Making biology easier to engineer - September 18, 2008

Loading...

Flash Player 9 (or above) is needed to view presentations.
We have detected that you do not have it on your computer. To install it, go here.

1 comments

Comments 1 - 1 of 1 previous next Post a comment

  • + guest8f39396 guest8f39396 8 months ago
    great job, guys! grad students at MIT totally rock!
Post a comment
Embed Video
Edit your comment Cancel

1 Favorite

Making biology easier to engineer - September 18, 2008 - Presentation Transcript

  1. Making biology easier to engineer Reshma Shetty rshetty@ginkgobioworks.com
  2. 1976 • Bio-manufacturing • Therapeutics • Better crops • Bioremediation • Energy production
  3. 2006 • Bio-manufacturing • Therapeutics • Better crops • Bioremediation • Energy production
  4. Engineering design cycle Design Testing Construction
  5. Design cycle is slow in biology Design (unpredictable) Testing Construction (poor technology) (slow)
  6. Standardization Refinement Measurement Reuse
  7. Standardization
  8. BioBrick® standard parts EcoRI XbaI BioBrick part SpeI PstI Knight, 2003
  9. BioBrick® standard assembly E X BioBrick part 1 S P E X BioBrick part 2 S P Digest with Digest with EcoRI and SpeI XbaI and PstI E X BioBrick part 1 S E X BioBrick part 2 S P Ligate E X BioBrick part 1 Mixed BioBrick part 2 S P
  10. A AB B ABCD C CD D E EF F EFGH G GH H
  11. Why use BioBrick® parts? To assemble multi-part systems
  12. Vector assembly from parts E X 1 S P * * pSB4K5-I52002: BioBrick vector 4 K x7 Shetty et al., J Biol Eng, 2008
  13. Multi-gene pathways Gene A Gene B Gene C
  14. Refinement
  15. Two-population cell-cell signaling Output pathway Quorum- Sender Sensing System Sender Receiver 8 Receiver Output Input System Engineers 7 Device Engineers BBa_F2620 PoPS 6 3OC6HSL R0040 B0034 C0062 B0015 R0062 5 AHL luxP(R) LuxR GFP (LVA) 4 luxP(L) Device Engineers 3 Biologists LuxR LuxI LuxCDABE 2 1
  16. LuxR LuxI LuxCDABE
  17. Device Engineers Biologists
  18. AHL luxP(R) LuxR GFP (LVA) luxP(L) Weiss & Knight, 2000
  19. R0040 B0034 C0062 B0015 R0062 Canton et al., Nat Biotech, 2008
  20. BBa_F2620 PoPS 3OC6HSL Canton et al., Nat Biotech, 2008
  21. BBa_F2620 BBa_F2620 3OC6HSL PoPS Receiver Mechanism & Function Component Parts A transcription factor (LuxR) that is active in the presence of a cell-cell signaling molecule (3OC6HSL) is controlled by a regulated operator (PLtetO-1). Device input is 3OC6HSL. Device output is PoPS from a LuxR-regulated operator. If R0040 B0034 C0062 B0015 R0062 used in a cell containing TetR then a second input such as PLtetO-1 RBS luxR Term. Plux,R aTc can be used to produce a Boolean AND function. Static Performance* Dynamic Performance* http://parts.mit.edu/registry/index.php/Part:BBa_F2620 600 8 600 8 GFP synthesis rate (molecules cell−1 s−1) GFP synthesis rate (molecules cell−1 s−1) Population Mean Colony Range 7 + 3OC6HSL 7 500 Hill Equation 500 6 6 400 400 5 5 PoPS cell−1 PoPS cell−1 System 300 4 300 4 3 3 200 200 GFP synthesis rate (Low Input) 2 GFP synthesis rate (High Input) 2 100 100 Polynomial Fit (High Input) 1 PoPS (High Input) 1 Engineers 0 0 0 0 0E+00 1E−10 1E−09 1E−08 1E−07 1E−06 1E−05 1E−04 −10 0 10 20 30 40 50 [3OC6HSL] (M) Time (min) Pmax [3OC6HSL]n Pmax: 6.6 PoPS cell-1 BBa_F2620 Response Time: <1 min Pout = K: 1.5E-09 M 3OC6HSL BBa_T9002 Response Time: 6±1 min K n + [3OC6HSL]n n: 1.6 Inputs: 0 M (Low), 1E-07 M (High) 3OC6HSL Input Compatibility* Reliability** Device 600 8 C4HSL GFP synthesis rate (molecules cell−1 s−1) C6HSL 7 500 3OC6HSL 6 C7HSL 92 400 5 74 C8HSL gs PoPS cell−1 56 lin 3OC8HSL Engineers 300 4 38 92 ub 1E0 C10HSL Signaling Devices GFP 1E1 Do 20 (arb1E2 1E3 1E4 74 gs C12HSL 3 itrar 200 y un 56 lin its) ub 2 38 Low Input GFP1E0 1E1 Do (0 M 3OC6HSL) (arb 1E2 1E3 20 100 itrar 1 y un 1E4 its) High Input 0 0 (1E -7 M 3OC6HSL) 0E+00 1E−10 1E−09 1E−08 1E−07 1E−06 1E−05 1E−04 [AHL] (M) Genetic: >92/>56 culture doublings Part Compatibility (qualitative) Performance: >92/>56 culture doublings (low/high input during propagation) Chassis: MC4100, MG1655, and DH5 Plasmids: pSB3K3 and pSB1A2 Conditions (abridged) Devices: E0240, E0430 and E0434 Output: PoPS measured via BBa_E0240 Culture: Supplemented M9, 37ºC Transcriptional Output Demand (low/high input) Plasmid: pSB3K3 Nucleotides: 0 / 6xNt nucleotides cell-1 s-1 Chassis: MG1655 Polymerases: 0 / 1.5E-1xNt RNAP cell-1 *Equipment: PE Victor3 multi-well fluorimeter (Nt = downstream transcript length) **Equipment: BD FACScan cytometer Authors: Barry Canton Ania Labno Registry of Standard Biological Parts License: Public Updated: March 2008 making life better, one part at a time Canton et al., Nat Biotech, 2008
  22. Two-population cell-cell signaling Output pathway Quorum- Sender Sensing System Sender Receiver Receiver Output Input
  23. Two-population cell-cell signaling Output pathway Quorum- Sender Sensing System Sender Receiver 8 Receiver Output Input System Engineers 7 Device Engineers BBa_F2620 PoPS 6 3OC6HSL R0040 B0034 C0062 B0015 R0062 5 AHL luxP(R) LuxR GFP (LVA) 4 luxP(L) Device Engineers 3 Biologists LuxR LuxI LuxCDABE 2 1
  24. Measurement
  25. Standard unit: the Ohm
  26. Promoter reference BBa_J23101 tttacagctagctcagtcctaggtattatgctagc
  27. Measurement kit E X E0240 S P E. coli strain GFP reporter TOP10 pUC AmpR E X P1010 S P E X E0240 S P Medium copy Promoter reference BioBrick plasmid standard p15A KanR p15A KanR
  28. Measurement kit instructions
  29. Promoter strength in AU
  30. Promoter strength in SPU
  31. Promoter strength across laboratories MIT, Virginia Tech, Johns Hopkins, Berkeley, LBL, Harvard, Brown C.V.=0.113
  32. Characterized promoter library
  33. Lessons • Ad hoc reference standards are useful • Reference standards materials and instructions should be distributed • Standards enable comparison of parts • Standards help to identify sources of variability for part improvement
  34. Reuse
  35. The host cell is a chassis System Replication Transcription Translation Degradation Cellular Chassis
  36. A biological virtual machine System Virtual Machine Cellular Chassis
  37. System is coupled to the chassis a Ribosomes RNA Polymerases Chassis gene Engineered System b Ribosomes O-ribosomes
  38. Decouple system and chassis RNA Polymerases Chassis gene Engineered System b Ribosomes O-ribosomes T7 RNAP RNA Polymerases Chassis gene Engineered System
  39. Orthogonal transcription and translation (VM1) O-ribosome generator O-ribosome generator O-ribosomes mutated rrnB rrnB mutated PBAD Arabinose T7 generator RBS T7 RNAP T lacUV5 IPTG T7 RNAP
  40. GFP expression is specific 40E+4 VM1 + Reporter T7 RNAP + Reporter O-ribosomes + Reporter Fluorescence (Relative Units) VM1 30E+4 VM1 (Uninduced) 20E+4 10E+4 0 0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6 Cell Density (OD600)
  41. VM1 consumes RNAP and ribosomes from the cell O-ribosome generator O-ribosome generator O-ribosomes mutated rrnB rrnB mutated PBAD Arabinose T7 generator RBS T7 RNAP T lacUV5 IPTG T7 RNAP
  42. Auto-regulating T7 RNAP and O-ribosomes (VM2.0) O-ribosome generator O-ribosomes mutated rrnB T7lacM T7 autogenerator (BBa_I20257) O-RBS lacI O-RBS T7 RNAP T LacI T7lacM T7 RNAP
  43. VM2.0 expresses GFP 1.2 Fluorescence/OD (Relative Units) 1 0.8 0.6 0.4 0.2 0 VM2.0 T7 RNAP O-ribosome VM2.0 + Generator + Generator + Reporter Reporter Reporter
  44. VM2.0 requires a lacIQ strain O-ribosome generator O-ribosomes mutated rrnB T7lacM T7 autogenerator (BBa_I20257) O-RBS lacI O-RBS T7 RNAP T LacI T7lacM T7 RNAP
  45. O-ribo Redesigned T7 autogenerator mutated rrnB T7lacM for increased lacI expression o-ribosome autogenerator (BBa_I20257) T7 generator o-ribo T7 autogenerator mutated rrnBO-RBS O-RBS lacI T7 RNAP T T7lacM (VM2.0) T7lacM T7 T7 autogenerator T7 autogenerator o-RBS T7 RNAP T o-RBS lacI T (VM2.2) T7lacM T7
  46. VM2.2 works in E. coli TOP10 2.0E+4 VM2.2 + Reporter T7 RNAP Autogenerator + Reporter O-ribosome Generator + Reporter Fluorescence (Relative Units) 1.6E+4 Reporter VM2.2 1.2E+4 0.8E+4 0.4E+4 0E+4 0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6 1.8 Cell Density (OD600)
  47. VM2.2 is less active than VM1 12E+4 12E+4 VM1.2 + Reporter VM2.2 + Reporter T7 RNAP + Reporter T7 RNAP Autogenerator + Reporter 10E+4 O-ribosomes + Reporter 10E+4 O-ribosome Generator + Reporter Fluorescence (Relative Units) Reporter Reporter VM1.2 VM2.2 8E+4 8E+4 6E+4 6E+4 4E+4 4E+4 2E+4 2E+4 0E+4 0E+4 0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6 1.8 0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6 1.8 Cell Density (OD600) Cell Density (OD600) O-ribosome generator o-ribosome generator O-ribosome generator O-ribosomes o-ribosomes mutated rrnB rrnB mutated mutated rrnB PBAD T7lacM Arabinose T7 autogenerator T7 generator LacI o-RBS T7 RNAP T o-RBS lacI T RBS T7 RNAP T T7lacM lacUV5 IPTG T7 RNAP T7 RNAP
  48. Standardization Refinement Measurement Reuse
  49. Constructive synthetic biology Make it fun Make it safe Make it open
  50. iGEM is a proof-of-concept
  51. Thank you team@ginkgobioworks.com http://ginkgobioworks.com

+ ginkgobioworksginkgobioworks, 2 years ago

custom

1086 views, 1 favs, 0 embeds more stats

Presentation given to NEB, Ipswich, MA

More info about this document

© All Rights Reserved

Go to text version

  • Total Views 1086
    • 1086 on SlideShare
    • 0 from embeds
  • Comments 1
  • Favorites 1
  • Downloads 13
Most viewed embeds

more

All embeds

less

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate. If needed, use the feedback form to let us know more details.

Cancel
File a copyright complaint
Having problems? Go to our helpdesk?

Categories