• Like
  • Save
Genes e-ingenierc3ada-genc3a9tica
Upcoming SlideShare
Loading in...5
×

Genes e-ingenierc3ada-genc3a9tica

  • 170 views
Uploaded on

 

More in: Technology , Travel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Be the first to comment
    Be the first to like this
No Downloads

Views

Total Views
170
On Slideshare
0
From Embeds
0
Number of Embeds
0

Actions

Shares
Downloads
0
Comments
0
Likes
0

Embeds 0

No embeds

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
    No notes for slide

Transcript

  • 1. 1. ADN: el material de los genes
  • 2. Empaquetamiento del ADN en uncromosoma en mitosis
  • 3. Estructura de la molécula de ADN(“descubierta” en 1953 por Watson y Crik)• El ADN es una doble cadena de nucleótidos, paralelasy enrolladas en hélice.• Los nucleótidos están formados por:– Azúcar: desoxirribosa– Fósforo (P)– Base nitrogenada:• Adenina (A),• Timina (T),• Guanina (G)• Citosina (C)
  • 4. La doble cadena estaría unida por estas bases, de manera que la Ase une a la T y la C a la GAAATTATGCGTGCATTGACCTAAACCCAAATTTGACTTACTTTAATACGCACGTAACTGGATTTGGGTTTAAACTGAATGPor ejemplo:
  • 5. Funciones del ADN• Si el ADN es el material del que están hechoslos genes, esta molécula debe realizar lasfunciones que se le atribuyen a los genes:– Contener la información genética (o hereditaria)necesaria para realizar todas las funciones del servivo. Pero ¿cómo lleva la información una moléculade ADN?– Controlar la aparición de los caracteres o larealización de una función. Pero ¿cómo semanifiesta el carácter o se realiza la función?– Pasar la información de una célula a sus célulashijas durante el proceso de división celular. Pero¿cómo se copia esa información que se va arepartir?
  • 6. 2. El ADN contiene información• La información vendrá dada por el orden de losnucleótidos (de las bases nitrogenadas)• Pero esta información tiene que traducirse aproteínas, que hacen un trabajo determinado y daránun carácter determinado¿Cómo y dónde se hace esto?• El ADN no puede salir del núcleo por lo que la informaciónse copia en una molécula de ARNm (mensajero). Estáformada también por nucleótidos y la información estácopiada por complementariedad: A=U, T=A, CΞG, GΞC(está molécula no posee la timina y en su lugar tieneuracilo)AAATTATGCGTGCATTGACCTAAACCCAAATTTGACTTACTTTAATACGCACGTAACTGGATTTGGGTTTAAACTGAATGAAAUUAUGCGUGCAUUGACCUAAACCCAAAUUUGACUUAC (RNAm)• El ARNm sale al citoplasma y su información se lee ytraduce en los ribosomas (el proceso se llama traducción)
  • 7. Traducción de la información a proteínas• Pero las proteínas están formadas por unidadesllamadas aminoácidos. ¿Cómo se traduce un“lenguaje” de nucleótidos a uno de Aa?• La secuencia de nucleótido es leída en grupos detres. Cada 3 nucleótidos (triplete) corresponde a1 Aa y esa correspondencia se llama códigogenético.• Los ribosomas van identificando los tripletes yvan uniendo los Aa hasta formar las proteínas
  • 8. Código genéticoAUG CGU GCA UUG ACC UAA ACC CAA AUU CUU UGA AC (RNAm)Metionina- Arginina- Alanina-… -Treonina- …- Treonina- Glicina- Isoleucina-…- Stop (proteína)Terceraletra
  • 9. Síntesis de proteínas
  • 10. 3. La información contenida en el ADN se copia• Se abre la doble cadena y delante de cada una de ellasse colocan los nucleótidos complementarios.
  • 11. 4. Cambios en la información genética:mutaciones• Las mutaciones son errores en la copia del ADN,producidos:– Al azar– Inducidos por agentes mutagénicos:• Factores físicos: rayos X• Sustancias químicas: como sustancias que hay en el tabaco• Las mutaciones pueden afectar:– A 1 gen (génicas): es un error al copiar el ADN. Es lacausa de que aparezcan alelos diferentes para 1 gen(aumentan la diversidad)– A 1 cromosoma (cromosómicas): es un error alrepartirse los cromosomas en la mitosis o meiosis (másimportante porque forma células reproductoras)
  • 12. • Una mutación puede resultar:– Favorable: facilita la supervivencia y deja másdescendencia.– Neutra: ni beneficia ni perjudica la descendencia (peropermanece en la población)– Desfavorable: los individuos que la tienen presentanproblemas para sobrevivir• Si el medio cambia, lo que es desfavorable puedellegar a ser favorable (o viceversa). Por ej la anemiafalciforme en lugares donde hay malaria (y ver diapositiva siguiente)• Además de las mutaciones hay otra forma deaumentar la diversidad ¿Cuál?
  • 13. Ejemplo de variación del medio
  • 14. Resumiendo: la diversidad se produce porREPRODUCCIÓNIntercambio deinformaciónErrores en lacopia o repartoReproducción sexual MutacionesVariabilidad en la descendencia
  • 15. 5. La ingeniería genética• Conjunto de técnicas que permiten quitar, poner omodificar genes al ADN de un organismo con el fin decambiar su información. Los genes incorporadospueden ser de la misma especie o de otra diferente.• Si los organismos modificados genéticamente soneucariotas, se dice que son transgénico.• Si los organismos modificados son procariotas(bacterias) se les suele denominar organismosgenéticamente modificados (OGM)
  • 16. 4. Los Proyectos Genoma• Genoma es el conjunto de genes que posee un organismo.• El “proyecto genoma” pretende secuenciar el ADN de unaespecie e identificar los genes.• El “Proyecto Genoma Humano” (PGH) comenzó en 1990 y secompletó en abril de 2003, pero se continúa con él porque, seconoce la secuencia de nucleótidos pero se pretende interpretarla información hasta conocer la posición de los genes y sufunción.• Características del genoma humano:– Contiene unos 3200 millones de pares de bases– Solo el 2% pertenece a genes con información para fabricarproteínas (proteoma: conjunto de proteínas codificadas por ungenoma). Contiene unos 25.000 genes pero se desconoce la funciónde casi la mitad de ellos– Es casi igual para todos los seres humanos. Solo nos diferencia el0,1%– Casi la mitad de las proteínas humanas son muy semejantes a las deotros seres vivos.• Así, además de la genómica se ha iniciado una etapa proteómica oProyecto Proteoma.
  • 17. 5¿Cómo se modifica el ADN de un organismo?
  • 18. APLICACIONES DE LAINGENIERÍA GENÉTICA
  • 19. • Obtención de proteínas de interés médico, comercial,etc… (insulina, hormona del crecimiento, factores de coagulación)• Obtención de vacunas recombinantes (aternativa al uso deorganismos patógenos inactivos)• Diagnóstico de enfermedades de origen genético• Tratamiento de enfermedades de origen génico:Terapia génica• …..
  • 20. Terapia génica• Estrategias Terapéuticas: enviar una información aun grupo de células del organismo puede hacerse dedos formas distintas– Inyectando directamente el vector en el paciente (estrategiain vivo-dentro del cuerpo)– Inyectando el gen en células sanas del paciente que se hanextraído antes mediante una biopsia (estrategia ex vivo-fuera del cuerpo).• ¿Qué tipo de células pueden emplearse en laterapia génica? Se pueden emplear dos tipos :– Células del propio paciente: estas células se modifican en ellaboratorio, antes de re-inyectarlas.– Células Madre: Células con gran capacidad de multiplicarse yque pueden generar cualquier tipo de célula de un organismoadulto. Estas células pueden extraerse del propio paciente oproceder de cultivos mantenidos en el laboratorio.
  • 21. Plantas transgénicastumorescélulavegetalProliferación dehormonascrecimiento. Seforman tumores enlas zonas de lalesiónPlásmido TinúcleocromosomacromosomaAgrobacteriuminductor de tumorescontiene oncogenes(genes onc)Ingenierogenéticonatural trassutitución degenes onc porgenes deinterésTransgénesis= introducción deADN extraño en un genoma, demodo que se mantenga estable deforma hereditaria y afecte atodas las células en los organismosmulticelulares.Vector: Se usa el plásmido de la bacteria Agrobacteriumtumefaciens, que es patógena de plantas. Produce tumores
  • 22. Resistencia a herbicidas, insectos y enfermedades microbianasEl maíz transgénico de Novartis es resistente al herbicida Basta y también esresistente al gusano barrenador europeo (contiene el Gen de resistencia a latoxina Bt de Bacillus thuringiensis) produce su propio insecticidaProblemas:La toxina Bt en las plantas transgénicas tiene propiedadessustancialmente diferentes a la toxina Bt en su forma natural.La toxina puede ser transmitida a través de la cadena alimenticia, unefecto que nunca ha sido observado en la toxina Bt en su forma natural.Larvas de especies de insectos predadores benéficos (larvas verdes decrisopa) murieron cuando fueron alimentadas con el gusano barrenadoreuropeo•Mejora de la calidad de los productos agrícolasARROZ con enzima lactoferrina de leche humana, que puede serutilizada para mejorar las fórmulas de leche infantil. Los niños lanecesitan para usar eficientemente el hierro y pelear contra lasinfecciones (Pearson, H. Nature, 26 april 2002).Gold rice de Monsanto con beta caroteno de genes de narciso,pigmentos que se transforman en pro-vitamina A al ser ingeridos•Síntesis de productos de interés comercialAnticuerpos animales, interferón, e incluso elementos de un poliésterdestinado a la fabricación de plásticos biodegradables
  • 23. Clonación de animales confunción reproductora(TRANSFERENCIA NUCLEAR DE CÉLULAS EMBRIONARIAS)
  • 24. Salmón transgénico porhormona de crecimiento.Producido por AF Protein Inc. Cuenta con el promotor de laproteína de anticongelamiento de otra especie de pez. Crecede 4 a 6 veces más rápido que un salmón no transgénico.Tiene un 20% en mejoramiento de la eficiencia de conversióndel alimento.Ingeniería Genética:NUEVOS ALIMENTOS(ISB, 2001, oct; Netlink, 2000).(Hoag, H. Nature, 27 enero 2003).VACAS LECHERAS con incremento deproteínas. En Nueva Zelanda se clonaronvacas con óvulos mejorados genéticamente,para mejorar la producción del queso y crema,aumentando dos veces la kappa caseína,crucial para hacer la cuajada y de 20% más debeta caseina, que mejora la acción del cuajo
  • 25. Terneros clonados y manipulados genéticamente (fábrica de anticuerpos humanos)genes para anticuerpos células dérmicas clonaciónhumanos recombinantesObjetivo: Tratamiento de enfermedades inmunológicasFuturo: Tratamiento de una amplia gama de enfermedades ocasionadas porbacterias y virus, como hepatitis, ántrax (utilizada como arma biológica)Clonan terneros en EE UU para producir anticuerposhumanosefe- Washington - agosto 2002
  • 26. Clonan cerdos destinados a trasplantar sus órganos ahumanosLa empresa escocesa PPL Therapeutics lograretirar de los cerditos el gen que provoca elrechazo en transplantes a humanos "alfa 1,3galactosil transferasa"Enero 2002. AP Photo/Roanoke Times, Gene Dalton (IDEAL-EFE)Paso importante en favor del xenotrasplante (transferencia de células uórganos de una especie a otra)Ayudará a superar la escasez de órganos humanos para hacer trasplantes detodo tipo
  • 27. Declaración Universal de Derecho Humanos y Genoma Humano de la UNESCO (1997),adoptada en 1998 por la Asamblea General de ONU (busca un balance entre unacontinuación en las investigaciones y la salvaguarda de los derechos humanos)Frente a los múltiples beneficios de la ingeniería genética pueden surgiralgunos problemas:•Problemas sanitarios nuevos microorganismos patógenos, efectos secundariosde nuevos fármacos de diseño, etc...•Problemas ecológicos desaparición de especies con consecuencias desconocidas,nuevos contaminaciones, etc...•Problemas sociales y políticos• Pueden crear diferencias aún más grandes entre países ricos y pobres (en el campo de laproducción industrial, agrícola y ganadera),• El sondeo génico en personas puede llevar a consecuencias nefastas en la contratación laboral, porejemplo, y atenta contra la intimidad a que tiene derecho toda persona (empleo, agencias deseguros, discriminación..).•Problemas éticos y morales
  • 28. Beneficios médicos tras el conocimiento de laestructura de cada gen humano1. Diagnóstico en individuos con riesgo de serportadores del gen de alguna enfermedad2. Marco de trabajo para el desarrollo denuevas terapias, además de nuevasestrategias para la terapia génica16 de Febrero de 200116 de Febrero de 2001Celera GenomicsCelera Genomics15 de Febrero de 200115 de Febrero de 2001Consorcio público internacionalConsorcio público internacionalProyecto genoma humanoProyecto genoma humanoLa secuencia del genoma es un atajo valioso: ayuda a loscientíficos a encontrar los genes más fácil y rápidamentey sienta las bases para averiguar la función de los genesidentificados
  • 29. DUDAS• ¿SI FUERA POSIBLE, A USTED LE GUSTARÍAHACERSE UN TEST GENÉTICO QUE LEDIJERA LAS ENFERMEDADES QUE SUFRIRÍAEN SU VIDA?
  • 30. • Reemplazar genesdefectuosos parasanar no escontroversia, pero...¿introducir genes engente saludable paraser más inteligente otransformarla enatleta, será ético?
  • 31. PERO:¿CUÁNTO PODEMOSAVANZAR?
  • 32. ETICA• Algunas aplicacionesparecen claramenteno éticas (armasbiológicas).• ...y muchas preguntasno tiene unarespuesta clara.
  • 33. PERO, al menos…Un públicoinformado es lamejor proteccióncontraaplicaciones noéticas o abusosdel conocimientobiológico.