggulangan Kebakaran PT. Indogravure‘, Jurnal Kesehatan Masyarakat Nasional, vol.1, no.2, Oktober., pp 63-68.Prosiding Seminar Nasional, 13-14 Desember 2010 1324
  • 138. ISBN 978-602-98295-0-1 PROSPEK PENGGUNAAN EKSTRAK JAMUR ENDOFITIK DARI DAUN TUMBUHAN KANDIS GAJAH (GARCINIA GRIFFITHII T. ANDERS) SEBAGAI OBAT ASAM URAT Oleh: Elfita , Muharni1, Munawar2, Rizki1 1 1 Jurusan Kimia, FMIPA Universitas Sriwijaya, Indralaya 2 Jurusan Biologi, FMIPA Universitas Sriwijaya, Indralaya ABSTRAKTumbuhan kandis gajah telah digunakan secara tradisional oleh masyarakatdaerah Sarasah Bonta, Lembah Arau, Sumatra Barat untuk mengobati berbagaipenyakit diantaranya asam urat. Berdasarkan penelitian di laboratorium, terbuktibahwa tumbuhan kandis gajah mengandung senyawa antioksidan yang dapatmenurunkan kadar asam urat. Untuk pengembangkan tumbuhan obat ini menjadisediaan obat tradisional untuk asam urat, tentu saja sulit dilakukan karenatumbuhan kandis gajah adalah tumbuhan endemik dengan masa tumbuh yanglama. Senyawa-senyawa antioksidan potensial yang dikandung oleh tumbuhankandis gajah, juga dihasilkan oleh mikroba endofitiknya. Telah diisolasi empatjamur endofitik dari daun tumbuhan kandis gajah yaitu jamur hijau muda, jamurhjau pink, jamur putih, dan jamur serabut putih. Keempat jamur tersebut dikulturdalam 3L media PDB selama empat minggu dan disaring untuk memisahkanmedia dengan jamurnya. Media yang sudah mengandung metabolit sekunderdipartisi menggunakan pelarut etil asetat masing-masing sebanyak 3L dengan tigakali ulangan, yang dilanjutkan dengan evaporasi. Uji aktifitas antioksidan terhadapkeempat ekstrak etilasetat tersebut menunjukkan bahwa jamur hijau mudamenunjukkan aktifitas tertingi dengan nilai persen inhibisi pada konsentrasi 100ppm adalah 96,8 %, yaitu setara dengan aktifitas senyawa standar vitamin Cdengan persen inhibisi 97,1 %. Hasil ini menunjukkan bahwa ekstrak jamurendofitik dari daun kandis gajah berpotensi untuk dikembangkan menjadi ekstrakterstandar untuk asam urat.Kata kunci: jamur endofitik, kandis gajah, dan asam urat PENDAHULUAN Penggunaan obat tradisional herbal oleh masyarakat semakin meningkat,sehingga menuntut produsen meningkatkan produknya dalam bentuk sediaanobat tradisional baik dalam bentuk jamu, obat herbal terstandar, maupun dalambentuk fitofarmaka. Beragam dan kompleksnya penyakit yang timbul di kalanganmasyarakat , menuntut para peneliti untuk menggali potensi alam tumbuh-Prosiding Seminar Nasional, 13-14 Desember 2010 1325
  • 139. ISBN 978-602-98295-0-1tumbuhan untuk mengatasi permasalahan tersebut. Dari hasil penelitianditemukan senyawa-senyawa bioaktif yang sangat potensial bahkan lebih aktif darisenyawa obat yang selama ini digunakan. Namun yang menjadi kendala adalahsenyawa potensial tersebut ditemukan dengan rendemen yang rendah danberasal dari tumbuhan obat yang sulit dibudidayakan. Diantaranya berasal daritumbuhan endemik, atau dari tumbuhan langka yang telah dilindungi populasinya,bahkan juga berasal dari tumbuhan yang panjang masa tumbuhnya. Kendala ini menyebabkan para peneliti dunia berlomba mencari jalan alternatifuntuk mendapatkan dan memperbanyak senyawa bioaktif tersebut. Beberapa caradilakukan diantaranya yaitu dengan kultur jaringan, mencari enzim dalamtumbuhan tersebut yang berperan dalam pembentukan senyawa aktif,transplantasi gen ke dalam sel bakteri, dan sintesis laboratorium (Radji, 2005).Eksplorasi senyawa dengan cara-cara tersebut memiliki peluang yang relatif kecildan tingkat kesulitan yang tinggi dalam pengerjaannya. Selain itu ada cara lain untuk mendapatkan senyawa bioaktif yaitu denganmemanfaatkan mikroba endofitik yang terdapat spesifik pada setiap tumbuhan.Mikroba ini hidup bersimbiosis saling menguntungkan dengan tumbuhan inangnyadan dapat bersama-sama menghasilkan metabolit sekunder tertentu (Hung andAnnapurna, 2004 dan Hundley, 2005). Dengan mengisolasi mikroba endofitik daritumbuhan inangnya, maka mikroba ini dapat dikultivasi dalam waktu yang singkatsehingga menghasilkan metabolit sekunder dalam jumlah yang sesuai dengankebutuhan. Cara ini perlu dikembangkan karena memiliki keunggulan dari segiwaktu dan biaya. Tumbuhan yang memiliki sejarah etnobotani, seperti tumbuhankandis gajah yang telah digunakan secara tradisional sebagai obat penyakit asamurat, merupakan kandidat yang menjanjikan untuk mendapatkan senyawaantioksidan untuk menurunkan kadar asam urat dalam tubuh. Hal ini disebabkankarena kegunaan suatu tumbuhan dalam bidang medis sangat terkait denganpopulasi mikroba endofitiknya. BAHAN DAN METODEBahan Bahan penelitian berupa daun tumbuhan kandis gajah yang diambil dari daerahSarasah Bonta, Lembah Arau, Sumatra Barat, media Potato Dextrose Agar (PDA)Prosiding Seminar Nasional, 13-14 Desember 2010 1326
  • 140. ISBN 978-602-98295-0-1dan Potato Dextrose Broth (PDB) untuk isolasi jamur endofitik, reagen untuk ujiantioksidan terdiri dari: dimetilsulfoksida (DMSO), 1,1-difenil-2-pikrilhidrazil(DPPH), metanol p.a., etil asetat teknis, dan serangkaian media yang umumdigunakan untuk uji-uji fisioligis atau enzimasi dalam identifikasi mikroba.Alat Alat-alat yang akan digunakan dalam penelitian ini antara lain: colony counter,autoklaf, alat inkubator, water bath, shaker incubator, timbangan analitik, lemaries, mikroskop, hotplat magnetic, foto mikroskop, vakum evaporator, lampu UV,dan alat-alat gelas lainnya yang biasa digunakan di Laboratorium Kimia Organikdan Laboratorium Mikrobiologi.Prosedur kerja Penelitian ini diawali dengan isolasi jamur dari daun tumbuhan kandis gajahdan seleksi isolat jamur yang menghasilkan metabolit sekunder potensial sebagaiantioksidan (Misaghi and Donndelinger, 1990 and Lumyong et al., 2001). Bagian daun dicuci dengan alkohol 70% dibilas dengan akuades steril,selanjutnya dicuci kembali dengan larutan HgCl2 5%, dan dibilas dengan aquadessteril. Masing-masing sampel (batang dan daun) dihomogenisasi menggunakanwaring blender secara aseptik. Selanjutnya diambil 10 gram dan dimasukkan kedalam medium PCB dan diinkubasi pada shaker dikocok dengan kecepatan 100rpm pada suhu ruang selama 2 x 24 jam. Selanjutnya masing-masing kultur (daribatang dan daun) diambil 0,1 ml distreak pada medium PDA lempeng danditambahkan antibakteri, selanjutnya diinkubasi pada suhu ruang selama 2 x 24jam. Setiap koloni yang tumbuh pada PDA dimurnikan dengan menggoreskanmenggunakan jarum ose pada medium NB. Masing-masing koloni yang tumbuhterpisah sebagai singgle colony diinokulasikan pada medium PDA miring untukjamur, yang selanjutnya digunakan sebagai kultur stok dan kultur kerja untuktahapan kerja berikutnya. Masing-masing isolat jamur yang diambil dari kultur kerja, ditumbuhkan padamedium cair PDB. Kemudian dilanjutkan pada tahap optimasi pertumbuhan setiapisolat mikroba endofitik untuk mendapatkan kultur yang optimal (Chandrashekharaet al., 2007). Isolat yang berpotensi menghasilkan senyawa metabolit sekunder,Prosiding Seminar Nasional, 13-14 Desember 2010 1327
  • 141. ISBN 978-602-98295-0-1dikultur kembali dalam 2 L medium cair PDB dan diinkubasi hingga kondisioptimum untuk menghasilkan senyawa bioaktif. Selanjutnya dilakukanpenyaringan untuk memisahkan antara biomassa dan filtratnya. Filtrat yangmengandung metabolit sekunder dipartisi dengan pelarut etil asetat. Ekstrak yangdiperoleh dipekatkan dengan rotary evaporator, sehingga didapatkan ekstrakkental etil asetat. Setiap ekstrak diuji aktifitas antioksidannya dengan metodeDPPH (Selvi et al., 2003) Larutan DPPH 0,05 mM disiapkan dalam metanol. Larutan sampel uji dibuatdengan melarutkan sampel dalam dimetil sufoksida (DMSO) dengan konsentrasi100 µg/mL. Kepada 0,2 mL larutan sampel ditambahkan 3,8 mL larutan DPPH0,05 mM. Campuran larutan dihomogenkan dan dibiarkan selama 30 menitditempat gelap. Serapan diukur dengan spektrofotometer UV-Vis pada λmaks 517nm. Untuk kontrol positif digunakan antioksidan standar asam askorbat, denganperlakuan yang sama seperti sampel. Aktivitas antioksidan sampel ditentukanoleh besarnya hambatan serapan radikal DPPH melalui perhitungan persentaseinhibisi serapan DPPH dengan rumus sebagai berikut: Ak = Absorban kontrol As = Absorban sampel Ak - As % Inhibisi = x 100 Ak HASIL DAN PEMBAHASAN Dari daun tumbuhan kandis gajah (10 g) telah diisolasi empat jamur yaitu D1-D4. Masing-masing isolat jamur yang diperoleh telah dikarakterisasi morfologikoloninya sehingga diketahui D1 = jamur hijau muda (HM); D2 = jamur hijau pink(HP); D3 = jamur serabut putih (SP); dan D4 = jamur putih (P). Foto keempatjamur dan hasil karakterisasinya, tertera pada Gambar 1 dan Tabel 1.Prosiding Seminar Nasional, 13-14 Desember 2010 1328
  • 142. ISBN 978-602-98295-0-1 D1 D2 D3 D4 Gambar 1. Foto jamur endofitik yang diisolasi dari daun kandis gajahTabel 1. Morfologi koloni isolat jamur pada medium CDA, MEA, dan PDA, inkubasi selama 3 x 24 jam pada suhu 37oC.Medium Karakter Isolat jamur HM HP SP P PDA Pertumbuhan +++ + +++ + Diameter 9cm 1 cm 9 cm 0,3 cm Warna koloni Hijau muda Hijau Putih Putih Warna Hijau Putih Putih Putih kekuningan Sebalik MEA Pertumbuhan +++ + +++ + Diameter 7cm 0,5 cm 8 cm 0,2 cm Warna koloni Hijau putih putih Putih Putih Warna Hijau putih Putih Putih kekuningan Sebalik CDA Pertumbuhan ++ + ++ + Diameter 3 cm 0,3 cm 5 cm 0,2 cm Warna koloni putih Putih Putih Putih Warna Putih putih transparan putih Putih Sebalik transparan Keterangan: + = Pertumbuhan Lambat (Diameter < 3 cm) ++ = Pertumbuhan Sedang (Diameter 3-6 cm)Prosiding Seminar Nasional, 13-14 Desember 2010 1329
  • 143. ISBN 978-602-98295-0-1 +++ = Pertumbuhan Cepat (Diameter > 6 cm) HM = hijau muda HP = hijau pink SP = serabut putihP = putih Setiap isolat jamur telah dibuat kurva pertumbuhan dengan menumbuhkanjamur pada medium PDB dengan menimbang berat kering miselium pada tahapanhari (Tabel 2). Dari data yang dihasilkan dapat diketahui bahwa waktu yang tepatuntuk mengisolasi metabolit sekunder yaitu pada hari ke-27 yang berada diakhirpertumbuhan yang terlihat pada konstannya berat kering miselium pada beberapatahapan hari. Keadaan ini disebut juga sebagai fase stasioner dimana pada fasetersebut pertumbuhan jamur akan terjadi keseimbangan antara pertumbuhan dankematian sehingga pada fase tersebut juga akan dihasilkan metabolit sekunderyang maksimal.Tabel 3. Berat kering miselium per satuan waktu Isolat Berat Kering Miselium (gr/50 ml) Pada Hari ke- 3 6 9 12 15 18 21 24 27 30 HM 0,05 0,10 0,11 0,12 0,14 0,16 0,18 0,20 0,20 0,16 HP 0,10 0,17 0,18 0,20 0,22 0,24 0,24 0,20 0,19 0,17 SP - 0,06 0,10 0,12 0,15 0,17 0,18 0,15 0,13 0.09 P - 0,03 0,04 0,06 0,07 0,08 0,10 0,14 0,14 0,10Keterangan :HM = hijau muda HP = hijau pink SP = serabut putih P = putih Isolat jamur yang diperoleh telah dikultivasi dalam medium cair PDB, masing-masing sebanyak 3 L media selama 28 hari, kemudian di saring. Supernatandipartisi dengan etilasetat sebanyak tiga kali dan dipisahkan. Selanjutnya ekstraketilasetat dievaporasi hingga diperoleh ekstrak kental. Foto kultivasi jamurendofitik dari tumbuhan kandis gajah tertera pada Gambar 2.Prosiding Seminar Nasional, 13-14 Desember 2010 1330
  • 144. ISBN 978-602-98295-0-1 Gambar 2. Foto kultivasi jamur endofitik dari daun tumbuhan kandis gajah Masing-masing ekstrak kental etil asetat telah diuji aktivitas antioksidannyadengan metode DPPH (Selvi et al., 2003). Penentuan aktivitas peredaman radikalDPPH dilakukan dengan mengukur absorbansi jumlah radikal DPPH sisa denganalat spektrofotometer UV-vis pada λmaks 517 nm. Kemampuan suatu senyawadalam meredam radikal DPPH pada konsentrasi tertentu, dihitung melalui %inhibisi. Hasilnya (Tabel 3) menunjukkan bahwa ekstrak etilasetat isolat jamurHM menunjukkan aktivitas yang tinggi setara dengan standar antioksidan vitaminC, sedangkan ekstrak etil asetat jamur HP, SP, dan P menunjukkan aktifantioksidan berada dibawah aktivitas vitamin C. Hal ini menunjukkan bahwaekstrak dari isolat jamur HM berpotensi untuk dikembangkan menjadi ekstrakterstandar untuk mengobati penyakit asam urat.Prosiding Seminar Nasional, 13-14 Desember 2010 1331
  • 145. ISBN 978-602-98295-0-1Tabel 3. Persen inhibisi isolat jamur pada konsentrasi 100 ppm dengan metode DPPH Isolat jamur Absorbansi Rata-rata % inhibisi HM 0,026 0,029 96,8 0,039 0,022 HP 0,474 0,463 49,2 0,455 0,460 SP 0,214 0,231 74,7 0,245 0,235 P 0,524 0,502 44,9 0,493 0,490 Vitamin C 0,032 0,026 97,1 0,017 0,029 KESIMPULAN Tumbuhan yang memiliki sejarah etnobotani, seperti kandis gajah yang telahdigunakan secara tradisional sebagai obat asam urat, maka mikroba endofitiknyajuga menghasilkan senyawa antioksidan yang berpotensi untuk menurunkankadar asam urat dalam tubuh. Senyawa tersebut dapat diperbanyak sesuaikebutuhan dalam waktu yang relatif singkat jika dibandingkan dengan mengisolasidari tumbuhan inangnya. Hal ini merupakan pencerahan dalam mewujudkanharapan untuk menempatkan obat dari bahan alam menjadi bagian integralpelayanan kesehatan formal. DAFTAR PUSTAKAChandrashekhara, Niranjanraj, S., Deepak, S.A., Amruthesh, K.N., Shetty, N.P., and Shetty, H.S. 2007. Endophytic Bacteria from Different Plant Origin Enhance Growth and Induce Downy Mildew Resistance in Pearl Millet. Asian Journal of Plant Pathology, 1 (1): 1-11.Hundley, N.J. 2005. Struktur Elucidation of Bioactive Compounds Isolated from Endophytes of Alstonia Scholaris and Acmena Graveolens. Thesis. Department of Chemistry and Biochemistry, Brigham Young University.Prosiding Seminar Nasional, 13-14 Desember 2010 1332
  • 146. ISBN 978-602-98295-0-1Hung, P.Q. and Annapurna, K. 2004. Isolation and Characterization of Endophytic Bacterial in Soybean (Glycine sp.). Omonrice, 12: 92-101.Lumyong, S., Norkaew, N., Ponputhachart, D., Lumyong, P., and Tomita, F. 2001. Isolation, Optimitation, and Characterization of Xylanase from Endophytic Fungi. Biotechnology for Sustainable Utilization of Biological Resources. The Tropic, 15.Misaghi, I.J. and Donndelinger, C.R. 1990. Endophytic Bacteria in Symptom-Free Cotton Plants. The American Phytopathological Society, 80 (9): 808-811.Radji, M. 2005. Peranan Bioteknologi dan Mikroba Endofit dalam Pengembangan Obat Herbal. Majalah Ilmu Kefarmasian, 2(3): 113-126.Selvi, A.T, Joseph, G. S., and Jayaprakasha, G. K. 2003. Inhibition of Growth and Aflatoxin Production in Aspergillus flavus by Garcinia indica Extract and Its Antioxidant Activity. Food Microbiology 20: 455-460.Prosiding Seminar Nasional, 13-14 Desember 2010 1333
  • 147. ISBN 978-602-98295-0-1 PENAPISAN AKTIVITAS ANTIJAMUR Candida albicans (C. P. Robin) Berkhout DARI TUMBUHAN PIPERACEAE DAN PENENTUAN NILAI KHMNYA Salni, Hanifa Marisa dan, Dwi Hardestyariki Jurusan Biologi Fakultas MIPA Unsri Indralaya ABSTRACT The Research of Screening Antifungal Activity of Candida albicans (CPRobin) Berkhout of Piperaceae Plants in Forest Protected Ataran Air Betung KotaAgung Subdistrict, Lahat Regency and Dempo Mountain of Pagar Alam City ‗hasbeen carried out from March until June 2010. Sampling was conducted at theForest Protected Ataran Air Betung Kota Agung Subdistrict, Lahat Regency andDempo Mountain of Pagar Alam City. Antifungal activity assays performed in theLaboratory of Microbiology and Genetics & Biotechnology, Department of Biology,Mathematic and Natural Sciences Faculty, University of Sriwijaya. The purpose ofthis study to determine the type Piperaceae which have potency as antifungalsource from Forest Protected Ataran Air Betung and Dempo Mountain, todetermine the Minimum Inhibitory Concentration from plants Piperaceae to thegrowth of C. albicans, and to receive material bioactive anti-Candida albicans fromPiperaceae to use as medicine alternative for society as medinine anti-Candidaalbicans. Antifungal activity test carried out by agar diffusion method, the fungusused was C. albicans. The results showed 12 species of Piperaceae from ForestProtected Ataran Air Betung & Dempo Mountain and based on the results ofscreening tests are four types of members of the Piperaceae are able toinhibit the growth of C. albicans. Three types of Piperaceae which hasantifungal activity large is Piper sarmentosum, Piper cubeba, and Piper betle.Minimum Inhibitory Concentration values of methanol extracts leaf Pipersarmentosum and Piper cubeba is 6 %, but minimum inhibitory concentrationvalues of methanol extracts leaf Piper betle is 7 %.Keys words : Antijamur Candida albicans Piperaceae PENDAHULUAN Mikosis merupakan penyakit infeksi jamur yang dapat menyerang permukaantubuh seperti kulit, kuku, lapisan mukosa, dan organ dalam lainnya. Salah satupenyebab mikosis adalah jamur golongan Candida. Sifat Candida dapat berubahmenjadi patogen dan menimbulkan infeksi bila pada tubuh terdapat faktorpredisposisi. (Mulyati et al., 2002).Prosiding Seminar Nasional, 13-14 Desember 2010 1334
  • 148. ISBN 978-602-98295-0-1 Kasus mikosis yang banyak ditemukan pada manusia adalah penyakitkandidiasis. Kandidiasis adalah penyakit infeksi kulit dan selaput lendir yangdisebabkan oleh jamur dari genus Candida (Hastiono 2004). Candida albicansdapat bersifat patogenik bila terdapat situasi yang memungkinkan untuk terjadinyamultiplikasi. Termasuk diantaranya adalah pemakaian steroid sistemik maupuntopikal, terjadinya penurunan imunitas AIDS, pemakaian antibiotik spektrum luas,dan diabetes mellitus (Brown & Burns 2005). Spesies Piperaceae yang biasa dipakai sebagai obat tradisional dalammengatasi kandidiasis vaginalis (keputihan) adalah (Piper betle)(Sundari &Winarno 1996). Piperaceae adalah salah satu famili tumbuhan yang mengandungminyak atsiri. Piperaceae terdiri atas 1300 spesies yang terbagi dalam 10 marga.Hampir semua Piperaceae tumbuh di hutan hujan tropis. Tumbuhan Piperaceaemerupakan jenis tumbuhan yang bermanfaat sebagai bahan rempah-rempah,tanaman hias dan tanaman obat-obatan (Lubis 2008). Hutan Lindung Ataran Air Betung dan Gunung Dempo Pagar Alammerupakan hutan tropis yang topografinya berupa dataran tinggi berbukit danbergunung serta memiliki keanekaragaman jenis tumbuhan yang tinggi. Beberapajenis tumbuhan diduga mengandung bahan bioaktif antijamur, termasuk diantaranya adalah Piperaceae yang diharapkan dapat dikembangkan sebagaibahan baku fitofarmaka untuk mengobati penyakit infeksi dan sebagai sumbersenyawa antijamur yang baru Pengobatan alternatif sekarang banyak digunakan untuk mengendalikanberbagai jenis penyakit. Salah satunya berupa penggunaan ekstrak alamitumbuhan (Jaiswai et al., 1994 dalam Suryanto et al., 2006). Saat ini datamengenai aktivitas tanaman obat lebih banyak didukung oleh pengalaman,belum sepenuhnya dibuktikan secara ilmiah. Sehingga, diperlukan adanyapenelitian, pengujian dan pengembangan obat tradisional (Noorcholies et al.,1997 dalam Parwata et al., 2009).Prosiding Seminar Nasional, 13-14 Desember 2010 1335
  • 149. ISBN 978-602-98295-0-1 METODOLOGI PENELITIANALAT DAN BAHAN Alat yang digunakan adalah blender, botol selai, bunsen, cawan petri,erlenmeyer, gelas ukur, hot plate, jarum ose, kertas cakram, kertas saring,Laminar Air Flow, magnetic stirer, penangas air, pipet serologis, tabung reaksi danvortex. Sedangkan bahan yang dibutuhkan adalah aquades, alkohol, alumuniumfoil, anggota Piperaceae yang didapatkan dari Hutan Lindung Ataran Air Betungdan di sekitar Gunung Dempo Pagar Alam, kapas, kertas saring, mediumsabouraud dextrose agar (SDA), medium sabouraud dextrose broth (SDB), danpelarut DMSO (dimetilsulfoksida).CARA KERJA1. Pembuatan Ekstrak Daun Piperaceae dikeringkan dibawah panas matahari selama ± 4 hari, sehingga didapatkan simplisia. Simplisia dihaluskan dengan blender hingga menjadi serbuk simplisia. Simplisia ditimbang sebanyak 50 g dan dimasukkan ke dalam botol selai. Kemudian dimaserasi dengan larutan metanol sebanyak 100 ml dan direndam selama 2 hari. Setelah 2 hari, larutan disaring menggunakan kertas saring dan dikeringkan di atas pemanas listrik hingga terbentuk ekstrak kental2. Uji Penapisan Antijamur Penapisan aktivitas antijamur dilakukan dengan menguji sampel yang telah didapatkan. Ekstrak dibuat dengan konsentrasi 10 %, lalu diujikan ke Candida albicans. Suspensi jamur sebanyak 0,1 ml dimasukkan ke dalam cawan petri, kemudian ditambahkan medium SDA 10 ml dengan suhu sekitar 37 o C. Selanjutnya dihomogenkan sampai membeku. Kertas cakram dicelupkan ke dalam masing-masing larutan ekstrak, kemudian diletakkan di atas media agar Setelah itu diinkubasi selama 2 x 24 jam. Ekstrak yang mempunyai daya hambat paling besar akan diuji efektifitasnya dengan menentukan konsentarasi hambat minimumnya3. Penentuan Konsentrasi Hambat Minimum (KHM)Prosiding Seminar Nasional, 13-14 Desember 2010 1336
  • 150. ISBN 978-602-98295-0-1 Penentuan KHM dilakukan secara metode difusi agar. fraksi aktif dibuat dengan konsentrasi 10 %, 9 %, 8 %, 7 %, 6 %. Pelarut yang digunakan adalah DMSO. Selanjutnya di uji aktivitas antijamurnya. Suspensi jamur dimasukkan ke dalam cawan petri sebanyak 0,1 ml, dan ditambahkan medium SDA sebanyak 10 ml. Selanjutnya dihomogenkan sampai membeku. Kertas cakram dicelupkan ke dalam masing-masing larutan fraksi aktif yang telah melalui tahap pengenceran. Setelah diinkubasi selama 48 jam pada suhu 37 o C diukur diameter hambatan yang terbentuk menggunakan jangka sorong (Picman et al., 1998 modifikasi Salni 2003). HASIL DAN PEMBAHASAN Spesies Piperaceae yang ditemukan di Hutan Lindung Ataran AirBetung terdapat 5 spesies yaitu Piper betle L., Piper cubeba L., Piperaduncum L., Piper nigrum L., dan Peperomia pellucida L. Sedangkan di GunungDempo ada 9 spesies yaitu Piper retrofractum Vahl., Piper recurvum Bl., Pipermollissimum Bl., Piper sarmentosum Roxb. Ex Hunter., Piper caninum Bl., Pipersp. 1, Piper sp. 2, Piper betle L. dan Piper aduncum L.Tabel 1. Hasil Pengukuran Zona Hambat yang terbentuk dari aktivitas antijamur 12 Spesies Piperaceae terhadap Candida albicans.No Jenis Diameter hambatan (mm) 1 Piper betle 12,25 2 Piper cubeba 13,00 3 Piper sarmentosum 13,00 4 Piper recurvum 10,00 5 Piper sp. 1 - 6 Piper retrofractum - 7 Piper sp. 2 - 8 Piper aduncum - 9 Peperomia pellucida - 10 Piper nigrum - 11 Piper mollissimum - 12 Piper caninum - Berdasarkan pengujian aktivitas antijamur dari 12 jenis Piperaceae dengankonsentrasi 10 % (Tabel 1), diketahui bahwa hanya 4 spesies Piperaceae sajayang menunjukkan keefektifan dalam menghambat pertumbuhan CandidaProsiding Seminar Nasional, 13-14 Desember 2010 1337
  • 151. ISBN 978-602-98295-0-1albicans. Hal ini dapat dilihat dari terbentuknya zona bening di sekitar cakramyang telah diletakkan pada medium agar yang ditumbuhi Candida albicans.Spesies Piperaceae yang dapat menghambat Candida albicans tersebut adalahPiper betle L., Piper cubeba, Piper sarmentosum Roxb, dan Piper recurvum Bl. Empat spesies Piperaceae yang mampu menunjukkan daya hambatterhadap Candida albicans diketahui bahwa mempunyai kandungan senyawakimia yang dapat digunakan sebagai bahan antimikrobia khususnya bersifatantifungi. Menurut (Parwata et al., 2009) minyak atsiri dari daun sirih terdiri darikavikol, eugenol, dan sineol. Minyak atsiri dari daun sirih mengandung 30% fenoldan beberapa derivatnya. Karvakrol yang terkandung dalam minyak atsiri sirihbersifat sebagai desinfektan dan antijamur sehingga bisa digunakansebagai antiseptik. Syahid & Balittro (2008) menyatakan juga bahwa daun P. sarmentosummengandung saponin dan polifenol. P. sarmentosum ini mengandung senyawakimia beta sitosterol, amide, pelliterine, alkene dan pyrole amide. Senyawa alkenemempunyai efek memperkecil selaput lendir (astringen). Monoterpen utama daridaun Piper cubeba terdiri atas senyawa -pinene, thujene, sabinene, dan limonene.Berdasarkan hasil penelitian terhadap lignan dan minyak atsiri dari P. cubebadapat diketahui bahwa selain dari biji, daun dari tumbuhan ini juga dapatdimanfaatkan untuk tujuan pengobatan. Hal ini dapat dijadikan dasar untukpengembangan lebih lanjut sehingga P. cubeba bisa dijadikan untuk pengobatanrasional (fitofarmaka) (Fahmi 2009). Pada penapisan aktivitas antijamur ada beberapa spesies Piperaceae yangtidak aktif dalam menghambat C. albicans. Minyak atsiri merupakan kandunganterbesar dari Piperaceae yang diduga menghambat pertumbuhan C.albicans.Salah satu faktor penyebab tidak aktifnya minyak atsiri di dalam ekstrakPiperaceae adalah perbedaan habitat dan ketinggian tempat. Menurut Purnomo &Asmarayani (2004) spesies Piperaceae yang diambil dari habitat dan ketinggianyang berbeda terbukti memiliki perbedaan terutama nilai kuantitas dari minyakatsiri. Hal ini dikarenakan adanya perbedaan faktor-faktor luar yangmempengaruhi, seperti iklim dan tanah. Diameter zona hambat terbesar yang terbentuk dalam media adalahekstrak Piper sarmentosum dan Piper cubeba yaitu sebesar 13 mm. DiameterProsiding Seminar Nasional, 13-14 Desember 2010 1338
  • 152. ISBN 978-602-98295-0-1zona hambat yang dibentuk ekstrak Piper betle sebagai antiseptik yang seringdigunakan dalam pengobatan hanya sebesar 12,25 mm. Hal ini berarti Pipersarmentosum dan Piper cubeba mempunyai potensi yang lebih baik dibandingkandengan Piper betle untuk dikembangkan sebagai senyawa antijamur baru. Ekstrak Piper betle, Piper sarmentosum dan Piper cubeba diuji lanjut untukmengetahui nilai konsentrasi hambat minimum (KHM) nya. Hasil penentuan nilaiKHM dapat dilihat pada tabel 2.Tabel 2. Hasil Pengukuran Zona Hambat 3 Ekstrak Spesies Piperaceae dari Pengujian Konsentrasi Hambat Minimum (KHM)Konsentrasi Diameter Zona Hambat 3 Spesies Piperaceae (mm) P. betle P. sarmentosum P. cubeba 10 % 9,30 ± 1,25 15,50 ± 1,80 14,60 ± 4,01 9 % 9,16 ± 0,76 16,16 ± 5,92 10,60 ± 1,44 8 % 9,30 ± 1,52 15,16 ± 2,25 9,16 ± 2,02 7% 8,60 ± 0,57 15,30 ± 4,19 8,83 ± 1,04 6% - 13,00 ± 3,96 9,83 ± 2,36 5% - - -Keterangan (-) : Tidak terbentuk diameter zona hambat Gambar 1. Hasil Pengujian Konsentrasi Hambat Minimum dari Piper sarmentosum terhadap Candida albicans Keterangan : 10 % = 17,5 mm; 9% = 23 mm; 8% = 17,5 mm ; 7% = 18 mm 6 % = 17,5 mmProsiding Seminar Nasional, 13-14 Desember 2010 1339
  • 153. ISBN 978-602-98295-0-1 Zona hambat Gambar 2. Hasil Pengujian Konsentrasi Hambat Minimum (KHM) dari Piper betle terhadap Candida albicans Keterangan : 10% = 10,5 mm; 9% =10 mm; 8% = 11 mm; 7% = 9 mm 6 % = - Zona Hambat Gambar 3. Hasil Pengujian Konsentrasi Hambat Minimum dari Piper cubeba terhadap Candida albicans Keterangan :10%= 15 mm; 9%= 9 mm; 8%=8 mm; 7%=8,5 mm 6 % = 2,5 mm Pada Tabel 2, dan Gambar 1, 2, 3, terlihat bahwa nilai konsentrasi hambatminimum (KHM) Piper sarmentosum dan Piper cubeba terletak pada konsentrasi 6%. Sedangkan nilai konsentrasi hambat minimum (KHM) Piper betle terletak padakonsentrasi 7 %. Menurut Sukandar et al., (2006) Konsentrasi Hambat Minimum(KHM) dinyatakan sebagai konsentrasi terkecil yang masih dapat menghambatpertumbuhan mikroba. Semakin kecil nilai KHM yang diperoleh maka semakinpeka mikroba yang di uji. Hal ini berarti semakin efektif penggunaan ekstrak dalammenghambat pertumbuhan mikroba. Menurut penelitian Elya & Soemiati (2002)hasil penentuan konsentrasi hambat minimum efek antijamur infusum daun sirihterhadap C.albicans menunjukkan bahwa infusum daun sirih mempunyai efekProsiding Seminar Nasional, 13-14 Desember 2010 1340
  • 154. ISBN 978-602-98295-0-1antijamur. Diameter zona hambat infusum daun sirih 250 mg/ml adalah 10,43 mm,500 mg/ml adalah 12,33 mm dan 1000 mg/ml adalah 16,80 mm. KESIMPULAN DAN SARANKseimpulan :1. Dari 12 spesies Piperaceae yang didapatkan di Hutan Lindung Ataran Air Betung dan Gunung Dempo hanya 4 spesies Piperaceae yang yang aktif menghambat C. albicans yaitu Piper cubeba, Piper betle, Piper recurvum dan Piper sarmentosum2. Piper sarmentosum dan Piper cubeba menunjukkan daya hambat terbesar terhadap Candida albicans dengan diameter zona hambat 13 mm.3. Nilai konsentrasi hambat minimum (KHM) Piper sarmentosum dan Piper cubeba terletak pada konsentrasi 6 %. Sedangkan nilai konsentrasi hambat minimum (KHM) Piper betle terletak pada konsentrasi 7 %.Saran Berdasarkan hasil penelitian ini, diharapkan dapat dilakukan penelitian lebihlanjut untuk mengisolasi dan mengidentifikasi senyawa aktif yang terkandungdalam ekstrak tumbuhan Piperaceae sebagai bahan antijamur, khususnya Pipersarmentosum yang bersifat fungisidal terhadap Candida albicans. DAFTAR PUSTAKABrown, R. G., & T. Burns. 2005. Dermatologi. Edisi kedelapan. Penerbit Erlangga. Jakarta: vi + 223 hlm.Elya, B & Soemiati, A. 2002. Uji Pendahuluan Efek Kombinasi Antijamur Infus Daun Sirih (Piper betle L.), Kulit Buah Delima (Punica granatum L.), dan Rimpang Kunyit (Curcuma domestica Val.) Terhadap Jamur Candida albicans. Jurnal Makara Seri Sains. Volume 6 Nomor 3. 149-154 hlmFahmi, E. 2009. Studi fitokimia dan biosintesis lignan dari Piper cubeba, dengan fokus pada tumbuhan obat Indonesia. Tesis. ITB Bandung. 1-120 hlm.Hastiono, S. 2004. Hikmah Hidup Bersama Cendawan. Jurnal Wartazoa. Balai Penelitian Veteriner Bogor. Vol. 14 Nomor 4. 178-183 hlmProsiding Seminar Nasional, 13-14 Desember 2010 1341
  • 155. ISBN 978-602-98295-0-1Lubis, A. 2008. Keanekaragaman Piperaceae & Rubiaceae di Taman Wisata Alam Deleng Lancuk Kabupaten Karo Sumatera Utara. Tesis. Program Studi Biologi Universitas Sumatera Utara. 1-90 hlmMulyati, R. W., Widiastuti, P.K Sjarifuddin. 2002. Isolasi Spesies Candida dari Tinja Penderita HIV/AIDS. Jurnal Makara Kesehatan. Vololume 6, No. 2. 51- 55 hlmParwata, I.M.Oka A., Rita, W.S., R.Yoga. 2009. Isolasi dan Uji Antiradikal Bebas Minyak Atsiri pada Daun Sirih (Piper betle Linn) Secara Spektroskopi Ultraviolet-Tampak. Jurnal Kimia 3 (1), Januari 2009 : 7-13 hlm.Purnomo & Asmarayani, R.2005. Hubungan Kekerabatan Antar Spesies Piper Berdasarkan Sifat Morfologi dan Minyak Atsiri Daun di Yogyakarta. Jurnal Biodiversitas. Volume 6, Nomor 1. 12-16 hlm.Sukandar,E.Y, Suwendar & E. Ekawati. 2006. Aktivitas ekstrak etanol herba seledri (Apium graveolens) dan daun urang aring (Eclipta prostata (L.)L.) terhadap Pityrosporum ovale. Majalah Farmasi Indonesia, 17 (1), 7 – 12. Sekolah Farmasi, Institut Teknologi Bandung. 7-12 hlm.Suryanto, D., T. B. Kelana., Erman, M., Nona, N. 2006. Pengaruh Ekstrak Metanol Daun Tumbuhan Pradep (Psycliotltria stipulaceti Wall (Familia: Rubiaceae)) Terhadap Mikroba. Jurnal Media FarmasiProsiding Seminar Nasional, 13-14 Desember 2010 1342
  • 156. ISBN 978-602-98295-0-1 ANALISIS DETERMINAN PEMANFAATAN LAYANAN ANTENATAL CARE (ANC) DI SUMATERA SELATAN Rini Mutahar Fakultas Kesehatan Masyarakat Unsri ABSTRAKKematian ibu umumnya dapat dicegah bila komplikasi kehamilan dan keadaanrisiko tinggi lainnya dapat dideteksi secara dini. Cara deteksi dini dapat dilakukanpada pelayanan antenatal care yaitu dengan peningkatan cakupan pelayananantenatal baik K1 dan K4. Penelitian ini bertujuan untuk mengetahui faktor-faktoryang berpengaruh terhadap pemanfaatan layanan ANC di Sumatera Selatan.Studi ini merupakan analisis lanjut dari Survei Demografi Kesehatan Indonesia(SDKI) 2007 yang menggunakan desain crosssectional. Analisis datamenggunakan regresi logistic ganda.Dari hasil penelitian didapatkan frekuensi ANC cukup sebanyak 58%,kelengkapan ANC terhadap > 2 jenis pelayanan, sebanyak 41,2% dan sebagianbesar ibu melakukan layanan ANC buruk (61.2%)3. Ibu yang mengalamikomplikasi kehamilan memiliki resiko memanfaatkan layanan antenatal 2,59 kalilebih besar dari pada ibu yang tidak mengalami komplikasi kehamilan setelahdikontrol oleh variable tempat tinggal, layanan ANC ditemani suami dan umur(95% CI 1.27-5.32). Ibu yang tidak ditemani suaminya saat kunjungan ANCmemiliki resiko memanfaatkan layanan antenatal hampir 2 kali lebih besar daripada ibu yang ditemani suaminya saat kunjungan ANC.Disarankan untuk lebih meningkatkan monitoring terhadap bidan desa terhadaplayanan ANC, tidak hanya pada frekuensi ANC tetapi juga pada kelengkapanpemeriksaan ANC dan meningkatkan penyuluhan bagi ibu hamil mengenailayanan ANCKata Kunci : ANC, komplikasi kehamilan, dukungan suamiProsiding Seminar Nasional, 13-14 Desember 2010 1343
  • 157. ISBN 978-602-98295-0-1 PENDAHULUAN Angka Kematian Ibu (AKI) merupakan salah satu indikator penting dalammenilai derajat kesehatan. AKI bukan saja merupakan indakator tingkat kesehatanwanita, tetapi juga menggambarkan tingkat akses, integritas dan efektivitas sektorkesehatan. Oleh karena itu AKI juga sering dipergunakan sebagai indikator tingkatkesejahteraan dari suatu negara (Depkes RI, 2005). Berdasarkan Survei Demografi Kesehatan Indonesia, AKI Indonesiaadalah 307/100.000 kelahiran hidup pada tahun 2002 (BPS, 2003). Angkaini masih dibawah target nasional yaitu 125 per 100,000 KH pada 2010 dan 102per 100.000 KH untuk target Milleniun Development Goals (MDGs). Sebagian besar kematian ibu di Indonesia adalah perdarahan 42 %,ekslampsia 13 %, komplikasi abortus 11 %, infeksi 10 % dan persalinan lama 9 %.Kematian ini umunya dapat dicegah bila komplikasi kehamilan tersebut dankeadaan risiko tinggi lainnya dapat dideteksi secara dini. Cara deteksi dini dapatdilakukan pada pelayanan antenatal care yaitu dengan peningkatan cakupanpelayanan antenatal baik K1 dan K4 ( WHO, 1998). Berdasarkan data SDKI 1994 bahwa jumlah ibu hamil yang berhasil difollow up hingga berakhirnya kehamilan sebanyak, 78% pernah memeriksakankehamilan. Meskipun demikian tidak semua dari mereka memeriksakanpemeriksaan sesuai standar pelayanan ANC sampai dengan 4 kali, yaitu 2 kalipada trisemester pertama, 1 kali pada trisemester ke-2 dan 2 kali pada trisemesterke 3, termasuk kelengkapan pelayanan ANC yang terdiri dari 5T, yaitu: ditimbang,itu sendiri, seperti: Timbangan berat badan dan pengukuran tinggi badan,pemeriksaan tekanan darah, pemeriksaan tinggi fundus uteri, pemberian TetanusToksoid (TT) dua kali selama hamil dan pemberian tablet zat besi. Kegiatan pelayanan antenatal care di Provinsi Suematera Selatan belummenunjukkan hasil yang memuaskan. Sebanyak 69,6% ibu pernahmemeriksakan kehamilannya dan hanya 59,2% yang melakukan pemeriksaanterhadap 3-5 jenis pelayanan ANC. (Depkes 2008)Prosiding Seminar Nasional, 13-14 Desember 2010 1344
  • 158. ISBN 978-602-98295-0-1 METODE Penelitian ini menggunakan data sekunder SDKI tahun 2007 yangdirancang dengan desain potong lintang (cross sectional). SDKI dilaksanakan olehBadan Pusat Statistik (BPS) bekerja sama dengan Badan Koordinasi KeluargaBerencana Nasional (BKKBN) dan Departemen Kesehatan. SDKI ini merupakanbagian dari program Internasional Survey Demografi dan Kesehatan(Demographic and Health Survey) yang dirancang untuk mengumpulkan datafertilitas, Keluarga Berencana (KB), serta kesehatan Ibu dan anak. Prosedur sampling yang dilakukan oleh SDKI 2007 dilakukan denganmenggunakan sampling beberapa tahap (multi stage sampling), meliputi clustersampling, stratified sampling, sistematik sampling, hingga sampel acak sederhana Populasi adalah wanita pernah kawin berumur 15-49 tahun yangmelahirkan bayi terakhir dalam 5 tahun sebelum survei yang berdomisili diSumatera Selatan. Peneliti memutuskan untuk mengambil seluruh populasimenjadi sampel penelitian, yang berjumlah 464 orang. Analisis data dilakukan dengan menggunakan regresi logistik ganda.Perhitungan Odds Ratio (OR) dilakukan dengan mengontrol beberapa variabelkarakteristik responden yang bermakna secara statistik (p-value < 0.05). HASIL Responden yang pernah hamil dalam periode 5 tahun sebelum surveysebanyak 464 orang, sebanyak 404 orang atau 87% berpendidikan SMP,sebagian besar responden berumur 20-35 tahun (70%). Hampir semua respondenmenyatakan pernah mengalami komplikasi kehamilan sebanyak 91,4% danhampir sebagian besar responden mempunyai paritas 2-3 (46.6%).Prosiding Seminar Nasional, 13-14 Desember 2010 1345
  • 159. ISBN 978-602-98295-0-1 Tabel 1 Distribusi Frekuensi menurut Karakteristik Faktor Ibu Variabel n % Pendidikan Tidak Sekolah 13 2.8 SD 219 47.2 SMP 214 46.1 SMA+ 18 3.9 Umur ibu < 20 tahun 44 9.5 20 – 35 tahun 325 70.0 > 35 tahun 95 20.5 Paritas Primipara 155 33.4 2-3 216 46.6 >3 93 20.0 Komplikasi Kehamilan Tidak Ada 424 91.4 Ada 37 8.0 Total 464 100 Sebagian besar responden tingal dipedesaan (67.7%) dan sebanyak56.5% responden mempunyai status ekonomi rendah atau menengah kebawah,seperti yang terlihat pada table 2. Tabel 2 Distribusi Frekuensi menurut Karakteristik Sosial Variabel n % Tingkat Sosial ekonomi 160 34.5 Terbawah 102 22.0 Menengah 100 21.6 Kebawah 49 10.6 Menengah 53 11.4 Menengah Keatas Teratas 32.3 Daerah tempat 67.7 tinggal 150 Perkotaan 314 Pedesaan Total 464 100 Layanan ANC pada penelitian ini didefinisikan menurut frekuensi ANC dankelengkapan ANC. Frekuensi ANC baik bila memenuhi 1 kali pada Trimester I, 1Prosiding Seminar Nasional, 13-14 Desember 2010 1346
  • 160. ISBN 978-602-98295-0-1kali pada Trimester II, dan 2 kali pada Trimester III. Kelengkapan jenispelayanan/pemeriksaan yang diberikan, yaitu timbang BB, ukur tinggi badan,tekanan darah, air seni, darah, dan raba perut yang dilakukan ibu selamakehamilannya. Layanan ANC dikategorikan baik, jika frekuensi memenuhi syaratdan jumlah pemeriksaan ≥ 2 dan dikategorikan buruk, selain dari syarat di atas. Dari hasil penelitian didapat sebagian besar reponden mempunyai frekuensiANC cukup (58.0%), dan lebih dari setengahnya melakukan pemeriksaan kurang dari2 jenis. Sebagian besar ibu melakukan layanan ANC buruk (61.2%). Dan lebihdari setengahnya ditemani suami pada saat pemeriksaan kehamilan (56.3%) Tabel 3 Distribusi Frekuensi menurut Karakteristik PelayananKesehatan Variabel n % Frekuensi ANC Kurang 138 29.7 Cukup 269 58.0 Kelengkapan ANC < 3 pemeriksaan 238 51.3* ≥ 3 pemeriksaan 191 41.2 Kunjungan ANC ditemani suami Tidak 168 36.2* Ya 561 56.3 Layanan ANC Buruk 284 61.2 Baik 138 29.7 Total 464 100 * Bila total % tidak 100%, selisihnya menunjukkan missing data Pada analisis bivariat, dari 7 variabel yang dianalisis, hanya 1 variabel yangtidak berpengaruh terhadap pemanfaata layanan ANC yaitu paritas. Semuavariable yang memenuhi kriteria merupakan variable kandidat model multivariat.Hasilnya memperlihatkan bahwa semua variable dapat diikutsertakan dalammodel dasar multivariate, kecuali paritas (nilai p < 0,05). Model akhir analisisregresi logistic dapat dilihat pada table 5. Pada model akhir ini, terdapat 4 variabelyang mempunyai p value < 0.05. Variabel tersebut adalah tempat tinggal,komplikasi kehamilan, layanan ANC ditemani suami dan umur ibu.Prosiding Seminar Nasional, 13-14 Desember 2010 1347
  • 161. ISBN 978-602-98295-0-1 Tabel 4 . Analisis Bivariat, Analisis Determinan Pemanfaatan Layanan ANCVariabel Layanan ANC P OR Kurang Baik CI 95% n % n % Pendidikan Rendah 276 63.8 128 31.7 0.04 2.7 (1.04- Tinggi 8 44.4 10 55.6 6.7) Umur < 29 tahun 172 71.1 70 28.9 0.055 1.5 (0.99- ˃ 29 tahun 112 62.2 68 37.8 2.3) Paritas <3 99 63.5 57 36.5 0.198 0.76 (0.5- ≥3 185 69.5 81 30.5 1.1)Komplikasi kehamilan Tidak 266 69.1 119 30.9 0.08 2.5 (1.25- Ya 17 47.2 19 52.8 4.9)Kunjungan ANCditemanisuami 124 75.6 40 24.4 0.004 1.9 (1.2-2.9) Tidak 159 62.1 97 37.9 YaTingkat Sosial 1.7 (1.1-ekonomi 165 72.7 62 27.3 0.01 2.5) Rendah 119 61.0 76 39.0 Tinggi Daerah tempat tinggal Perkotaan 82 56.9 62 43.1 0.01 0.5 (0.3- Pedesaan 202 72.7 76 27.3 0.75) . Tabel 5. Model Akhir Analisis Determinan Pemanfaatan Layanan ANC Variabel P Exp 95 % CI (B) Exp (B) Tempat tinggal 0.01 0.491 0.31-0.76 Komplikasi kehamilan 0.09 2.59 1.27-5.32 Ditemani suami 0.05 1.90 1.21-2.99 Umur 0.02 1.66 1.08-2.55 Konstanta 0.496 0.75 PEMBAHASAN Prosiding Seminar Nasional, 13-14 Desember 2010 1348
  • 162. ISBN 978-602-98295-0-1 Desain yang digunakan dalam penelitian ini adalah crossectional. Desainini mempunyai kelamahan karena tidak dapat membedakan variable yangmenjadi penyebab dengan variable yang menjadi akibat. Namun demikian,setidaknya ada 2 variabel utama yang dapat dipastikan terjadi sebelumpemeriksaan kehamilan terjadi, yaitu umur dan layanan ANC ditemani suami . Responden yang mempunyai frekuensi ANCnya cukup sebanyak 58%.Angka ini hampir sama dengan Survei Kesehatan Rumah Tangga 2001 yaitu 53%. dan penelitian Besral (2006) bahwa sebesar 52,1% responden melakukanpemeriksaan kehamilan minimal 4 kali. Kualitas layanan ANC pada penelitian iniditentukan oleh variable kelengkapan ANC, sebanyak 41,2% respondenmelakukan pemeriksaan terhadap > 2 jenis pelayanan ANC. Hasil ini lebih rendahdari data Riskesdas 2007, sebanyak 59,2%. Dalam penelitian ini, ibu yang mengalami komplikasi kehamilan memilikiresiko memanfaatkan layanan antenatal 2,59 kali lebih besar dari pada ibu yangtidak mengalami komplikasi kehamilan setelah dikontrol oleh variable tempattinggal, layanan ANC ditemani suami dan umur (95% CI 1.27-5.32). Pemilihanvariabel komplikasi kehamilan dalam penelitian ini ditujukan untuk mengetahuiseberapa besar kebutuhan ibu untuk menggunakan layanan ANC. Hal ini sesuaidengan teori Anderson (1975), yaitu keadaan atau kondisi saat periksa hamil yangdirasa atau dipersepsi ibu terhadap berat ringannya penyakit atau keluhan/gejalayang dirasakan ibu sebagai gangguan kesehatan selama kehamilannya. Andersonjuga berpendapan bahwa kebutuhan merupakan faktor yang menjadi alasanlangsung untuk seseorang menggunakan fasilitas pelayanan kesehatan. Dukungan suami atau pihak ketiga dalam penelitian ini diperlihatkan olehvariable kunjungan ANC yang ditemani suami. Pada penelitian ini, ibu yang tidakditemani suaminya saat kunjungan ANC memiliki resiko memanfaatkan layananantenatal hampir 2 kali lebih besar dari pada ibu yang ditemani suaminya saatkunjungan ANC setelah dikontrol oleh variable tempat tinggal, layanan ANC danumur (95% CI 1.21-2.99). Adanya dukungan dari suami ini sebagai faktorpenunjang/penguat (reinforcing) yang mendorong seseorang untuk melakukansesuatu dalam hal ini mendorong ibu hamil untuk memnafaatkana pelayananantenatal. Hasil ini sejalan dengan penelitian yang dilakukan Wibowo (1999) diCiawi bahwa hampir semua pemanfaatan pelayanan antenatal terjadi atasProsiding Seminar Nasional, 13-14 Desember 2010 1349
  • 163. ISBN 978-602-98295-0-1anjuran/dukungan pihak ketiga. Adimiharja(1992), menyatakan bahwa kehidupansosial masyarakat di Indonesia, seorang ibu dalam kehidupan berumah tanggadalam mengambil keputusan penting termasuk memeriksakan kehamilannyakepuskesmas untuk dirinya sendiri maka suaminyalah yang mengambil tanggungjawab tersebut. Ibu berumur < 29 tahun memiliki resiko memanfaatkan layanan antenatal1,7 kali lebih besar dari pada ibu yang berumur > 29 tahun setelah dikontrol olehvariable tempat tinggal, layanan ANC ditemani suami dan komplikasi kehamilan(95% CI 1.08-2.55). Hasil pelitian ini berbeda dengan Tanuwidjaya (1994) bahwatidak ada perbedaan pemanfaatan pelayanan antenatal pada kelompok 20-35tahun dan umur < 20 tahun atau > 35 tahun. Perbedaan ini kemungkinandisebabkan karena penggunaan cut off point yang berbeda. Penelitian ini membuktikan bahwa dari 4 variabel utama (komplikasikehamilan, tempat tinggal, umur dan dukungan suami) yang paling besarpengaruhnya adalah komplikasi kehamilan (ORadj = 2,59) dan dukungan suami(ORadj= 1,9) KESIMPULAN1. Dari hasil penelitian didapatkan frekuensi ANC cukup sebanyak 58%, kelengkapan ANC terhadap > 2 jenis pelayanan, sebanyak 41,2% dan sebagian besar ibu melakukan layanan ANC buruk (61.2%)32. Terdapat hubungan yang erat antara dukungan suami dengam pemanfaatan layanan ANC. Ibu yang tidak ditemani suaminya saat kunjungan ANC memiliki resiko memanfaatkan layanan antenatal hampir 2 kali lebih besar dari pada ibu yang ditemani suaminya saat kunjungan ANC3. Peningkatan layanan ANC tidak dapat mengandalkan frekuensi kunjungan tetapi juga harus diikuti dengan kualitas kunjungan ANC yang dipenuhi dengan 5T4. Variabel yang paling besar pengaruhnya terhadap pemanfaatan layanan ANC adalah komplikasi kehamilan yang diikuti oleh dukungan suami.Prosiding Seminar Nasional, 13-14 Desember 2010 1350
  • 164. ISBN 978-602-98295-0-1 SARAN1. Untuk lebih meningkatkan monitoring terhadap bidan desa terhadap layanan ANC, tidak hanya pada frekuensi ANC tetapi juga pada kelengkapan pemeriksaan ANC, mengingat rendahnya pemanfaatan layanan ANC.2. Melakukan penyuluhan bagi ibu hamil mengenai layanan ANC, sebagai pendidikan informal, mengingat sebagian besar ibu berpendidikan SMP DAFTAR PUSTAKAAdimiharja, K. 1992. Faktor Sosiokultur Yang Mempengaruhi Angka Kematian Maternal, Pertemuan Tahunan POGI VIII, BAdungAnderson, R. 1998. A Behavioral Models f Families Use of Health Services, Research Seriea 25, The University of ChicagoBesral. 2006. Pengaruh Pemeriksaan Kehamilanj Terhadap Penolong Persalinan.Jurnal Kesehatan Masyarakat Vol.1. No,2, Oktober 2006: 88-92Depkes, 2005. Pedoman Sistem Rujukan Maternal dan Neonatal Di Tingkat Kabupaten/Kota.Depkes.2008 Riset Dasar Kesehatan. Depkes. JakartaDepkes, 2002. Laporan Survey Kesehatan Rumah Tangga 2001: Studi Kesehatan Ibu dan AnakBPS, BKKBN, Depkes & Macro International Inc. 1997. Survey Demografi dan Kesehatan Indonesia 1998. JakartaTanuwidjaya S.N, 1992. Faktor-faktor yang berhubungan dengan pemanfaatan pelayanan antenatal di Puskesmas wilayah Kabupaten Bogor, Tesis Program Pasca Sarjana IKM FKM UI, DepokWibowo, A. 1999. Laporan Penelitian, Ciri Reproduksi dan Pemanfaatan Pemeriksaan Kehamilan di Kecamatan Ciawi Kabupaten BogorWHO. 1998. Regional Health Report Focus On Woman, New Delhi.Prosiding Seminar Nasional, 13-14 Desember 2010 1351
  • 165. ISBN 978-602-98295-0-1 FAKTOR-FAKTOR YANG MEMPENGARUHI STATUS GIZI BALITA DI DESA SENURO TIMUR KECAMATAN TANJUNG BATU OGAN ILIR Rini Mutahar, Fatmalina Febry, Suci Destriatania & Indah Purnama Sari Fakultas Kesehatan Masyarakat Unsri ABSTRAKMasa balita merupakan masa yang tergolong rawan dalam pertumbuhan danperkembangan anak karena pada masa ini anak mudah sakit dan mudah terjadikurang gizi Prevalensi gizi kurang dan gizi buruk mulai meningkat pada usia 6-11bulan dan mencapai puncaknya pada usia 12-23 bulan dan 24-35 bulan. Tujuanpenelitian ini adalah diketahuinya faktor-faktor mempengaruhi status gizi balita diDesa Senuro Timur Kecamatan Tanjung Batu Kabupaten Ogan Ilir.Rancangan penelitian ini adalah potong lintang (cross sectional) dimana dilakukanpengukuran variabel dependen dan variabel independen pada saat yang sama.Populasi dalam penelitian ini adalah semua anak balita bertempat tinggal di DesaSenuro Timur Kecamatan Tanjung Batu Ogan Ilir. Sampel dalam penelitian iniadalah sebagian dari populasi Kriteria inklusi sampel penelitian ini adalah keluargayang memiliki balita usia 6-59 bulan dan tercatat pada register posyandu. Datadianalisis secara univariat dan bivariat.Dari hasil penelitian didapatkan bahwa sebagian besar anak mempunyai statusgizi baik, yang mempunyai status gizi kurang hanya 20,3%. Sebagian besar anakberusia antara 12 – 36 bulan, anak paling banyak laki-laki (53,6%) dan anak yangmenderita diare sebesar 30,4%. Tidak terdapat hubungan yang bermakna antarastatus gizi balita dengan jenis kelamin, umur dan penyakit infeksi Serta adahubungan yang bermakna antara status gizi dengan kecukupan energi (p < 0,05).Disarankan untuk meningkatkan kegiatan promosi kepada masyarakat mengenaiPerilaku Hidup Bersih dan Sehat (PHBS), dan penelitian lebih lanjut dapat di telitivariable lain yang dapat menyebabkan status gizi balita, seperti pola asuh dan,pola pemberian ASI serta menentukan variable mana yang lebih berpengaruhKata kunci : Status Gizi, Balita, Ogan Ilir PENDAHULUAN Masa balita merupakan masa yang tergolong rawan dalam pertumbuhandan perkembangan anak karena pada masa ini anak mudah sakit dan mudahterjadi kurang gizi (Soetjiningsih; Sarah, 2008). Gizi kurang merupakan salah satumasalah gizi utama pada balita di Indonesia. Prevalensi gizi kurang dan gizi burukmulai meningkat pada usia 6-11 bulan dan mencapai puncaknya pada usia 12-23bulan dan 24-35 bulan. Di negara-negara ASEAN pada periode tahun yangProsiding Seminar Nasional, 13-14 Desember 2010 1352
  • 166. ISBN 978-602-98295-0-1hampir sama (1990-1997) prevalensi gizi buruk pada anak balita hanya berkisarantara 1-5 % (Soekirman; Lubis, 2008). Kondisi status gizi kurang (BB/U < - 2 SD)pada balita di Malaysia dan Thailand masing-masing sebesar 18,3% dan 18,6%(Hidayat, 2005). Berdasarkan data Survei Sosial Ekonomi Nasional (SUSENAS) 2003prevalensi gizi buruk pada balita di Indonesia menurut BB/U pada tahun 2002adalah 8,0% dengan jumlah balita 18.369.952 orang dan meningkat pada tahun2003 yaitu 8,3% dengan jumlah balita 18.608.762 orang (Hayatinur. E; Lubis,2008). Selain itu, berdasarkan data Direktorat Bina Gizi Masyarakat SumateraSelatan pada tahun 2006 terdapat 110.461 balita, 36.424 diantaranya tergolonggizi kurang dan 3.460 balita tergolong gizi buruk (berdasarkan indeks antropometriBB/U). Sedangkan pada tahun 2008 terdapat 106.701 balita, 13.183 diantaranyatergolong gizi kurang dan 1.798 balita tergolong gizi buruk (Wirakencana; Sartika,2009). Desa Senuro Timur merupakan salah satu desa yang berada di wilayahkerja Kecamatan Tanjung Batu. Data yang diperoleh dari Puskesmas Seri Tanjungpada bulan Juni 2010 diperoleh bahwa dari 14 balita terdapat 13 balita denganstatus gizi bawah garis merah (BGM) dan 1 balita dengan status gizi burukberdasarkan BB/U. 1 balita dengan status gizi buruk berasal dari keluarga yangbukan dari keluarga miskin (gakin) dengan riwayat kesehatan tidak imunisasilengkap dan menderita penyakit. Oleh karena itu, berdasarkan latar belakangdiatas, maka peneliti tertarik untuk melakukan penelitian mengenai faktor-faktoryang mempengaruhi status gizi balita di Desa Senuro Timur Kecamatan TanjungBatu Kabupaten Ogan Ilir Sumatera Selatan. METODE Rancangan penelitian ini adalah potong lintang (cross sectional) dimanadilakukan pengukuran variabel dependen dan variabel independen pada saatyang sama. Variabel dependen yang akan diteliti adalah KEP balita sedangkanvariabel independennya adalah karakteristik anak (umur, jenis kelamin, penyakitinfeksi), karakteristik ibu (pendidikan ibu, pengetahun gizi ibu, pekerjaan ibu),karakteristik ayah (pendidikan ayah, pekerjaan ayah), karakteristik keluargaProsiding Seminar Nasional, 13-14 Desember 2010 1353
  • 167. ISBN 978-602-98295-0-1(jumlah anggota keluarga, jumlah balita, tingkat pendapatan keluarga), pola asuh,pola konsumsi kalori dan protein) Populasi dalam penelitian ini adalah semua anak balita bertempat tinggal diDesa Senuro Timur Kecamatan Tanjung Batu Ogan Ilir. Sampel dalam penelitianini adalah sebagian dari populasi. Kriteria inklusi sampel penelitian ini adalahkeluarga yang memiliki balita usia 6-59 bulan dan tercatat pada register posyandu. Data dinalisis secara univariat dan bivariat untuk mengetahui hubunganantara variabel bebas dengan variabel terikat, yang dilakukan secara statistikdengan menggunakan uji Chi-Square pada tingkat kemaknaan 95%. (α = 0,05). HASIL Dari hasil analisa data diperoleh bahwa sebagian besar umur balitaberada pada umur 12 - 36 bulan. Hasil penelitian didapat, pendidikan ibu balitalebih banyak adalah tamat SMP yaitu sebanyak 58 orang (84.1 %) dari dan umuribu balita lebih banyak adalah ≤ median yaitu 39 tahun yaitu sebanyak 39 orang(56.5 %). Pendidikan ayah balita lebih banyak adalah tamat SMP yaitu sebanyak53 orang (76.8 %) dari dan pendapatan ayah balita lebih banyak adalah < 1 jutayaitu sebanyak 47 orang (68.1 %). PEMBAHASAN Tabel 1 menyajikan hubungan karakteristik balita dengan status gizi.Hubungan jenis kelamin balita dengan status gizi didapatkan proporsi balita gizikurang lebih banyak pada perempuan yaitu 68 orang (38.2 %) sedangkan proporsibalita gizi kurang lebih banyak pada perempuan yaitu 7 orang (21.9 %) dan 7orang (18.9%) pada laki-laki perempuan. Hasil uji statistik tidak terdapat hubunganyang bermakna antara jenis kelamin balita dengan status gizi (P value = 0.761).Menurut baku standar WHO-NCHS dalam Depkes (2002a ) jenis kelami jugamenpengaruhi ukuran tubuh anak dimana laki-laki lebih berat dan lebih tinggi dariperempuan pada umur yang sama dalam keadaan status gizi baik. Sehinggakebutuhan zat gizi laki-laki lebih tinggi dari pada perempuan karena perbedaaanluas tubuh dan aktifitasnya (Apriadji, 1986).Prosiding Seminar Nasional, 13-14 Desember 2010 1354
  • 168. ISBN 978-602-98295-0-1 Hubungan umur balita dengan status gizi didapatkan proporsi balitagizi kurang lebih banyak pada umur 37-60 bulan sebanyak 7 anak (23.3%),sedangkan proporsi balita gizi baik lebih banyak pada umur 7-36 bulan sebanyak11 anak (84.6 %). Hasil uji statistik tidak terdapat hubungan yang bermaknaantara umur balita dengan status gizi (P value = 0.699). Umur merupakan salahsatu faktor internal yang menentukan kebutuhan gizi seseorang, sehingga umurberkaitan erat dengan status gizi balita (Apriadji, 1986). Data dari studipertumbuhan anak dibeberapa negara berkembang menunjukkan bahwagangguan pertumbuhan mulai tampak pada umur 3 sampai 6 bulan pertama masabayi (Jus‘at, 1992). Hasil penelitian Jamil (1977) yang dikutip Lismartina (2000)menunjukkan bahwa pada umur di bawah 6 bulan kebanyakan bayi masih dalamkeadaan status gizi yang baik sedangkan pada golongan umur setelah 6 bulanjumlah balita yang berstatus gizi baik nampak dengan jelas menurun sampai 50%.Prevalensi KEP ditemukan pada usia balita dan puncaknya pada usia 1-2 tahun.Hal ini dikarenakan kebutuhan gizi pada usia tersebut meningkat tajam sedangkanASI sudah tidak mencukupi, selain itu makanan sapihan tidak diberikan dalamjumlah dan frekuensi yang cukup serta adanya penyakit diare karena konsumsipada makanan yang diberikan (Abunain, 1979 dalam Lismartina, 2000). Proporsi status gizi kurang pada balita lebih besar dijumpai pada anakdengan penyakit infeksi (22.2%) bila dibandingkan dengan anak dengan penyakitlainnya dan tidak sakit (18.2%). Ternyata hasil uji statistik menunjukkan tidakadanya hubungan yang bermakna (p = 0.677). Penyakit infeksi sangat eratkaitannya dengan status gizi yang rendah. Hal ini dapat dijelaskan melaluimekanisme pertahanan tubuh yaitu pada balita yang KEP terjadi kekuranganmasukan energi dan protein ke dalam tubuh sehingga kemapuan tubuh untukmembentuk protein baru berkurang, Hal ini kemudian menyebabkan pembentukankekebalan tubuh seluler terganggu, sehingga tubuh menderita rawan seranganinfeksi (Jeliffe, 1989). Beberapa penyakit infeksi yang sangat erat kaitannnyadengan kekurangan gizi pada anak salah satunya yaitu diare. Diare yang beratdan terjadi berulang-ulang akan menyebabkan seorang anak akan menderita KEPdan hal ini bisa berakibat terhadap tingginya hambatan pertumbuhan, tingginyamorbiditas dan mortalitas. KEP dengan diare merupakan hubungan dua arah yangmengarah pada status gizi yang semakin buruk (Depkes, 2000).Prosiding Seminar Nasional, 13-14 Desember 2010 1355
  • 169. ISBN 978-602-98295-0-1 Proporsi status gizi kurang pada balita lebih besar dijumpai anak dengan jumlah energi yang cukup (32.0% bila dibandingkan dengan anak dengan jumlah energi yang kurang (13,6%). Ternyata hasil uji statistik menunjukkan adanya hubungan yang bermakna (p < 0,05). Salah satu indikator untuk menunjukkan tingkat kesehatan penduduk adalah tingkat kecukupan gizi, yang lazim disajikan dalam energi dan protein (BPS, 2002). Energi dan protein mempunyai fungsi yang sangat luas dan penting dalam tubuh. Asupan energi yang seimbang sangat diperlukan pada berbagai tahap tumbuh kembang manusia, khususnya balita (Pudjiadi, 2000). Jika terjadi kekurangan konsumsi energi dalam waktu yang cukup lama maka akan berakibat pada terjadinya KEP (Sudiarti & Utari, 2007). Tabel 1 Hubungan Karakteristik Ibu Dengan Status Gizi (BB/U) Balita di Desa Senuro Timur Kecamatan Tanjung Batu OI Tahun 2010Variabel Status Gizi P CI Kurang Baik 95% n % n % Umur Balita 7 –36 bulan 2 15.4 11 84.6 0.699 0.57 37-60 bulan 7 23.3 23 76.7 (0.1-3.7) Jenis Kelamin Laki-laki 7 18.9 30 81.1 0.761 0.83 Perempuan 7 21.9 25 7801 (0.26-2.70) Penyakit Infeksi Ya 8 22.2 28 77.8 0.677 1.27 Tidak 6 18.2 27 81.8 (0.39-4.20) Konsumsi Energi Kurang 6 13.6 38 86.4 0.05 0.037 Cukup 8 32.0 17 68.0 (0.10-1.12) Prosiding Seminar Nasional, 13-14 Desember 2010 1356
  • 170. ISBN 978-602-98295-0-1 Tabel 2 Hubungan Karakteristik Ibu Dengan Status Gizi (BB/U) Balita di Desa Senuro Timur Kecamatan Tanjung Batu OI Tahun 2010Variabel Status Gizi P CI Kurang Baik 95% n % n % Umur Ibu ˃ median 4 13.3 25 86.7 0.208 0.45 ≤ median 10 25.6 29 70.4 (0.12- 1.60) Tingkat Pendidikan Rendah 0 0 3 100 0.367 - Tinggi 14 21.5 51 78.5Tingkat Pengetahuan Rendah 14 21.9 50 78.1 0.241 - Tinggi 0 0 5 100 Pekerjaan Bukan Petani 8 33.3 18 66.7 0.049 3.25 Petani 6 13.3 39 86.7 (0.97- 0.88) Proporsi status gizi kurang pada balita lebih besar dijumpai pada ibu dengan pendidikan tinggi (21.5%) bila dibandingkan dengan ibu yang berpendidikan rendah (12,4%). Ternyata hasil uji statistik menunjukkan tidak adanya hubungan yang bermakna (p > 0,05). Pendidikan merupakan proses pemberdayaan peserta didik sebagai subyek sekaligus objek dalam membangun kehidupan yang lebih baik. Pendidikan sangat berperan sebagai faktor kunci dalam meningkatkan sumber daya manusia. Indikator untuk tingkat pendidikan adalah jenjang pendidikan yang telah dicapai oleh penduduk usia 15 tahun keatas. Data SUSENAS tahun 2002 menyebutkan bahwa rata-rata tertinggi jenjang pendidikan yang dicapai oleh penduduk adalah di Provinsi DKI Jakarta rata-tata sampai kelas 1 SMU (BPS, 2002). Penelitian Sukmadewi (2003), menyatakan bahwa proporsi balita status gizi buruk lebih tinggi terjadi pada ibu dengan pendidikan ≤ 9 tahun. Hal ini didukung oleh penelitian yang dilakukan Alibbirwin (2001) yang mendapatkan hubungan yang bermakna antara pendidikan ibu dengan status KEP pada balita. Menurutnya ibu dengan pendidikan ≤ SMP berpeluang lebih tinggi terhadap terjadinya balita KEP dibandingkan ibu dengan pendidikan > SMP. Prosiding Seminar Nasional, 13-14 Desember 2010 1357
  • 171. ISBN 978-602-98295-0-1 Proporsi status gizi kurang pada balita bukan petani atau tidak bekerja lebih besar dijumpai pada ibu yang bekerja atau petani (33.3%) bila dibandingkan dengan ibu yang bekerja(13.3%). Ternyata hasil uji statistik menunjukkan adanya hubungan yang bermakna (p < 0,05). Menurut Harahap, dkk (1992) salah satu dampak negatif yang dikuatirkan timbul akibat dari keikutsertaan ibu dalam kegiatan diluar rumah adalah keterlantaran anak terutama balita. Bagi keluarga miskin, pekerjaan ibu diluar rumah menyebabkan anak dilalaikan. Dalam keluarga, wanita berperan sebagai pengasuh anak dan mengatur konsumsi pangan anggota keluarga, peranan wanita dalam usaha perbaikan gizi keluarga terutama untuk meningkatkan status gizi bayi dan anak sangatlah penting. Tabel 3 Hubungan Karakteristik Ayah Dengan Status Gizi (BB/U) Balita di Desa Senuro Timur Kecamatan Tanjung Batu OI Tahun 2010Variabel Status Gizi P CI Kurang Baik 95% n % n % Tingkat Pendidikan Rendah 0 0 4 100 0.299 - Tinggi 14 21.5 51 78.5 Pekerjaan Bukan Petani 6 27.3 16 72.7 0.324 1.83 Petani 8 17.0 39 83.0 (0.55- 6.12) Tingkat Pendapatan ˂ 1 juta 0 0 4 100 0.299 - ≥ 1 juta 14 21.5 51 78.5 Proporsi status gizi kurang pada balita lebih besar dijumpai pada ayah dengan pendidikan tinggi (21.5) bila dibandingkan dengan ayah yang pendidikan rendah (0%). Ternyata hasil uji statistik menunjukkan tidak adanya hubungan yang bermakna (p = 0,299). Syamsul (1999) dalam Tarigan (2003) menyatakan bahwa rendahnya tingkat pendidikan pada keluarga, memberikan suatu gambaran bahwa adanya keterbatasan sember daya manusia dalam mengakses pengetahuan khususnya di bidang kesehatan untuk menerapkan dalam kehidupan keluarga terutama pada pengasuhan anak balita. Faktor pendidikan turut pula menentukan Prosiding Seminar Nasional, 13-14 Desember 2010 1358
  • 172. ISBN 978-602-98295-0-1cara memahani pengetahuan gizi. Dari kepentingan gizi keluarga pendidikan amatperlu agar lebih tanggap terhadap adanya masalah gizi dalam keluarga dan bisamengambil tindakan secepatnya (Apriadji, 1986) Proporsi status gizi kurang pada balita lebih besar dijumpai pada keluargayang memiliki jumlah pendapatan yang tinggi (14,0%) bila dibandingkan dengankeluarga yang memiliki jumlah pendapatan yang rendah (0%). Ternyata hasil ujistatistik menunjukkan tidak adanya hubungan yang bermakna (p = 0,324). Proporsi status gizi kurang pada balita lebih besar dijumpai pada ayah yangbukan petani (27.3%) bila dibandingkan dengan ayah yang bekerja sebagai petani(170%) Ternyata hasil uji statistik menunjukkan tidak adanya hubungan yangbermakna (p < 0,05). Kemampuan keluarga untuk membeli bahan makanan antara laintergantung pada besar kecilnya pendapatan keluarga, harga bahan makananserta tingkat pengelolaan sumberdaya lahan dan pekarangan. Keluarga denganpendapatan terbatas, besar kemungkinan kurang dapat memenuhi kebutuhanmakanannya sejumlah yang diperlukan tubuh. Setidaknya keanekaragamanbahan makanan KESIMPULAN1. Sebagian besar anak mempunyai status gizi baik, yang mempunyai status gizi kurang hanya 20,3%. Sebagian besar anak berusia antara 12 – 36 bulan, anak paling banyak laki-laki (53,6%) dan anak yang menderita diare sebesar 30,4%.2. Tidak terdapat hubungan yang bermakna antara status gizi balita dengan jenis kelamin, umur dan penyakit infeksi yaitu masing-masing dengan P value = 0.761, 0.699 dan 0.677. Serta ada hubungan yang bermakna antara status gizi dengan kecukupan energi (p < 0,05).Prosiding Seminar Nasional, 13-14 Desember 2010 1359
  • 173. ISBN 978-602-98295-0-13. Tidak ada hubungan yang bermakna antara status gizi anak dengan tingkat pendidikan ibu (p > 0,05) tetapi ada hubungan yang bermakna antara status gizi anak dengan pekerjaan ibu (p < 0,05).4. Tidak adanya hubungan yang bermakna antara status gizi anak dengan tingkat pendidikan ayah (p = 0,299), antara status gizi anak dengan tingkat pendapatan ayah (p = 0,324) dan antara status gizi anak dengan pekerjaan ayah (p < 0,05). SARAN1. Meningkatkan kegaiatan promosi kepada masyarakat mengenai Perilaku Hidup Bersih dan Sehat (PHBS), sehingga penyakit infeksi bisa dihindari dan pola pemberian makanan dapat lebih baik2. Penelitian lebih lanjut dapat di teliti variable lain yang dapat menyebabkan status gizi balita, seperti pola asuh dan, pola pemberian ASI serta menentukan variable mana yang lebih berpengaruh DAFTAR PUSTAKAApriadji, Wied Harry. 1986, Gizi Keluarga , Penebar Swadaya , JakartaBiro Pusat Statistik. 2002, Indikator Kesejahteraan Rakyat , Biro Pusat Statistik, JakartaDepkes. 2000a, Makanan pendamping ASI (MP-ASI)., Depkes, JakartaDepkes. 2000. Rencana Aksi Pangan Dan Gizi Nasional. Depkes RI, Jakarta.Fitriah, Cholida. 2009, Pengetahuan Keluarga Tentang Pertumbuhan dan Perkembangan Balita di Lingkungan Amaliah Kelurahan Kuala SimpangProsiding Seminar Nasional, 13-14 Desember 2010 1360
  • 174. ISBN 978-602-98295-0-1 Kabupaten Aceh Tamiang, [online], dari : http://repository.usu.ac.id [23 Juli 2010]Harahap,Heryudarini,dkk. 1992, Pengasuhan dan Keadaan Gizi Anak dari Ibu yangBekerja DI DKI Jakatra , Puslitbang Gizi, BogorHidayat, Zainul. 2005, Faktor-faktor yang Mempengaruhi Status Gizi Balita di Indonesia, [online], dari : http://www.digilib.ui.ac.id [20 Juli 2010]Jus`at, Idrus. 1999, Determinan of Nutrition Status of PreSchool Children In Indonesia, An Analisis of the National Sicio Economy Survey (SUSENAS), (Disertasi). Cornel University, USA, 1999.Khoiri, Idah Fitri. 2009, Status Gizi Balita di Posyandu Kelurahan Padang Bulan Kecamatan Medan Baru, [online], dari : http://repository.usu.ac.id [20 Juli 2010]Jalan & Sumali. 1998. Repelita VII Untuk Mendukung Pengembangan SDM Yang Berkualitas. WKPG VI. LIPI, JakartaLismartina, 2000. Faktor-faktor Yang Berhubungan Dengan Terjadinya KEP Pada Anak Balita Di Kecamatan Tebet Walikotamadya Jakarta Selatan Tahun 2000. Skripsi, Fakultas Kesehatan Masyarakat Universitas Indonesia, DepokLubis, Ritayani. 2008, Hubungan Pola Asuh Ibu Dengan Status Gizi Anak Balita di Wilayah Kerja Puskesmas Pantai Cermin Kecamatan Tanjung Pura Kabupaten Langkat Tahun 2008, [online], dari : http://repository.usu.ac.id [20 Juli 2010]Mardiana. 2006, Hubungan Perilaku Gizi Ibu Dengan Status Gizi Balita di Puskesmas Tanjung Beringin Kecamatan Hinai Kabupaten Langkat Tahun 2005, [online], dari : http://repository.usu.ac.id [20 Juli 2010]Sarah, Mia. 2008, Hubungan Tingkat Sosial dan Pola Asuh Dengan Status Gizi Anak Balita di Wilayah Kerja Puskesmas Pantai Cermin Kecamatan Tanjung Pura Kabupaten Langkat Tahun 2008, [online], dari : http://repository.usu.ac.id [20 Juli 2010]Prosiding Seminar Nasional, 13-14 Desember 2010 1361
  • 175. ISBN 978-602-98295-0-1Sartika/, Dewi. 2009, Hubungan Pola Pemberian Makanan Dengan Status Gizi Pada Bayi Usia 0-11 Bulan di Kelurahan Indralaya Mulya Ogan Ilir Tahun 2009. [Skripsi]. Fakultas Kesehatan Masyarakat Universitas Sriwijaya, Indralaya.Sudiarti, T. & Diah M. Utari dalam Departemen gizi dan Kesehatan Masyarakat Fakultas Kesehatan Masyarakat Universitas Indonesia. 2007, Gizi dan Kesehatan Masyarakat, PT Rajagrafindo Persada, Jakarta.Tarigan. 2003, Faktor-faktor yang Berhubungan dengan Status Gizi Anak Umur 6- 36 Bulan dan Sebelum dan Saat Krisis Ekonomi di Wilayah Jawa Tengah,dalam Buletin Penelitian Kesehatan Vol.31, No 1, 2003 Sukmadewi, Sri. 2003. Faktor-faktor Yang Berhubungan Dengan Status Gizi Balita Di Wilayah Puskesmas Bogor Tengah Kota Bogor Tahun 2003. Skripsi, Fakultas Kesehatan Masyarakat Universitas Indonesia, DepokProsiding Seminar Nasional, 13-14 Desember 2010 1362

×