• Save
Composición Macromolecular de los Seres Vivos
Upcoming SlideShare
Loading in...5
×
 

Composición Macromolecular de los Seres Vivos

on

  • 6,623 views

Responde a nivel de organización "Macromolécula" a la pregunta ¿Cuál es la composición química de los seres vivos?

Responde a nivel de organización "Macromolécula" a la pregunta ¿Cuál es la composición química de los seres vivos?

Statistics

Views

Total Views
6,623
Views on SlideShare
5,241
Embed Views
1,382

Actions

Likes
3
Downloads
1
Comments
0

12 Embeds 1,382

http://biol1c201.blogspot.mx 1086
http://biol1c201.blogspot.com 200
http://www.biol1c201.blogspot.mx 35
http://biol1c201.blogspot.com.es 29
http://biol1c201.blogspot.com.ar 14
http://aulavirtual2.educa.madrid.org 8
http://biol1c201.blogspot.com.br 4
http://biol1c201.blogspot.it 2
http://biol1c201.blogspot.fr 1
http://biol1c201.blogspot.ro 1
http://biol1c201.blogspot.de 1
http://biol1c201.blogspot.ca 1
More...

Accessibility

Categories

Upload Details

Uploaded via as Microsoft PowerPoint

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

    Composición Macromolecular de los Seres Vivos Composición Macromolecular de los Seres Vivos Presentation Transcript

    • ¿Cuál es la composición química de los Seres Vivos? Tema 1.3 de Biología I Colegio de Bachilleres M. en C. Rafael Govea Villaseñor Nivel de Organización “Macromolécula” Versión 3.4
    • Podemos responder la pregunta a 3 niveles de Organización de la Materia M en C Rafael Govea Villaseñor
      • A nivel “Átomo”
      • A nivel “Molécula”
      • A nivel “Macromolécula”
    • Composición a nivel “MACROMOLÉCULA” M. En C. Rafael Govea Villaseñor Los Seres Vivos estamos hechos de cientos de miles de distintas moléculas de biopolímeros que forman parte estructural y funcional de nosotros Todas las macromoléculas son polímeros de pequeñas moléculas orgánicas unida una tras otra Clasificamos a los Biopolímeros de acuerdo a sus monómeros en: Heteropolímeros, cuando contienen >1 tipo de monómero Homopolímeros, cuando contienen sólo 1 tipo de monómero
    • ¿Cuáles son los principales Biopolímeros? M en C Rafael Govea Villaseñor Proteínas Heteropolímeros lineales de aminoácidos Polisacáridos Homo o heteropolímeros lineales o ramificados Ácidos Nucleicos Heteropolímeros simples o dobles de nucleótidos
    • Proteínas
      • Son cadenas de decenas a miles de aa
      • Las conforman 20 monómeros distintos:
      • Unidos por Enlaces Peptídicos
      M. En C. Rafael Govea Villaseñor -C - N- O H
    • Niveles Estructurales de las Proteínas M en C Rafael Govea Villaseñor Estructura primaria: Es la secuencia de aminoácidos en la cadena. Estructura secundaria: Es el doblado de la cadena de aminoácidos en hélices o láminas. Estructura Terciaria: Es la posición espacial de las estructuras secundarias unas respecto a otras Dominio: Es el plegado 3D independiente de una serie contigua de estructuras de 2º nivel de la cadena polipeptídica de las de otra porción de ésta. Estructura Cuaternaria: Es la asociación de varias cadenas polipeptídicas debidamente dobladas
    • Primer Nivel Estructural de las Proteínas M en C Rafael Govea Villaseñor Met -Lis-Asp-Pro-Leu-His-Tir-Gli-...-Gln-Cis-Fen- Val Extremo N-terminal Extremo C-terminal Estructura Primaria : Es la secuencia de 20 aminoácidos distintos en la cadena de decenas a miles de aa de longitud
    • Segundo Nivel Estructural de las Proteínas M en C Rafael Govea Villaseñor Hélice  Lámina  Estructura Secundaria : Es el doblado de la cadena de aminoácido en formas características estabilizadas por puentes de Hidrógeno formado por los átomos de los enlaces peptídicos: Puente de H -C - N- O H -C - N- O H
    • Tercer Nivel Estructural de las Proteínas M en C Rafael Govea Villaseñor 2 Hélices  horizontales Extremo N-terminal 8 Hélices  antiparalelas Puente disulfuro Estructura Terciaria : Es la orientación espacial recíproca de los distintos elementos de nivel secundario. La disposición 3D está estabilizada por puentes de H, puentes disulfuro -S-S-, enlace iónico e interacciones hidrofóbicas
    • Nivel Estructural Dominio de las Proteínas M en C Rafael Govea Villaseñor Dominio: Es el plegado 3D particular de un segmento de la cadena polipeptídica independiente del plegado en otra porción de la cadena. Los dominios otorgan propiedades biológicas especiales. Dominio Ig Presente en las proteínas que funcionan como anticuerpos Dominio SH2 Presente en las proteínas que funcionan en cascadas de señalización
    • Cuarto Nivel Estructural de las Proteínas M en C Rafael Govea Villaseñor Receptor de la acetilcolina (5 cadenas polipeptídicas) Proteasa de HIV-1 (2 cadenas) Estructura Cuaternaria : Es la asociación de varias cadenas polipeptídicas por complementaridad de sus superficies e interacciones débiles
    • Ejemplos de Proteínas M. En C. Rafael Govea Villaseñor ADN Hemoglobina
    • ¿Cuáles son las Funciones de las Proteínas?
      • Catalizadora (enzimática)
      • Transportadora
      • Acarreadora
      • Adhesiva
      • Mensajera
      • Motriz
      • Inhibidora
      • Activadora
      • Receptora
      • Identificadora y
      • Todas las demás
      TODAS M en C Rafael Govea Villaseñor
    • ¿Cuáles son las Funciones de las Proteínas? M en C Rafael Govea Villaseñor No existe proceso o función celular e incluso en el organismo pluricelular en la que NO HAYA UNA O VARIAS PROTEÍNAS funcionando como ejecutoras o asistentes
    • Ácidos Nucleicos
      • Son cadenas simples o dobles de decenas a miles de millones de nucleótidos
      • Los conforman 4 monómeros distintos:
        • GACU en el ARN
        • GACT en el ADN
      • Unidos por Enlaces Fosfodiéster
      • Hay 2 tipos: el ARN y El ADN
      M. En C. Rafael Govea Villaseñor O =P- O - O O 3’ 5’
    • Funciones de los Ácidos Nucleicos M en C Rafael Govea Villaseñor
      • Almacenar Información
        • A largo plazo, el ADN
        • A corto plazo, el ARN
      • Estructural. El ARNr  Ribosoma
      • Transporte. El ARNt lleva aminoácidos
      • Mensajero. El ARNm lleva el mensaje genético al ribosoma
      • Catalizador. Las Ribozimas
    • ¿Qué es el Ácido Ribonucleico (ARN)? M en C Rafael Govea Villaseñor Es un heteropolímero lineal de ribonucleótidos unidos por enlaces fosfodiester. Los nucleótidos tienen las bases nitrogenadas de G, A, C y U Estructura terciaria de un ARN de transferencia
    • Ejemplos de ARN M. En C. Rafael Govea Villaseñor ARN de la subunidad 30S del ribosoma Proteínas asociadas ARNt que transporta a la Fenilalanina a los ribosomas
    • ¿Cuáles son las Funciones del ARN? M en C Rafael Govea Villaseñor
      • Almacenar Información a corto plazo (ARNm)
      • Leer la información genética = transportar y transferir aminoácidos (ARNt)
      • Unir aminoácidos = formar enlaces peptídicos (ARNr)
      • Catalizar otras reacciones químicas
      • Regular la expresión genética
    • ¿Qué es el Ácido Desoxirribonucleico (ADN)? M en C Rafael Govea Villaseñor Es un heteropolímero lineal de 2 cadenas de desoxirribonucleótidos de G, A, C y T Los nucleótidos se unen por enlaces fosfodiéster y las cadenas por enlaces de puente de H entre pares de bases G  C y A=T
    • ADN, una doble hélice muy larga M en C Rafael Govea Villaseñor Mide desde centímetros hasta casi un metro
    • ADN, pero muy delgada 5' 5' 3' 3' Diapo 0052 Apenas 2 nm de ancho 10 pb = 3.43 nm Genoma humano 2(3 200 Mpb) = 2.20 m M en C Rafael Govea Villaseñor G A C T D P D P D P D P A G T C D P D P D P D P
    • Un ejemplo de ADN de 12 pb M. En C. Rafael Govea Villaseñor Cadena 5’ -> 3’ Pares de bases Cadena 3’  5’
    • ADN c atg ctgcagcagtcagtc taa ct gtacgacgtcgtcagtcagattga Cadena sentido Cadena antisentido 5’ 5’ 3’ 3’ M en C Rafael Govea Villaseñor
    • ¿Cuáles son las Funciones del ADN? M en C Rafael Govea Villaseñor
      • Almacenar Información genética a largo plazo (los genomas)
      • Contienen secuencias reguladoras que controlan la expresión de la información
      • El programa genético que controla el desarrollo del organismo está escrito como secuencias de pares de basesdel ADN
    • Código Genético ADN ARN ARNm Proteína Corte y empalme Traducción Réplicación M en C Rafael Govea Villaseñor Transcripción
    • Polisacáridos
      • Son cadenas simples o ramificadas de decenas a millones de monosacáridos
      • Los conforman ya 1 o varios monómeros distintos:
        • α y β -D-glucosa, Manosa, galactosa,
        • N-acetiglucosamina, ác. Siálico,…
      • Unidos por Enlaces Glucosídicos:
      M. En C. Rafael Govea Villaseñor -O- carbonos 1 α ó 1 β carbonos 3, 4 ó 5
    • Polisacáridos = azúcares complejos Son biopolímeros lineales o ramificados de monosacáridos M en C Rafael Govea Villaseñor
    • Funciones de los Polisacáridos M en C Rafael Govea Villaseñor
      • Estructural, forman las paredes celulares de…
        • Plantas, la celulosa
        • Hongos, la quitina
      • Energética. Almacenamiento a largo plazo, el almidón, el glucógeno…
      • Mensajero. Las células se reconocen por su cubierta de carbohidratos
    • FIN ADN circular bacteriano