02b rvi2, rvi4, rvi11 snp markers and surprises-m. jänsch-20130221

668 views
429 views

Published on

0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
668
On SlideShare
0
From Embeds
0
Number of Embeds
2
Actions
Shares
0
Downloads
3
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

02b rvi2, rvi4, rvi11 snp markers and surprises-m. jänsch-20130221

  1. 1. Rvi2, Rvi4, Rvi11: SNP markers and surprises Melanie Jänsch, Juliane Weger, Giovanni Broggini, Vincent Bus, Sue Gardiner, Heather Bassett and Andrea Patocchi
  2. 2. Objectives 1. Identification of 5 single nucleotide polymorphisms (SNPs) within an interval of 1 cM 2. Check for level of polymorphism of SNPs in 8 founders 3. Focus of this talk: apple scab resistance genes Rvi 11 (Vbj), Rvi 2 (Vh2) and Rvi 4 (Vh4) (Bus et al., 2011)
  3. 3. repeat Method – SNP development or reject region BLAST available flanking markers on GD sequence Primer Design + PCR SEQ and SNP analysis SNP found SNP confirmation of map position with subset of resistant , susceptible and recombinant individuals closest to the gene SNP polymorphism test with 8 founders SNP identified and validated ok ok ok ok reject region reject region
  4. 4. SNP polymorphism example - Rvi4 (Vh4) 250 260 270 280 290 300 310 320 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| 2249_TNL1 CGTGTTTCTGAAATGCTTCAGCTAAATCTCCGTCCTGCTTCCTGACATGCGAAGGATCAACGTGATAGAATATTGGCAMA Gala_TNL1 CGTGTTTATGAAATGCTTCGGCAAAATCTCCGTCCTGCTTCCTGATATGCGAAGGATCAACGTGATAGAATATTGGCAAA Braeburn_TNL1 CGTGTTTCTGAAATGCTTCGGCTAAATCTCCGTTCTGCTTCCTGATATGCGAAGGATCAACGTGATAGAATATTGGCAAA Cox_TNL1 CGTGTTTCTGAAATGCTTCGGCTAAATCTCCGTTCTGCTTCCTGATATGCGAAGGATCAACGTGATAGAATATTGGCAAA Delicious_TNL1 CGTGTTTCTGAAATGCTTCGGCTAAATCTCCGTTCTGCTTCCTGATATGCGAAGGATCAACGTGATAGAATATTGGCAAA F2_TNL1 CGTGTTTCTGAAATGCTTCGGCTAAATCTCCGTTCTGCTTCCTGATATGCGAAGGATCAACGTGATAGAATATTGGCAAA Golden_TNL1 CGTGTTTATGAAATGCTTCGGCAAAATCTCCGTCCTGCTTCTTGACATGCGAAGGATCAACGTGATAGAATATTGGCAAA Granny_TNL1 CGTGTTTCTGAAATGCTTCGGCTAAATCTCCGTTCTGCTTCCTGATATGCGAAGGATCAACGTGATAGAATATTGGCAAA Jonathan_TNL1 CGTGTTCCCGAAATGCTTCAGCTAAATCTCCGTTCTGATTCCTGACATGCGAAGGATCAACGTGATAGAATATTGGCAAA McIntosh_TNL1 CGTGTTTCTGAAATGCTTCGGCTAAATCTCCGTTCTGCTTCCTGATATGCGAAGGATCAACGTGATAGAATATTGGCAAA 330 340 350 360 370 380 390 400 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| 2249_TNL1 ACATG---CCCCAGTTTGCCTCTGCACTCCATGATCTTCACCAGCTCGTCAAGACACCAACTCGAATCCGCATACCTCCT Gala_TNL1 ACATGTCGCTCCAGTTTGTCTCTGCACTCCATGATCTTCACCAGCTCGTCAAGACACCAACTCGAATCCGCATACATCTT Braeburn_TNL1 ACATGTCGCCCCAGTTTGTCTCTGCACTCCATGATCTTCACCAGCTCGTCAAGACACCAACTCGAATCCGCATACATCTT Cox_TNL1 ACATGTCGCCCCAGTTTGTCTCTGCACTCCATGATCTTCACCAGCTCGTCAAGACACCAACTCGAATCCGCATACATCTT Delicious_TNL1 ACATGTCGCCCCAGTTTGTCTCTGCACTCCATGATCTTCACCAGCTCGTCAAGACACCAACTCGAATCCGCATACATCTT F2_TNL1 ACATGTCGCCCCAGTTTGTCTCTGCACTCCATGATCTTCACCAGCTCGTCAAGACACCAACTCGAATCCGCATACATCTT Golden_TNL1 ACATGTCGCTCCAGTTTGTCTCTGCACTCCATGATCTTCACCAGCTCGTCAAGACACCAACTCGAATCCGCATACATCTT Granny_TNL1 ACATGTCGCCCCAGTTTGTCTCTGCACTCCATGATCTTCACCAGCTCGTCAAGACACCAACTCGAATCCGCATACATCTT Jonathan_TNL1 ACATGTCGCCCCAGTTTGTCTCTGCACTCCATGATCTTCACCAGCTCGTCAAGACACCAACTCGAATCCGCATACATCTT McIntosh_TNL1 ACATGTCGCCCCAGTTTGTCTCTGCACTCCATGATCTTCACCAGCTCGTCAAGACACCAACTCGAATCCGCATACATCTT Parents and 8 founders included 2nd choice SNPs 1st choice SNPs
  5. 5. FVbj3 Z13_SCAR CH02c06 SNP_region_20(8) B8 CH05e03 Rvi11 SNP_region_34(9) CH03d01 0.1 0.1 2.0 0.7 0.7 0.8 3.8 Rvi11 Rvi11 (Vbj) • Plant material: GD x A722-7, 145 plants • 55 regions tested • In 2 regions SNPs identified • Vbj SNPs mapped between 0.7 and 3 cM • 17 SNPs found in total (Gygax et al., 2004)
  6. 6. Rvi2 (Vh2) • Plant material: GD x X2250, 146 plants • 44 regions tested • In 8 regions SNPs identified • Vh2 SNPs mapped between 0.7 and 2.8 cM • 61 SNPS found in total (Bus et al., 2005) CH02b10 CH2-Z13SCAR SNP_region_53(8) SNP_region_41(1) CH05e03 SNP_region_20.4(1) CH-Vbj2 SNP_region_21(15) SNP_region_23(5) Rvi2 SNP_region_27(21) L19SCAR SNP_region_34.3(6) SNP_region_36(4) CH03d01 0.7 0.7 0.7 0.7 1.4 Rvi2
  7. 7. Rvi4 (Vh4) Hi22d06 SNP_region_TNL1(20) SNP_region_3(2) SNP_region_10(1) SNP_region_Vr2_3(3) Rvi4 SNP_region_ARGH37(1) CH02c02a Hi02a07 SCAR-S22 2.1 0.4 1.3 Rvi4 • Plant material: Gala x X2249, 242 plants • 30 regions tested • In 5 regions SNPs identified • Vh4 SNPs mapped at 0 cM • 27 SNPs found in total (Bus et al., 2005)
  8. 8. Rvi2 vs. Rvi11 CH02b10 Z13_SCAR SNP_region_53(8) SNP_region_41(1) CH05e03 SNP_region_20(1) CH-Vbj2 SNP_region_21(15) SNP_region_23(5) Rvi2 SNP_region_27(21) L19SCAR SNP_region_34(6) SNP_region_36(4) CH03d01 0.7 0.7 0.7 0.7 1.4 Rvi2 Z13_SCAR CH02c06 SNP_region_20(8) B8 CH05e03 Rvi11 SNP_region_34(9) FVbj3 CH03d01 0.1 0.1 2.0 0.7 0.7 0.8 3.8 Rvi11 • Indication that Rvi2 and Rvi11 may derive from the same region • Allelic? • Phenotype of the two genes is similar (SC vs. SN) • Difference due to difference level of enhancement of the resistance cascade? (Bus et al., 2011)
  9. 9. Rvi4 vs. Rvi15 • Indication that Rvi4 and Rvi15 may derive from the same region • Allelic? • Phenotype of the two genes is the same (PPP) • Rvi4 symptoms visible after 3-4 days, Rvi15 after 7 days • Difference due to difference level of enhancement of the resistance cascade? 005 Hi22d06 SNP_region_TNL1(20) SNP_region_3(2) SNP_region_10(1) SNP_region_Vr2_3(3) Rvi4 SNP_region_ARGH37(1) CH02c02a Hi02a07 S22_SCAR 2.1 0.4 1.3 Rvi4 CH02f06 ARGH37 Rvi15 ARGH17 CH02c02a 2.9 1.2 0.3 1.7 Rvi15 (Bus et al., 2011)
  10. 10. Conclusion • SNP markers for resistance genes most used in breeding will be soon available. • This will simplify marker assisted selection (MAS) and will allow a reduction of its costs . • The precise mapping of the genes increases the precision of MAS and indicates the possible allelism of: – Rvi2 and Rvi11 – Rvi4 and Rvi15

×