Making biology easier to engineer - September 18, 2008

Making biology easier to engineer Reshma Shetty rshetty@ginkgobioworks.com

1976 • Bio-manufacturing • Therapeutics • Better crops • Bioremediation • Energy production

2006 • Bio-manufacturing • Therapeutics • Better crops • Bioremediation • Energy production

Engineering design cycle Design Testing Construction

Design cycle is slow in biology Design (unpredictable) Testing Construction (poor technology) (slow)

Standardization Reﬁnement Measurement Reuse

Standardization

BioBrick® standard parts EcoRI XbaI BioBrick part SpeI PstI Knight, 2003

BioBrick® standard assembly E X BioBrick part 1 S P E X BioBrick part 2 S P Digest with Digest with EcoRI and SpeI XbaI and PstI E X BioBrick part 1 S E X BioBrick part 2 S P Ligate E X BioBrick part 1 Mixed BioBrick part 2 S P

A AB B ABCD C CD D E EF F EFGH G GH H

Why use BioBrick® parts? To assemble multi-part systems

Vector assembly from parts E X 1 S P * * pSB4K5-I52002: BioBrick vector 4 K x7 Shetty et al., J Biol Eng, 2008

Multi-gene pathways Gene A Gene B Gene C

Reﬁnement

Two-population cell-cell signaling Output pathway Quorum- Sender Sensing System Sender Receiver 8 Receiver Output Input System Engineers 7 Device Engineers BBa_F2620 PoPS 6 3OC6HSL R0040 B0034 C0062 B0015 R0062 5 AHL luxP(R) LuxR GFP (LVA) 4 luxP(L) Device Engineers 3 Biologists LuxR LuxI LuxCDABE 2 1

LuxR LuxI LuxCDABE

Device Engineers Biologists

AHL luxP(R) LuxR GFP (LVA) luxP(L) Weiss & Knight, 2000

R0040 B0034 C0062 B0015 R0062 Canton et al., Nat Biotech, 2008

BBa_F2620 PoPS 3OC6HSL Canton et al., Nat Biotech, 2008

BBa_F2620 BBa_F2620 3OC6HSL PoPS Receiver Mechanism & Function Component Parts A transcription factor (LuxR) that is active in the presence of a cell-cell signaling molecule (3OC6HSL) is controlled by a regulated operator (PLtetO-1). Device input is 3OC6HSL. Device output is PoPS from a LuxR-regulated operator. If R0040 B0034 C0062 B0015 R0062 used in a cell containing TetR then a second input such as PLtetO-1 RBS luxR Term. Plux,R aTc can be used to produce a Boolean AND function. Static Performance* Dynamic Performance* http://parts.mit.edu/registry/index.php/Part:BBa_F2620 600 8 600 8 GFP synthesis rate (molecules cell−1 s−1) GFP synthesis rate (molecules cell−1 s−1) Population Mean Colony Range 7 + 3OC6HSL 7 500 Hill Equation 500 6 6 400 400 5 5 PoPS cell−1 PoPS cell−1 System 300 4 300 4 3 3 200 200 GFP synthesis rate (Low Input) 2 GFP synthesis rate (High Input) 2 100 100 Polynomial Fit (High Input) 1 PoPS (High Input) 1 Engineers 0 0 0 0 0E+00 1E−10 1E−09 1E−08 1E−07 1E−06 1E−05 1E−04 −10 0 10 20 30 40 50 [3OC6HSL] (M) Time (min) Pmax [3OC6HSL]n Pmax: 6.6 PoPS cell-1 BBa_F2620 Response Time: <1 min Pout = K: 1.5E-09 M 3OC6HSL BBa_T9002 Response Time: 6±1 min K n + [3OC6HSL]n n: 1.6 Inputs: 0 M (Low), 1E-07 M (High) 3OC6HSL Input Compatibility* Reliability** Device 600 8 C4HSL GFP synthesis rate (molecules cell−1 s−1) C6HSL 7 500 3OC6HSL 6 C7HSL 92 400 5 74 C8HSL gs PoPS cell−1 56 lin 3OC8HSL Engineers 300 4 38 92 ub 1E0 C10HSL Signaling Devices GFP 1E1 Do 20 (arb1E2 1E3 1E4 74 gs C12HSL 3 itrar 200 y un 56 lin its) ub 2 38 Low Input GFP1E0 1E1 Do (0 M 3OC6HSL) (arb 1E2 1E3 20 100 itrar 1 y un 1E4 its) High Input 0 0 (1E -7 M 3OC6HSL) 0E+00 1E−10 1E−09 1E−08 1E−07 1E−06 1E−05 1E−04 [AHL] (M) Genetic: >92/>56 culture doublings Part Compatibility (qualitative) Performance: >92/>56 culture doublings (low/high input during propagation) Chassis: MC4100, MG1655, and DH5 Plasmids: pSB3K3 and pSB1A2 Conditions (abridged) Devices: E0240, E0430 and E0434 Output: PoPS measured via BBa_E0240 Culture: Supplemented M9, 37ºC Transcriptional Output Demand (low/high input) Plasmid: pSB3K3 Nucleotides: 0 / 6xNt nucleotides cell-1 s-1 Chassis: MG1655 Polymerases: 0 / 1.5E-1xNt RNAP cell-1 *Equipment: PE Victor3 multi-well fluorimeter (Nt = downstream transcript length) **Equipment: BD FACScan cytometer Authors: Barry Canton Ania Labno Registry of Standard Biological Parts License: Public Updated: March 2008 making life better, one part at a time Canton et al., Nat Biotech, 2008

Two-population cell-cell signaling Output pathway Quorum- Sender Sensing System Sender Receiver Receiver Output Input

Two-population cell-cell signaling Output pathway Quorum- Sender Sensing System Sender Receiver 8 Receiver Output Input System Engineers 7 Device Engineers BBa_F2620 PoPS 6 3OC6HSL R0040 B0034 C0062 B0015 R0062 5 AHL luxP(R) LuxR GFP (LVA) 4 luxP(L) Device Engineers 3 Biologists LuxR LuxI LuxCDABE 2 1

Measurement

Standard unit: the Ohm

Promoter reference BBa_J23101 tttacagctagctcagtcctaggtattatgctagc

Measurement kit E X E0240 S P E. coli strain GFP reporter TOP10 pUC AmpR E X P1010 S P E X E0240 S P Medium copy Promoter reference BioBrick plasmid standard p15A KanR p15A KanR

Measurement kit instructions

Promoter strength in AU

Promoter strength in SPU

Promoter strength across laboratories MIT, Virginia Tech, Johns Hopkins, Berkeley, LBL, Harvard, Brown C.V.=0.113

Characterized promoter library

Lessons • Ad hoc reference standards are useful • Reference standards materials and instructions should be distributed • Standards enable comparison of parts • Standards help to identify sources of variability for part improvement

The host cell is a chassis System Replication Transcription Translation Degradation Cellular Chassis

A biological virtual machine System Virtual Machine Cellular Chassis

System is coupled to the chassis a Ribosomes RNA Polymerases Chassis gene Engineered System b Ribosomes O-ribosomes

Decouple system and chassis RNA Polymerases Chassis gene Engineered System b Ribosomes O-ribosomes T7 RNAP RNA Polymerases Chassis gene Engineered System

Orthogonal transcription and translation (VM1) O-ribosome generator O-ribosome generator O-ribosomes mutated rrnB rrnB mutated PBAD Arabinose T7 generator RBS T7 RNAP T lacUV5 IPTG T7 RNAP

GFP expression is speciﬁc 40E+4 VM1 + Reporter T7 RNAP + Reporter O-ribosomes + Reporter Fluorescence (Relative Units) VM1 30E+4 VM1 (Uninduced) 20E+4 10E+4 0 0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6 Cell Density (OD600)

VM1 consumes RNAP and ribosomes from the cell O-ribosome generator O-ribosome generator O-ribosomes mutated rrnB rrnB mutated PBAD Arabinose T7 generator RBS T7 RNAP T lacUV5 IPTG T7 RNAP

Auto-regulating T7 RNAP and O-ribosomes (VM2.0) O-ribosome generator O-ribosomes mutated rrnB T7lacM T7 autogenerator (BBa_I20257) O-RBS lacI O-RBS T7 RNAP T LacI T7lacM T7 RNAP

VM2.0 expresses GFP 1.2 Fluorescence/OD (Relative Units) 1 0.8 0.6 0.4 0.2 0 VM2.0 T7 RNAP O-ribosome VM2.0 + Generator + Generator + Reporter Reporter Reporter

VM2.0 requires a lacIQ strain O-ribosome generator O-ribosomes mutated rrnB T7lacM T7 autogenerator (BBa_I20257) O-RBS lacI O-RBS T7 RNAP T LacI T7lacM T7 RNAP

O-ribo Redesigned T7 autogenerator mutated rrnB T7lacM for increased lacI expression o-ribosome autogenerator (BBa_I20257) T7 generator o-ribo T7 autogenerator mutated rrnBO-RBS O-RBS lacI T7 RNAP T T7lacM (VM2.0) T7lacM T7 T7 autogenerator T7 autogenerator o-RBS T7 RNAP T o-RBS lacI T (VM2.2) T7lacM T7

VM2.2 works in E. coli TOP10 2.0E+4 VM2.2 + Reporter T7 RNAP Autogenerator + Reporter O-ribosome Generator + Reporter Fluorescence (Relative Units) 1.6E+4 Reporter VM2.2 1.2E+4 0.8E+4 0.4E+4 0E+4 0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6 1.8 Cell Density (OD600)

VM2.2 is less active than VM1 12E+4 12E+4 VM1.2 + Reporter VM2.2 + Reporter T7 RNAP + Reporter T7 RNAP Autogenerator + Reporter 10E+4 O-ribosomes + Reporter 10E+4 O-ribosome Generator + Reporter Fluorescence (Relative Units) Reporter Reporter VM1.2 VM2.2 8E+4 8E+4 6E+4 6E+4 4E+4 4E+4 2E+4 2E+4 0E+4 0E+4 0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6 1.8 0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6 1.8 Cell Density (OD600) Cell Density (OD600) O-ribosome generator o-ribosome generator O-ribosome generator O-ribosomes o-ribosomes mutated rrnB rrnB mutated mutated rrnB PBAD T7lacM Arabinose T7 autogenerator T7 generator LacI o-RBS T7 RNAP T o-RBS lacI T RBS T7 RNAP T T7lacM lacUV5 IPTG T7 RNAP T7 RNAP

Standardization Reﬁnement Measurement Reuse

Constructive synthetic biology Make it fun Make it safe Make it open

iGEM is a proof-of-concept

Thank you team@ginkgobioworks.com http://ginkgobioworks.com

Making biology easier to engineer - September 18, 2008

by ginkgobioworks on Sep 25, 2008

Accessibility

Categories

Tags

Upload Details

Usage Rights

1 Embed 1

Statistics

Making biology easier to engineer - September 18, 2008 — Presentation Transcript