02a wp1 progresses&results-20130221
Upcoming SlideShare
Loading in...5
×
 

02a wp1 progresses&results-20130221

on

  • 192 views

 

Statistics

Views

Total Views
192
Views on SlideShare
138
Embed Views
54

Actions

Likes
0
Downloads
0
Comments
0

1 Embed 54

http://www.fruitbreedomics.com 54

Accessibility

Categories

Upload Details

Uploaded via as Adobe PDF

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

02a wp1 progresses&results-20130221 02a wp1 progresses&results-20130221 Presentation Transcript

  • WP1 Results achieved since the beginning of the project and plans for 2013
  • The general objective of WP1 … is to develop more efficient breeding programs applying MAB. To reach this goal WP1 will design and develop: • Selection strategies and schemes to be tested in pilot studies • SNP markers tightly linked to selected genes will be developed • Cost efficient MAB pipelines will be identified and used to genotype the plant material of the pilot studies
  • State of progress of the ongoing tasks (in a nutshell) • Task 1.1: Breeding strategies (AIM: understand how apple & peach a breed and develop better breeding strategies – First deliverable of the WP (D1.1: description of ideotypes and breeding schemes) submitted at M18 – Applicability of GWS in apple and peach as been studied and found to be possible (see also experiments at PFR) • Task 1.2: development/identification of SNP markers for genes mapped before the start of the project – Apple: SNP makers identified for 12 out 18 loci – Peach SNP makers identified for 7 out 12 loci • Task 1.3: Pilot studies (AIM: demonstrate the power of MAS) – Prepared list of PSP for both apple and peach, for peach final list in preparation – GWS for apple planned (peach in consideration): populations identified, genotyping with 384 SNPs is sufficient; genotyping approach and company identified, financing is possible within partner own budget! • Task 1.4: Genotyping pipeline (AIM: apply MAS using T.1.2 SNPs to PSP) – In the process of finalizing MAB protocol (deadline M24!) – In collaboration FEM (WP6) offers from genotyping companies have been collected and a company with a good offer has been identified • Task 1.5: Specification list of breeder-interface (AIM: develop an breeder-friendly interface to query the DB) – No much progresses have been made in this task. As deadline (M30!) is approaching activities have to start during this meeting and continue until September
  • (Main) results achieved so far • Task 1.1: Breeding strategies – Thanks two stakeholder surveys we were able to figure out how apple and peach are currently selected and which are the traits most important for apple and peach breeders • Apple results: see François talk of the stakeholder day 2012 • Peach results: see Thierry talk (in few minutes) • Task 1.2: SNP markers – Apple (12/18); SNP makers identified for: Rvi2 (Vh2), Rvi4 (Vh4), Rvi5 (Vm), Rvi6 (Vf), Rvi11 (Vbj), Rvi13 (Vdurello), Rvi15 (Vr2), QTLs LG17 Fiesta and Discovery, FB-MR5, FB-E and Pl2 (nearly finish Rvi12 (Vb)) • Examples of the results and surprises: see Melanie Jänsch (talk in few minutes) – Peach (7/12); SNP markers identified for: Rm2, Vr2, D, S, G, Y and F
  • Publications • 1 published scientific paper: • Kumar et al. 2012: Genomic Selection for Fruit Quality Traits in Apple(Malus x domestica Borkh.). PLoSONE 7(5): e36674. • But in 2013 (M28) we have D1.4 which is composed by the submitted manuscripts reporting the fine mapping and development of SNP markers for selected major genes and QTLs (output of T1.2)
  • Main challenges for 2013 ALL Deliverables and milestones to be done in the next 6 months (chronological order): • D1.4 (M28): submitted manuscripts on fine mapping of selected major genes and QTLs (output of T1.2) • D1.2 (M30): Evaluation of breeding strategies used in other crops (GWS included) (output of T1.1) • MS4 (M24 not 28): markers tightly linked to the loci of interest (report) • MS5 (24) Optimized MAB protocol (report) • MS3 (M30): Evaluation of breeding strategies used in other crops (review) • MS6 (M30): Specifications of breeder interface defined (report)
  • Action Plan for the coming year WHAT WHO HOW DEADLINE T1.1 submit D1.2 “Evaluation of breeding strategies used in other crops (GWS included)” DLO According partner’s strategy M30 T1.2 finish SNP identification and submit D1.3 (MS on fine mapping of selected major genes and QTLs) EVD, DCA, JKI, IRTA, UMIL, INRA According partner’s strategies M28 T1.3 perform MAB in apple and peach; Perform GWS in apple MAB: Apple and peach breeders involved in the task; GS: B3F, Novadi with the support of INRA and DLO Breeders make plant material available; Statistical support for GWS by INRA/DLO If feasible before harvest in order to identify the material to phenotype T1.4 Test genotyping platform Genotype pilot studies populations Partners involved and selected company According protocols M25 M30 T1.5 specification list breeder-interface ALL Being active and reactive to DCA requests M30
  • Interactions between WP1 and the rest of the project • Interactions planned with WP3, 4 and 7 (breeder interface) • Interactions planned with the stakeholders: – None planned
  • Selected short talks • Melanie Jänsch Rvi2, Rvi4 and Rvi11: SNP markers and surprises • Thierry Pascal Peach part of Deliverable 1.1
  • Rvi2, Rvi4, Rvi11: SNP markers and surprises Melanie Jänsch, Juliane Weger, Giovanni Broggini, Vincent Bus, Sue Gardiner, Heather Bassett and Andrea Patocchi
  • Objectives 1. Identification of 5 single nucleotide polymorphisms (SNPs) within an interval of 1 cM 2. Check for level of polymorphism of SNPs in 8 founders 3. Focus of this talk: apple scab resistance genes Rvi 11 (Vbj), Rvi 2 (Vh2) and Rvi 4 (Vh4) (Bus et al., 2011)
  • repeat Method – SNP development or reject region BLAST available flanking markers on GD sequence Primer Design + PCR SEQ and SNP analysis SNP found SNP confirmation of map position with subset of resistant , susceptible and recombinant individuals closest to the gene SNP polymorphism test with 8 founders SNP identified and validated ok ok ok ok reject region reject region
  • SNP polymorphism example - Rvi4 (Vh4) 250 260 270 280 290 300 310 320 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| 2249_TNL1 CGTGTTTCTGAAATGCTTCAGCTAAATCTCCGTCCTGCTTCCTGACATGCGAAGGATCAACGTGATAGAATATTGGCAMA Gala_TNL1 CGTGTTTATGAAATGCTTCGGCAAAATCTCCGTCCTGCTTCCTGATATGCGAAGGATCAACGTGATAGAATATTGGCAAA Braeburn_TNL1 CGTGTTTCTGAAATGCTTCGGCTAAATCTCCGTTCTGCTTCCTGATATGCGAAGGATCAACGTGATAGAATATTGGCAAA Cox_TNL1 CGTGTTTCTGAAATGCTTCGGCTAAATCTCCGTTCTGCTTCCTGATATGCGAAGGATCAACGTGATAGAATATTGGCAAA Delicious_TNL1 CGTGTTTCTGAAATGCTTCGGCTAAATCTCCGTTCTGCTTCCTGATATGCGAAGGATCAACGTGATAGAATATTGGCAAA F2_TNL1 CGTGTTTCTGAAATGCTTCGGCTAAATCTCCGTTCTGCTTCCTGATATGCGAAGGATCAACGTGATAGAATATTGGCAAA Golden_TNL1 CGTGTTTATGAAATGCTTCGGCAAAATCTCCGTCCTGCTTCTTGACATGCGAAGGATCAACGTGATAGAATATTGGCAAA Granny_TNL1 CGTGTTTCTGAAATGCTTCGGCTAAATCTCCGTTCTGCTTCCTGATATGCGAAGGATCAACGTGATAGAATATTGGCAAA Jonathan_TNL1 CGTGTTCCCGAAATGCTTCAGCTAAATCTCCGTTCTGATTCCTGACATGCGAAGGATCAACGTGATAGAATATTGGCAAA McIntosh_TNL1 CGTGTTTCTGAAATGCTTCGGCTAAATCTCCGTTCTGCTTCCTGATATGCGAAGGATCAACGTGATAGAATATTGGCAAA 330 340 350 360 370 380 390 400 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| 2249_TNL1 ACATG---CCCCAGTTTGCCTCTGCACTCCATGATCTTCACCAGCTCGTCAAGACACCAACTCGAATCCGCATACCTCCT Gala_TNL1 ACATGTCGCTCCAGTTTGTCTCTGCACTCCATGATCTTCACCAGCTCGTCAAGACACCAACTCGAATCCGCATACATCTT Braeburn_TNL1 ACATGTCGCCCCAGTTTGTCTCTGCACTCCATGATCTTCACCAGCTCGTCAAGACACCAACTCGAATCCGCATACATCTT Cox_TNL1 ACATGTCGCCCCAGTTTGTCTCTGCACTCCATGATCTTCACCAGCTCGTCAAGACACCAACTCGAATCCGCATACATCTT Delicious_TNL1 ACATGTCGCCCCAGTTTGTCTCTGCACTCCATGATCTTCACCAGCTCGTCAAGACACCAACTCGAATCCGCATACATCTT F2_TNL1 ACATGTCGCCCCAGTTTGTCTCTGCACTCCATGATCTTCACCAGCTCGTCAAGACACCAACTCGAATCCGCATACATCTT Golden_TNL1 ACATGTCGCTCCAGTTTGTCTCTGCACTCCATGATCTTCACCAGCTCGTCAAGACACCAACTCGAATCCGCATACATCTT Granny_TNL1 ACATGTCGCCCCAGTTTGTCTCTGCACTCCATGATCTTCACCAGCTCGTCAAGACACCAACTCGAATCCGCATACATCTT Jonathan_TNL1 ACATGTCGCCCCAGTTTGTCTCTGCACTCCATGATCTTCACCAGCTCGTCAAGACACCAACTCGAATCCGCATACATCTT McIntosh_TNL1 ACATGTCGCCCCAGTTTGTCTCTGCACTCCATGATCTTCACCAGCTCGTCAAGACACCAACTCGAATCCGCATACATCTT Parents and 8 founders included 2nd choice SNPs 1st choice SNPs
  • FVbj3 Z13_SCAR CH02c06 SNP_region_20(8) B8 CH05e03 Rvi11 SNP_region_34(9) CH03d01 0.1 0.1 2.0 0.7 0.7 0.8 3.8 Rvi11 Rvi11 (Vbj) • Plant material: GD x A722-7, 145 plants • 55 regions tested • In 2 regions SNPs identified • Vbj SNPs mapped between 0.7 and 3 cM • 17 SNPs found in total (Gygax et al., 2004)
  • Rvi2 (Vh2) • Plant material: GD x X2250, 146 plants • 44 regions tested • In 8 regions SNPs identified • Vh2 SNPs mapped between 0.7 and 2.8 cM • 61 SNPS found in total • Intense study and verification of the first mapping to define the correct map position (Bus et al., 2005) CH02b10 CH2-Z13SCAR SNP_region_53(8) SNP_region_41(1) CH05e03 SNP_region_20.4(1) CH-Vbj2 SNP_region_21(15) SNP_region_23(5) Rvi2 SNP_region_27(21) L19SCAR SNP_region_34.3(6) SNP_region_36(4) CH03d01 0.7 0.7 0.7 0.7 1.4 Rvi2
  • Rvi4 (Vh4) Hi22d06 SNP_region_TNL1(20) SNP_region_3(2) SNP_region_10(1) SNP_region_Vr2_3(3) Rvi4 SNP_region_ARGH37(1) CH02c02a Hi02a07 SCAR-S22 2.1 0.4 1.3 Rvi4 • Plant material: Gala x X2249, 242 plants • 30 regions tested • In 5 regions SNPs identified • Vh4 SNPs mapped at 0 cM • 27 SNPs found in total • Intense study and verification of the first mapping to define the correct map position (Bus et al., 2005)
  • Rvi2 vs. Rvi11 CH02b10 Z13_SCAR SNP_region_53(8) SNP_region_41(1) CH05e03 SNP_region_20(1) CH-Vbj2 SNP_region_21(15) SNP_region_23(5) Rvi2 SNP_region_27(21) L19SCAR SNP_region_34(6) SNP_region_36(4) CH03d01 0.7 0.7 0.7 0.7 1.4 Rvi2 Z13_SCAR CH02c06 SNP_region_20(8) B8 CH05e03 Rvi11 SNP_region_34(9) FVbj3 CH03d01 0.1 0.1 2.0 0.7 0.7 0.8 3.8 Rvi11 • Indication that Rvi2 and Rvi11 may derive from the same region • Allelic? • Phenotype of the two genes is similar (SC vs. SN) • Difference due to difference level of enhancement of the resistance cascade? (Bus et al., 2011)
  • Rvi4 vs. Rvi15 • Indication that Rvi4 and Rvi15 may derive from the same region • Allelic? • Phenotype of the two genes is the same (PPP) • Rvi4 symptoms visible after 3-4 days, Rvi15 after 7 days • Difference due to difference level of enhancement of the resistance cascade? 005 Hi22d06 SNP_region_TNL1(20) SNP_region_3(2) SNP_region_10(1) SNP_region_Vr2_3(3) Rvi4 SNP_region_ARGH37(1) CH02c02a Hi02a07 S22_SCAR 2.1 0.4 1.3 Rvi4 CH02f06 ARGH37 Rvi15 ARGH17 CH02c02a 2.9 1.2 0.3 1.7 Rvi15 (Bus et al., 2011)
  • Conclusion • SNP markers for resistance genes most used in breeding will be soon available. • This will simplify marker assisted selection (MAS) and will allow a reduction of its costs . • The precise mapping of the genes increases the precision of MAS and indicates the possible allelism of: – Rvi2 and Rvi11 – Rvi4 and Rvi15