Making biology easier to
       engineer

           Reshma Shetty
    rshetty@ginkgobioworks.com
1976

• Bio-manufacturing
• Therapeutics
• Better crops
• Bioremediation
• Energy production
2006

• Bio-manufacturing
• Therapeutics
• Better crops
• Bioremediation
• Energy production
Engineering design cycle

          Design

Testing            Construction
Design cycle is slow in biology

                    Design
                (unpredictable)

  Testing                    ...
Standardization
  Refinement
 Measurement
    Reuse
Standardization
BioBrick®         standard parts


 EcoRI   XbaI   BioBrick part   SpeI   PstI




                                       ...
BioBrick®                       standard assembly
  E   X       BioBrick part 1       S    P           E   X        BioBri...
A
    AB
B
         ABCD
C
    CD
D

E
    EF
F
         EFGH
G
    GH
H
Why use   BioBrick®   parts?

To assemble multi-part systems
Vector assembly from parts
                E   X               1       S   P


            *                              ...
Multi-gene pathways


 Gene A   Gene B      Gene C
Refinement
Two-population
     cell-cell signaling Output
     pathway                                                 Quorum-
      ...
LuxR   LuxI   LuxCDABE
Device
Engineers
Biologists
AHL
                   luxP(R)
      LuxR                   GFP (LVA)

             luxP(L)




                          ...
R0040   B0034   C0062   B0015 R0062




                        Canton et al., Nat Biotech, 2008
BBa_F2620           PoPS
3OC6HSL




                  Canton et al., Nat Biotech, 2008
BBa_F2620                                                                                                                 ...
Two-population
cell-cell signaling Output
pathway                                 Quorum-
                             Sen...
Two-population
     cell-cell signaling Output
     pathway                                                 Quorum-
      ...
Measurement
Standard unit: the Ohm
Promoter reference


   BBa_J23101
   tttacagctagctcagtcctaggtattatgctagc
Measurement kit
E   X      E0240          S   P



                                             E. coli strain
    GFP rep...
Measurement kit instructions
Promoter strength in AU
Promoter strength in SPU
Promoter strength
                 across laboratories




MIT, Virginia Tech, Johns Hopkins, Berkeley, LBL, Harvard, Brow...
Characterized promoter library
Lessons

• Ad hoc reference standards are useful
• Reference standards materials and
  instructions should be distributed
...
Reuse
The host cell is a chassis

                        System




   Replication   Transcription Translation   Degradation


...
A biological virtual machine

            System
                     Virtual
                     Machine




           ...
System is coupled to the
                  chassis
a
                   Ribosomes




                   RNA Polymerases

...
Decouple system and chassis
                     RNA Polymerases

    Chassis gene                                     Eng...
Orthogonal transcription and
     translation (VM1)
                                O-ribosome generator
                 ...
GFP expression is specific
                                40E+4
                                             VM1 + Reporte...
VM1 consumes RNAP and
 ribosomes from the cell
                              O-ribosome generator
                        ...
Auto-regulating T7 RNAP and
   O-ribosomes (VM2.0)
                       O-ribosome generator
                           ...
VM2.0 expresses GFP
                                   1.2
Fluorescence/OD (Relative Units)




                          ...
VM2.0 requires a                              lacIQ          strain
                       O-ribosome generator
          ...
O-ribo

 Redesigned T7 autogenerator
                                 mutated rrnB
                   T7lacM



 for incre...
VM2.2 works in E. coli TOP10
                                 2.0E+4
                                            VM2.2 + R...
VM2.2 is less active than VM1
                          12E+4                                                             ...
Standardization
  Refinement
 Measurement
    Reuse
Constructive synthetic biology

         Make it fun
        Make it safe
        Make it open
iGEM is a proof-of-concept
Thank you


team@ginkgobioworks.com
http://ginkgobioworks.com
Making biology easier to engineer - September 18, 2008
Making biology easier to engineer - September 18, 2008
Making biology easier to engineer - September 18, 2008
Making biology easier to engineer - September 18, 2008
Making biology easier to engineer - September 18, 2008
Making biology easier to engineer - September 18, 2008
Making biology easier to engineer - September 18, 2008
Upcoming SlideShare
Loading in …5
×

Making biology easier to engineer - September 18, 2008

2,262 views

Published on

Presentation given to NEB, Ipswich, MA

Published in: Technology, Travel
0 Comments
1 Like
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total views
2,262
On SlideShare
0
From Embeds
0
Number of Embeds
8
Actions
Shares
0
Downloads
48
Comments
0
Likes
1
Embeds 0
No embeds

No notes for slide

Making biology easier to engineer - September 18, 2008

  1. 1. Making biology easier to engineer Reshma Shetty rshetty@ginkgobioworks.com
  2. 2. 1976 • Bio-manufacturing • Therapeutics • Better crops • Bioremediation • Energy production
  3. 3. 2006 • Bio-manufacturing • Therapeutics • Better crops • Bioremediation • Energy production
  4. 4. Engineering design cycle Design Testing Construction
  5. 5. Design cycle is slow in biology Design (unpredictable) Testing Construction (poor technology) (slow)
  6. 6. Standardization Refinement Measurement Reuse
  7. 7. Standardization
  8. 8. BioBrick® standard parts EcoRI XbaI BioBrick part SpeI PstI Knight, 2003
  9. 9. BioBrick® standard assembly E X BioBrick part 1 S P E X BioBrick part 2 S P Digest with Digest with EcoRI and SpeI XbaI and PstI E X BioBrick part 1 S E X BioBrick part 2 S P Ligate E X BioBrick part 1 Mixed BioBrick part 2 S P
  10. 10. A AB B ABCD C CD D E EF F EFGH G GH H
  11. 11. Why use BioBrick® parts? To assemble multi-part systems
  12. 12. Vector assembly from parts E X 1 S P * * pSB4K5-I52002: BioBrick vector 4 K x7 Shetty et al., J Biol Eng, 2008
  13. 13. Multi-gene pathways Gene A Gene B Gene C
  14. 14. Refinement
  15. 15. Two-population cell-cell signaling Output pathway Quorum- Sender Sensing System Sender Receiver 8 Receiver Output Input System Engineers 7 Device Engineers BBa_F2620 PoPS 6 3OC6HSL R0040 B0034 C0062 B0015 R0062 5 AHL luxP(R) LuxR GFP (LVA) 4 luxP(L) Device Engineers 3 Biologists LuxR LuxI LuxCDABE 2 1
  16. 16. LuxR LuxI LuxCDABE
  17. 17. Device Engineers Biologists
  18. 18. AHL luxP(R) LuxR GFP (LVA) luxP(L) Weiss & Knight, 2000
  19. 19. R0040 B0034 C0062 B0015 R0062 Canton et al., Nat Biotech, 2008
  20. 20. BBa_F2620 PoPS 3OC6HSL Canton et al., Nat Biotech, 2008
  21. 21. BBa_F2620 BBa_F2620 3OC6HSL PoPS Receiver Mechanism & Function Component Parts A transcription factor (LuxR) that is active in the presence of a cell-cell signaling molecule (3OC6HSL) is controlled by a regulated operator (PLtetO-1). Device input is 3OC6HSL. Device output is PoPS from a LuxR-regulated operator. If R0040 B0034 C0062 B0015 R0062 used in a cell containing TetR then a second input such as PLtetO-1 RBS luxR Term. Plux,R aTc can be used to produce a Boolean AND function. Static Performance* Dynamic Performance* http://parts.mit.edu/registry/index.php/Part:BBa_F2620 600 8 600 8 GFP synthesis rate (molecules cell−1 s−1) GFP synthesis rate (molecules cell−1 s−1) Population Mean Colony Range 7 + 3OC6HSL 7 500 Hill Equation 500 6 6 400 400 5 5 PoPS cell−1 PoPS cell−1 System 300 4 300 4 3 3 200 200 GFP synthesis rate (Low Input) 2 GFP synthesis rate (High Input) 2 100 100 Polynomial Fit (High Input) 1 PoPS (High Input) 1 Engineers 0 0 0 0 0E+00 1E−10 1E−09 1E−08 1E−07 1E−06 1E−05 1E−04 −10 0 10 20 30 40 50 [3OC6HSL] (M) Time (min) Pmax [3OC6HSL]n Pmax: 6.6 PoPS cell-1 BBa_F2620 Response Time: <1 min Pout = K: 1.5E-09 M 3OC6HSL BBa_T9002 Response Time: 6±1 min K n + [3OC6HSL]n n: 1.6 Inputs: 0 M (Low), 1E-07 M (High) 3OC6HSL Input Compatibility* Reliability** Device 600 8 C4HSL GFP synthesis rate (molecules cell−1 s−1) C6HSL 7 500 3OC6HSL 6 C7HSL 92 400 5 74 C8HSL gs PoPS cell−1 56 lin 3OC8HSL Engineers 300 4 38 92 ub 1E0 C10HSL Signaling Devices GFP 1E1 Do 20 (arb1E2 1E3 1E4 74 gs C12HSL 3 itrar 200 y un 56 lin its) ub 2 38 Low Input GFP1E0 1E1 Do (0 M 3OC6HSL) (arb 1E2 1E3 20 100 itrar 1 y un 1E4 its) High Input 0 0 (1E -7 M 3OC6HSL) 0E+00 1E−10 1E−09 1E−08 1E−07 1E−06 1E−05 1E−04 [AHL] (M) Genetic: >92/>56 culture doublings Part Compatibility (qualitative) Performance: >92/>56 culture doublings (low/high input during propagation) Chassis: MC4100, MG1655, and DH5 Plasmids: pSB3K3 and pSB1A2 Conditions (abridged) Devices: E0240, E0430 and E0434 Output: PoPS measured via BBa_E0240 Culture: Supplemented M9, 37ºC Transcriptional Output Demand (low/high input) Plasmid: pSB3K3 Nucleotides: 0 / 6xNt nucleotides cell-1 s-1 Chassis: MG1655 Polymerases: 0 / 1.5E-1xNt RNAP cell-1 *Equipment: PE Victor3 multi-well fluorimeter (Nt = downstream transcript length) **Equipment: BD FACScan cytometer Authors: Barry Canton Ania Labno Registry of Standard Biological Parts License: Public Updated: March 2008 making life better, one part at a time Canton et al., Nat Biotech, 2008
  22. 22. Two-population cell-cell signaling Output pathway Quorum- Sender Sensing System Sender Receiver Receiver Output Input
  23. 23. Two-population cell-cell signaling Output pathway Quorum- Sender Sensing System Sender Receiver 8 Receiver Output Input System Engineers 7 Device Engineers BBa_F2620 PoPS 6 3OC6HSL R0040 B0034 C0062 B0015 R0062 5 AHL luxP(R) LuxR GFP (LVA) 4 luxP(L) Device Engineers 3 Biologists LuxR LuxI LuxCDABE 2 1
  24. 24. Measurement
  25. 25. Standard unit: the Ohm
  26. 26. Promoter reference BBa_J23101 tttacagctagctcagtcctaggtattatgctagc
  27. 27. Measurement kit E X E0240 S P E. coli strain GFP reporter TOP10 pUC AmpR E X P1010 S P E X E0240 S P Medium copy Promoter reference BioBrick plasmid standard p15A KanR p15A KanR
  28. 28. Measurement kit instructions
  29. 29. Promoter strength in AU
  30. 30. Promoter strength in SPU
  31. 31. Promoter strength across laboratories MIT, Virginia Tech, Johns Hopkins, Berkeley, LBL, Harvard, Brown C.V.=0.113
  32. 32. Characterized promoter library
  33. 33. Lessons • Ad hoc reference standards are useful • Reference standards materials and instructions should be distributed • Standards enable comparison of parts • Standards help to identify sources of variability for part improvement
  34. 34. Reuse
  35. 35. The host cell is a chassis System Replication Transcription Translation Degradation Cellular Chassis
  36. 36. A biological virtual machine System Virtual Machine Cellular Chassis
  37. 37. System is coupled to the chassis a Ribosomes RNA Polymerases Chassis gene Engineered System b Ribosomes O-ribosomes
  38. 38. Decouple system and chassis RNA Polymerases Chassis gene Engineered System b Ribosomes O-ribosomes T7 RNAP RNA Polymerases Chassis gene Engineered System
  39. 39. Orthogonal transcription and translation (VM1) O-ribosome generator O-ribosome generator O-ribosomes mutated rrnB rrnB mutated PBAD Arabinose T7 generator RBS T7 RNAP T lacUV5 IPTG T7 RNAP
  40. 40. GFP expression is specific 40E+4 VM1 + Reporter T7 RNAP + Reporter O-ribosomes + Reporter Fluorescence (Relative Units) VM1 30E+4 VM1 (Uninduced) 20E+4 10E+4 0 0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6 Cell Density (OD600)
  41. 41. VM1 consumes RNAP and ribosomes from the cell O-ribosome generator O-ribosome generator O-ribosomes mutated rrnB rrnB mutated PBAD Arabinose T7 generator RBS T7 RNAP T lacUV5 IPTG T7 RNAP
  42. 42. Auto-regulating T7 RNAP and O-ribosomes (VM2.0) O-ribosome generator O-ribosomes mutated rrnB T7lacM T7 autogenerator (BBa_I20257) O-RBS lacI O-RBS T7 RNAP T LacI T7lacM T7 RNAP
  43. 43. VM2.0 expresses GFP 1.2 Fluorescence/OD (Relative Units) 1 0.8 0.6 0.4 0.2 0 VM2.0 T7 RNAP O-ribosome VM2.0 + Generator + Generator + Reporter Reporter Reporter
  44. 44. VM2.0 requires a lacIQ strain O-ribosome generator O-ribosomes mutated rrnB T7lacM T7 autogenerator (BBa_I20257) O-RBS lacI O-RBS T7 RNAP T LacI T7lacM T7 RNAP
  45. 45. O-ribo Redesigned T7 autogenerator mutated rrnB T7lacM for increased lacI expression o-ribosome autogenerator (BBa_I20257) T7 generator o-ribo T7 autogenerator mutated rrnBO-RBS O-RBS lacI T7 RNAP T T7lacM (VM2.0) T7lacM T7 T7 autogenerator T7 autogenerator o-RBS T7 RNAP T o-RBS lacI T (VM2.2) T7lacM T7
  46. 46. VM2.2 works in E. coli TOP10 2.0E+4 VM2.2 + Reporter T7 RNAP Autogenerator + Reporter O-ribosome Generator + Reporter Fluorescence (Relative Units) 1.6E+4 Reporter VM2.2 1.2E+4 0.8E+4 0.4E+4 0E+4 0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6 1.8 Cell Density (OD600)
  47. 47. VM2.2 is less active than VM1 12E+4 12E+4 VM1.2 + Reporter VM2.2 + Reporter T7 RNAP + Reporter T7 RNAP Autogenerator + Reporter 10E+4 O-ribosomes + Reporter 10E+4 O-ribosome Generator + Reporter Fluorescence (Relative Units) Reporter Reporter VM1.2 VM2.2 8E+4 8E+4 6E+4 6E+4 4E+4 4E+4 2E+4 2E+4 0E+4 0E+4 0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6 1.8 0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6 1.8 Cell Density (OD600) Cell Density (OD600) O-ribosome generator o-ribosome generator O-ribosome generator O-ribosomes o-ribosomes mutated rrnB rrnB mutated mutated rrnB PBAD T7lacM Arabinose T7 autogenerator T7 generator LacI o-RBS T7 RNAP T o-RBS lacI T RBS T7 RNAP T T7lacM lacUV5 IPTG T7 RNAP T7 RNAP
  48. 48. Standardization Refinement Measurement Reuse
  49. 49. Constructive synthetic biology Make it fun Make it safe Make it open
  50. 50. iGEM is a proof-of-concept
  51. 51. Thank you team@ginkgobioworks.com http://ginkgobioworks.com

×