• Save
El Virus De La Gripe
Upcoming SlideShare
Loading in...5
×
 

El Virus De La Gripe

on

  • 44,167 views

2ª Version de la presentación con datos actualizados, pero aún preliminar.

2ª Version de la presentación con datos actualizados, pero aún preliminar.

Statistics

Views

Total Views
44,167
Views on SlideShare
41,443
Embed Views
2,724

Actions

Likes
30
Downloads
0
Comments
2

34 Embeds 2,724

http://biol2c201.blogspot.com 1850
http://biol2c201.blogspot.mx 318
http://www.iweb34.com 134
http://bioangelferp.wordpress.com 133
http://www.slideshare.net 72
http://ecolc201.blogspot.com 39
http://celula1a404.blogspot.com 27
http://biol1c201.blogspot.com 25
http://biol2c201.blogspot.com.ar 18
http://ecolc201.blogspot.mx 16
http://celula1a404.blogspot.mx 11
http://biol2c201.blogspot.com.es 9
http://formacion.educa.madrid.org 9
http://nuevospowerpoints.blogspot.com 8
http://consultoriolaboratorio.blogspot.com 8
http://pollofritogonzalo.blogspot.com 7
http://biolokitos503.blogspot.com 6
http://ecolc201.blogspot.com.br 4
http://www.google.com.pe 4
http://pollofritogonzalo.blogspot.mx 3
http://celula1a404.blogspot.com.ar 3
http://biol1c201.blogspot.mx 3
http://nuevospowerpoints.blogspot.mx 3
http://biolokitos600.blogspot.com 3
http://nuevospowerpoints.blogspot.com.es 2
http://celula1a404.blogspot.com.es 1
http://celula1a404.blogspot.de 1
http://biol2c201.blogspot.com.br 1
http://www.google.com 1
http://www.google.com.mx 1
http://www.ecologia603601.blogspot.com 1
http://www.bacholandia.blogspot.com 1
http://www.biol1c201.blogspot.com 1
http://nuevospowerpoints.blogspot.com.ar 1
More...

Accessibility

Upload Details

Uploaded via as Microsoft PowerPoint

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
  • Hola! Me gustaría utilizar algunas de las imagenes que salen en esta presentación para una presentación que debo hacer para mi asignatura de Virología acerca del ciclo viral del virus de la gripe. ¿Podría decirme dónde puedo encontrarlas? (me refiero a los dibujos que esquematizan la entrada, multiplicación y salida del virus de la célula huésped). Muchas gracias.
    Cristina
    Are you sure you want to
    Your message goes here
    Processing…
  • Ya preparé una versíon corregida y aumentada de ésta presentación. Además le agregué audio.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

El Virus De La Gripe El Virus De La Gripe Presentation Transcript

  • El Virus de la Gripe y la Influenza M. en C. Rafael Govea Villaseñor CINVESTAV Versión 1.3
  • ¿Qué es la Influenza? Es una enfermedad respiratoria provocada por el Virus de la Gripe que afecta a aves y mamíferos, incluidos nosotros M. en C. Rafael Govea Villaseñor
  • ¿Qué es el Virus de la Gripe? Es un virus cu-bierto de membrana con genoma de ARN fragmentado en 8 cadenas (-) antisentido que codifica 10 genes y 11 proteínas M. en C. Rafael Govea Villaseñor
  • Virus de la Gripe Neuraminidasa N1, N2,… Hemaglutinina H1, H2 , H3… Proteína de Matriz M1 ARNv (8C, 10 genes, 11 proteínas) Proteína Canal M2 RNApol M. en C. Rafael Govea Villaseñor
  • ¿Cuántos Tipos hay de virus de la Gripe? 3 tipos De acuerdo a la antígenicidad de la nucleoproteína A C B Perteneciente a la Familia de Ortomixovirus Aves y humanos Humanos y Cerdos Humanos M. en C. Rafael Govea Villaseñor
  • ¿Cuáles mamíferos se enferman de gripe? Cerdos Equinos Cetáceos Leones marinos Humanos M. en C. Rafael Govea Villaseñor
  • ¿Cuáles aves se enferman de gripe? Patos, 36 Gansos, 8 Cisnes, 3 Gaviotas, 9 Golondrinas, 9 Aves lacustres, 10 Gallinetas, 3 Petreles, 5 Cormoranes, 1 M. en C. Rafael Govea Villaseñor
  • ¿Cuál Tipo de virus es más peligroso? El Virus tipo A es responsable de casos estacionales y las pandemias (epidemias globales) El Virus tipo B es responsable de brotes limitados a lo largo del año El Virus tipo C es responsable de casos leves M. en C. Rafael Govea Villaseñor
  • ¿Quién se enferma de gripe aviar? Criadores de aves de corral, vendedores de aves vivas, compradores Vía aérea y contacto con deyecciones No se contagia al comer pollos, pero se sugiere una buena cocción (cocinar a >70 ºC) M. en C. Rafael Govea Villaseñor
  • ¿Quién se enferma de gripe porcina? Criadores de cerdos, vendedores de cerdos vivos, compradores A través de la Vía aérea y contacto directo con cerdos No se contagia al comer cerdos, pero se sugiere una buena cocción (cocinar a >70 ºC) M. en C. Rafael Govea Villaseñor
  • ¿Quién se enferma de gripe humana? Personal médico, familiares, compañeros, amigos, pasajeros que respiren el aire de un enfermo que tosió o estornudó y no se tapó la boca con el brazo A través de la Vía aérea o contacto con gotitas de aerosol extendidas por las manos sobre objetos como pasamanos, manijas, bocinas, teclados, ratones, mesas, manos sucias, etc. M. en C. Rafael Govea Villaseñor
  • ¿Cómo se clasifica el virus de la Gripe A? Según las glicoproteínas de superficie: H y N H1, H2, … H16 N1, N2, … N9 M. en C. Rafael Govea Villaseñor
  • ¿Cuál es la Reserva del Virus de la Gripe? Las aves, cerdos, humanos, caballos, focas,… que se contagian con sus propias cepas gripales o de otra especie M. en C. Rafael Govea Villaseñor
  • Ciclo Vital del Virus, adhesión Primero el virus se pega a la membrana de las células mediante un molécula receptora normal M. en C. Rafael Govea Villaseñor
  • ¿Cuál es la molécula receptora sobre la Membrana Celular? Glucoproteína El Ácido siálico de diversas glucoproteínas 1 3 2 4 5 6 M. en C. Rafael Govea Villaseñor
  • Ciclo Vital del Virus, fagocitosis 1. Luego el virus es envuelto en una bolsa membranosa, el Fagosoma 2. Una bomba del fagosoma acidifica el interior 4.- La proteasa rompe a la hemaglutinina viral, activándola 3.- El medio ácido activa a una Proteasa Pulmonar M. en C. Rafael Govea Villaseñor
  • Ciclo Vital del Virus, fusión La proteína canal M2 deja entrar iones H + al virus y dispara la fusión de membranas mediante un cambio conformacional de la Hemaglutinina activada M. en C. Rafael Govea Villaseñor
  • Ciclo Vital del Virus, entrada del ARNv Citoplasma Luego, los 8 fragmentos de ARN viral migran hacia el núcleo celular donde ocurre su replicación y su transcripción M. en C. Rafael Govea Villaseñor
  • EXPRESION GENICA en nuestras células (C. Eucarióticas) ADN ARN (Transcrito primario) ARNm PROTEINA Como saben, normalmente la información guardada en el ADN se transcribe en ARN que se procesa en ARNm y luego se traduce para fabricar las proteínas que realizan las funciones celulares M. en C. Rafael Govea Villaseñor
  • Ciclo Vital del Virus, expresión La ARN polimerasa sintetiza miles de ARN mensajeros y la célula fabrica millones de copias de las 11 proteínas virales NS1 La ARN replicasa sintetiza miles de copias de los 8 fragmentos de ARN virales M. en C. Rafael Govea Villaseñor
  • ¿Cómo está conformado el ADN? Diapo 1152 M. en C. Rafael Govea Villaseñor Como recuerdan, el ADN está hecho de 2 cadenas complementarias y antiparalelas de nucleótidos. La cadena sentido (+) almacena la información (copia de respaldo) para elaborar el ARNm y la cadena antisentido (-) se usa para fabricar miles de copias del ARN mensajero… GCATGTACGTAGCTAGCTAAG CGTACATGCATCGATCGATTC 5' 5' 3' 3' CADENA "SENTIDO" CADENA "ANTISENTIDO" + -
  • SINTESIS DE ARN M. en C. Rafael Govea Villaseñor Como puede verse aquí abajo: Pero el virus de la gripe no tiene ADN, sino ARN (-) CGTACATGCATCGATCGATTC 5' GCATGTACGTAGCTAGCTAAG 5' 3' 3' GCAUGUACGUAGCUAGCUAAG 5' 3' CADENA "SENTIDO" ARN m + + -
  • Flujo de la Información Genética Viral ARNv (-) RNApol Miles de ARNm Ribosomas Proteínas Virales 3’ 5’ 3’ 5’ Replicasa Duplex Intermediarios 3’ 5’ 3’ 5’ ARNv (-) Replicasa M. en C. Rafael Govea Villaseñor Como los 8 fragmentos de ARN viral son cadenas (-) se usan directamen-te para hacer ARNm y los ribosomas elaboran las 11 proteínas virales. Y la replicación de los 8 ARNv se logra mediante un intermediario de ARN de doble cadena (duplex) que tiene un ARN (+) y luego sobre éste se fabrican las 8 cadenas virales (-)
  • Ciclo Vital del Virus, ensamble 1 Y la Neuraminidasa corta los ácidos Siálicos de las glucoproteínas celulares. Así los nuevos virus no se atascarán en la célula infectada y quedarán libres para afectar a otras miles M. en C. Rafael Govea Villaseñor Luego las proteínas virales H, N y M2 se insertan en la membrana celular
  • Ciclo Vital del Virus, ensamble final y gemación Los 8 fragmentos de ARN viral se encapsulan con la proteína de Matriz M1 y la Gemación ocurre cubriendo al virus de membrana celular robada M. en C. Rafael Govea Villaseñor
  • Filogenia del Virus de la Gripe M. en C. Rafael Govea Villaseñor La comparación de los genomas secuenciados de los virus de la gripe ha permitido conocer su historia evolutiva Humanos Aves americanas Cerdo americano Cerdo Euro-asiático
  • ¿Cómo surgen las nuevas cepas? Por Recombinación Virus aviar o porcino HxN1 Hiperpatógeno, pero incapaz de contagio de persona a persona Virus Humano H1N1 Capaz de contagio persona a persona Virus recombinante Hx N1 patógeno y capaz de pasar de una persona a otra
  • Origen de las cepas de Gripe Pandémicas M. en C. Rafael Govea Villaseñor Como el genoma del virus de la gripe está hecho de 8 fragmentos de ARN. Si hay infección simultánea de 2 cepas distintas, entonces se forman virus recombinados
  • Recombinación en Cerdos y Transmisión a humanos M. en C. Rafael Govea Villaseñor Los cerdos pueden infectarse simultáneamente con virus aviares, propios y humanos y allí recombinarse como en el nuevo virus AH1N1
  • Las infecciones con virus porcinos recombinados permiten su evolución M. en C. Rafael Govea Villaseñor Cada persona infectada con el virus recombinado, enferma pero no transmite en virus. El virus “muere” al fallecer el paciente o destruido por el sistema inmune al sanar , hasta que un virus muta y puede infectar a otra persona propagándose con éxito Transmisión eficiente
  • Pandemias más importantes Gripe española de 1918: AH1N1 (mortalidad del 2.5%, 40 millones) Gripe asiática de 1957: AH2N2 Gripe Hong Kong de 1968: AH3N2 Futura Gripe Aviar de 20??: AH5N1 (mortalidad de 72%) M. en C. Rafael Govea Villaseñor Nueva Gripe de 2009: AH1N1 Mortalidad de ¿0 a 7%?
  • Síntomas de la Gripe humana
    • fiebre (por lo general alta)
    • dolor de cabeza intenso
    • cansancio extremo
    • tos seca
    • dolor de garganta
    • Secreción o congestión nasal
    • dolores musculares o articulares
    M. en C. Rafael Govea Villaseñor También pueden presentarse síntomas estomacales, como náusea, vómito y diarrea, pero son más comunes en los niños que en los adultos Si se presentan 3 o más de éstos síntomas hay que ir a una clínica u hospital para evaluación médica
  • Complicaciones de la Gripe humana Neumonía bacteriana Deshidratación y el empeoramiento de enfermedades crónicas, tales como: la insuficiencia cardiaca congestiva el asma y la diabetes Los niños pueden contraer: sinusitis e infección de oídos. M. en C. Rafael Govea Villaseñor
  • Casos en humanos Neumonitis gripal 5 días después M. en C. Rafael Govea Villaseñor
  • Métodos de detección en pacientes M. en C. Rafael Govea Villaseñor
  • ¿El virus de la Gripe es un peligro para México? No en lo inmediato (antes de abril de 2009) Pero la evolución del Virus seguirá su curso La cuestión no es sí va a ocurrir o no, sino cuándo y dónde Ocurrió ahora, aquí en México y es de origen porcino
  • Países afectados México, USA, Canadá, España, Nueva Zelanda Y los que se acumulen en la semana Estamos en el inicio de una pandemia M. en C. Rafael Govea Villaseñor
  • ¿Hay Medicamentos eficaces vs VGH? Si Inhibidores de la Neuraminidasa: Oseltamivir (Tamiflu) y zanamivir (Ralenza) M. en C. Rafael Govea Villaseñor Pero no hay que automedicarse, pues dosis inadecuadas, no serán efectivas y provocarán la muerte del infectado y la evolución de virus resistentes
  • ¿Hay Medicamentos eficaces vs el virus de la gripe? Si Pero, el nuevo virus AH1N1 es resistente a la amantadina y la rimantidina M. en C. Rafael Govea Villaseñor Los medicamentos antigripales, que se venden sin receta, no contienen antivirales, sino una mezcla “engañadora” para reducir el dolor, la fiebre y los malestares. No curan
  • ¿Hay Vacunas eficaces vs el nuevo virus de la Gripe AH1N1? No Aún no se elabora y las vacunas existentes difícilmente ayudarán pues es un nuevo virus con proteínas H y N mutadas M. en C. Rafael Govea Villaseñor
  • ¿Qué podemos hacer? Como el virus de la gripe es un virus cubierto basta con agua y jabón o alcohol para eliminarlo M. en C. Rafael Govea Villaseñor Por eso hay que lavarse las manos con frecuencia y limpiar manijas, teclados, bocinas y todo lo que pueda ser tocado con manos contaminadas
  • ¿Qué podemos hacer? No escupir al suelo M. en C. Rafael Govea Villaseñor Pues si usamos las manos regaremos los virus por todos lados: manijas, ratones, teclados, pasamanos, bocinas, ojos, bocas y todo lo que pueda ser tocado con manos contaminadas Hay que taparse la boca al toser o estornudar con el brazo
  • ¿Qué podemos hacer? M. en C. Rafael Govea Villaseñor Lavarnos las manos muchas veces a lo largo del día
  • ¿Qué podemos hacer? M. en C. Rafael Govea Villaseñor No tocar los ojos, nariz y boca con las manos , a menos que estén recién lavadas o higienizadas con alcohol al 70% o en gel.
  • Hábitos Básicos de Higiene M. en C. Rafael Govea Villaseñor
  • Medidas preventivas si hay síntomas
    • Acudir a unidades médicas en cuanto se presenten síntomas compatibles con la influenza
    • Usar Tapa-bocas
    • No compartir cubiertos
    • Quedarse en casa durante la infección (u hospital) tomando los antivirales recetados
    • Cubrirse con el brazo al toser o estornudar
    • Lavarse las manos con frecuencia
    • Limpiar objetos como pasamanos, perillas, teclados
    M. en C. Rafael Govea Villaseñor
  • M. en C. Rafael Govea Villaseñor