TCC: Gesiane Ribeiro Guimarães, Orientador: Milton Luiz da Paz Lima
Upcoming SlideShare
Loading in...5
×
 

TCC: Gesiane Ribeiro Guimarães, Orientador: Milton Luiz da Paz Lima

on

  • 4,841 views

 

Statistics

Views

Total Views
4,841
Views on SlideShare
4,841
Embed Views
0

Actions

Likes
0
Downloads
31
Comments
0

0 Embeds 0

No embeds

Accessibility

Categories

Upload Details

Uploaded via as Adobe PDF

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

TCC: Gesiane Ribeiro Guimarães, Orientador: Milton Luiz da Paz Lima TCC: Gesiane Ribeiro Guimarães, Orientador: Milton Luiz da Paz Lima Document Transcript

  • Ministério da Educação Secretaria de Educação Profissional e Tecnológica Instituto Federal de Educação Ciência e Tecnologia Goiano Curso de Tecnologia em Gestão Ambiental GESIANE RIBEIRO GUIMARÃESDIVERSIDADE E CARACTERIZAÇÃO MORFOCULTURAL, BIOLÓGICA, BIOQUÍMICA E MOLECULAR DE ISOLADOS DE Colletotrichum spp. 1
  • URUTAÍ - GO 2011 2
  • Ministério da Educação Secretaria de Educação Profissional e Tecnológica Instituto Federal de Educação Ciência e Tecnologia Goiano Curso de Tecnólogo em Gestão Ambiental GESIANE RIBEIRO GUIMARÃESDIVERSIDADE E CARACTERIZAÇÃO MORFOCULTURAL, BIOLÓGICA, BIOQUÍMICA E MOLECULAR DE ISOLADOS DE Colletotrichum spp. Monografia apresentada para obtenção do grau de Tecnólogo em Gestão Ambiental ao Instituto Federal Goiano – CampusUrutaí. Orientador: Dr. Milton Luiz da Paz Lima. URUTAÍ - GO 2011
  • GESIANE RIBEIRO GUIMARÃESDIVERSIDADE E CARACTERIZAÇÃO MORFOCULTURAL, BIOLÓGICA, BIOQUÍMICA E MOLECULAR DE ISOLADOS DE Colletotrichum spp. BANCA EXAMINADORA _______________________________________ D.Sc. Marcus Vinícius Vieitas Ramos (Revisor) _______________________________________ M.Sc. Fernando Godinho de Araújo (Revisor) _______________________________________ D.Sc. Milton Luiz da Paz Lima (Orientador) Data da Defesa: Urutaí, 22 de dezembro de 2011.
  • Dedico a meus pais Geraci e Ana Maria e aosmeus irmãos Giselle, Geraci Junior, Germi eGelza,que sempre me apoiaram com todo seuamor e carinho e me estimularam a nuncadesistir dos meus objetivos. E ao meuorientador pelo esforço e dedicação.
  • “Seja a mudança que você quer ver nomundo.”Mahatma Gandhi.
  • AGRADECIMENTOSA Deus.Aos meus pais e irmãos pelo amor, carinho e compreensão que sempre me apoiaram e meincentivaram a não desistir dos meus ideais. Ao Instituto Federal Goiano campus Urutaí em especialo Laboratório de Microbiologia, agradeço não só a formação acadêmica, mas também a oportunidadee todo apoio para realização desta monografia. Quero agradecer de modo especial ao meu orientadorMilton, por sua atenção, apoio, otimismo, confiança e amizade.Obrigada por esta oportunidade de aprender e contribuir com a Ciência.Aos membros da banca examinadora, M. Sc. Fernando Godinho de Araújo (Revisor), Dr. MarcusVinícius Vieitas Ramos (Revisor), Dr. Milton Luiz da Paz Lima (Orientador), por terem aceitadoparticipar da avaliação deste trabalho.Aos professores do curso que contribuíram para minha formação profissional:Leonice A. Carvalho, Sandra Zago, Carlos Alberto, Rogério C. Machado, Telma Moura, Lucas C. B.de Azevedo, Sue Éllen Ester Queiroz, Guilherme Malafaia, Bruno G. A. da Veiga, Aline Sueli de L.Rodrigues, Alexandre Igor de A. Pereira, Juliano Avelar, José Antônio, Muza do Carmo Vieira,Marcos de Morais, Marcos Fernandes e Milton Luiz da Paz Lima.A vocês que dedicaram seu tempo e sua experiência, o meu muito obrigado e eterno reconhecimento.Obrigada especialmente aos eternos amigos Luiz Paulo, Fagner, Mirella, Gleciene e a todos quetorceram por mim.Obrigada também aos amigos que passaram pelo Laboratório de Microbiologia, Michelle, Éder,Jovan, Priscila, Ana Cristina, Sara, Aldemir, Edilson Silva, Maurílio, Felipe, Alessandra, Flávio,Vânia, Lucas, Anelise, João Marcos e Gianne Amorim.À minha amiga Gaby, por sempre somar entusiasmos e alegrias.Obrigada por tantos momentos de alegria e amizade. Sentirei muito a falta de vocês!
  • RESUMOGUIMARAES, G.R. Diversidade e caracterização morfocultural, bioquímica e molecular de isoladosde Colletotrichum spp. Projeto de Monografia de Final de Curso. 2011.Estudos de diversidade de microrganismos evidenciam variações importantes que muitas vezesquestionam e desvalidam importantes conceitos de espécies. Aspectos morfológicos de muitasespécies de Colletotrichum não são suficientes para sua perfeita identificação, principalmente paraC. gloeosporioides, que em literatura e considerado uma espécie-grupo. Isolados de Colletotrichumspp. foram obtidos de várias hospedeiras, oriundos de diferentes regiões de coleta. Serão estudadosquatro critérios de diferenciação: i) aspectos morfoculturais, ii) aspectos morfológicos emorfométricos das estruturas reprodutivas, iii) testes biológicos, iv) uso de fontes diferenciadoras deC e N, v) identificação molecular. Os isolados foram obtidos através do isolamento em meio ágar-agua (AA), preparando-se culturas monospóricas, sendo repicados para formação de culturas purasem meio de cultura BDA. A partir destas culturas puras foram empregados os quatro marcadores dediferenciação fenotípica. A coloração das colônias teve em seu verso coloração branca, salmão,acinzentado, alaranjado e creme, e o reverso variando entre alaranjado e acinzentado. A classificaçãodo micélio variou de aéreo ou intermediário, e esta forma variou de cotonosa a rosácea. Avaliando ocrescimento micelial, o isolado oriundo de dracena teve melhor crescimento no primeiro dia deavaliação chegando a atingir 18 mm No primeiro experimento a área abaixo da curva de progressodo crescimento micelial (AACPCM) variou de 145 a 359 (isolados de mamão e dracena,respectivamente), e a taxa de crescimento variou de 4,2 a12 mm.dia -1. No segundo experimento aAACPCM variou de 160 a 262 mm.dia -1, e a taxa de crescimento variou de 4,2 a12 mm.dia -1(isolados caqui e antúrio, respectivamente). O teste de patogenicidade cruzada revelou asuscetibilidade dos frutos e das folhas testadas. Todos os isolados foram patogênicos em seushospedeiros de origem (exceção sem ferimento abacate, caqui, dracena e iuca). No tratamento comferimento as folhas da fruta do conde apresentaram maior porcentagem de infecção dos isoladosinoculados (95,8 %). No tratamento sem ferimento as folhas de abacate apresentaram maiorporcentagem de infecção pelos isolados testados (45,8 %). O isolado oriundo de conde foi o isoladoque apresentou maior gama de hospedeiras (total de 22 hospedeiros) nos tratamentos com ferimento;e nos tratamentos sem ferimento os isolados de abacate, cana e mamão foram mais agressivos noshospedeiros testados. Os isolados com menos gama de hospedeiros e consequente maiorespecificidade destacam-se os isolados de goiaba e falso massambará com ferimento e os isolados degoiaba e soja sem ferimento. As principais fontes de carbono para os isolados testados continham em
  • suas combinações dextrose e sorbitol, pois os maiores valores de AACPCM e TC, foram paratratamentos que continham essas fontes de C. A sacarose não demonstrou uma fonte de C eficientepara a morfofisiologia dos isolados. Cinquenta % dos isolados (árvore-da-fortuna, banana fruto,caqui e conde) apresentaram maiores valores de AACPCM para a combinação dextrose e nitrato depotássio. Trinta e oito % dos isolados (banana folha, banana fruto e caqui (folha),) tiveram TCmaiores para isolados também submetidos a combinação de dextrose e nitrato de potássio. Osisolados de conde, chuchu e árvore da fortuna apresentaram os menores valores médios de AACPCMe TC. As características fenotípicas dos isolados de Colletotrichum permitiram desenvolver umaanálise comparativa para identificação do complexo grupo. Os melhores pares de oligonucleotídeosimportantes para amplificação de sequencias de isolados de Colletotrichum foram os pares deoligonucleotídeos ITS e Actina. Através desse trabalho pode-se caracterizar uma população deisolados de Colletotrichum spp. utilizando parâmetros fenotípicos e moleculares.Palavras-chave: inoculação cruzada, antracnose, doenças foliares.
  • SUMÁRIOAGRADECIMENTOS...........................................................................................................................9RESUMO............................................................................................................................................. 10LISTAGEM DE FIGURAS..................................................................................................................12LISTAGEM DE TABELAS.................................................................................................................121. INTRODUÇÃO............................................................................................................................... 132. OBJETIVO.......................................................................................................................................13 2.1. OBJETIVO GERAL...........................................................................................................................13 2.2. OBJETIVOS ESPECÍFICOS..................................................................................................................133. REVISÃO DE LITERATURA.........................................................................................................143.1. HOSPEDEIROS............................................................................................................................14 3.1.1. Abacate (Persea americana Mill – Lauraceae).................................................................14 3.1.2. Amora (Morus nigra Linneu - Moraceae).........................................................................14 3.1.3. Antúrio (Anthurium andreanum Linden. - Araceae).........................................................15 3.1.4. Árvore da Fortuna (Polyscias fructicosa Linneu – Araliaceae)......................................... 15 3.1.5. Banana (Musa paradisíaca Linneu – Musaceae)..............................................................15 3.1.6. Cana (Saccharum officinarum Linneu - Poaceae).............................................................15 3.1.7. Caqui (Diospyros kaki Linneu - Ebenaceae)...................................................................... 15 3.1.8. Chuchu (Sechium edule Jacq. - Cucurbitaceae)................................................................ 16 3.1.11. Dracena (Dracena fragans Linneu - Liliaceae)................................................................16 3.1.12. Falso massambará (Sorghum arundinaceum Linneu- Poaceae).................................... 16 3.1.13. Goiaba (Psidium guajava Linneu - Myrtaceae).............................................................. 16 3.1.14. Iuca (Yucca elephantipes Regel - Agavaceae).................................................................17 3.1.15. Mamão (Carica papaia Linneu - Caricaceae)................................................................. 17 3.1.17. Manga (Mangifera indica Linneu - Anacardiaceae).......................................................17 3.1.18. Mangaba (Hancornia speciosa Gomes - Apocynaceae).................................................17 3. 1.19. Negramina (Siparuna guianensis Aublet - Siparunaceae).............................................18 3.1.20. Soja (Glycine max Linneu - Fabacaeae)..........................................................................18 3.1. 21. Tomate (Lycopersicon esculentum Linneu - Solanaceae)...............................................18 3.1.22. Uva (Vitis vinifera Linneu - Vitaceae)..............................................................................183.2. A DOENÇA – ANTRACNOSE.................................................................................................... 19 3.3. GÊNERO COLLETOTRICHUM.............................................................................................................19
  • 3.3.1. Colletotrichum gloeosporioides (Penz.) Penz e Sacc. (1884)............................................ 20 3.3.2 COLLETOTRICHUM CAPSICI (H.SYD.) E. BUTL. E BISBY (1931)....................................................... 21 3.3.3 COLLETOTRICHUM MUSAE (BERKELEY & M.A. CURTIS) ARX (1957)............................................... 21 OS PRINCIPAIS HOSPEDEIROS DESTE PATÓGENO SÃO ESPÉCIES DE MUSA SPP. COMO M. TEXTILIS, CONTUDO FOI REGISTRADA SUA OCORRÊNCIA EM MALUS PUMILA (MAÇA), MANGIFERA INDICA (MANGA), PERSEA AMERICANA (ABACATE), PSIDIUM GUAJAVA (GOIABA) AND VIGNA SP. (ATRAVÉS DE NODULAÇÕES)...................................... 21 APRESENTA COMO BAINÔMIO MYXOSPORIUM MUSAE BERK. & M.A. CURTIS 1874, E SINONÍMIA GLOEOSPORIUM MUSARUM COOKE & MASSEE 1887. PARA ESTE ANAMORFO AINDA NÃO FOI IDENTIFICADO EM LITERATURA A SUA FORMA TELEOMÓRFICA...........................................................................................................................21 3.3.4 COLLETOTRICHUM FALCATUM (BERK. & CURT.) (1957).................................................................. 214. MATERIAL E MÉTODOS..............................................................................................................21 4.1. CARACTERIZAÇÃO MORFOCULTURAL E MORFOLOGIA DE ESTRUTURAS REPRODUTIVAS.................................22 4.2.CARACTERIZAÇÃO BIOLÓGICA (TESTE DE PATOGENICIDADE CRUZADA).....................................................22 4. 3. CARACTERIZAÇÃO BIOQUÍMICA.......................................................................................................224.4. SELEÇÃO MOLECULAR DE PRIMERS ESPECÍFICOS PARA DETECÇAO........................235. RESULTADOS E DISCUSSÃO......................................................................................................24 5.1.CARACTERIZAÇÃO CULTURAL E MORFOLÓGICA DOS ISOLADOS.................................................................245.2. CARACTERIZAÇÃO BIOLÓGICA (TESTE DE PATOGENICIDADE CRUZADA)..............395.3. CARACTERIZAÇÃO BIOQUÍMICA.........................................................................................415.4. IDENTIFICAÇÃO DE OLIGONUCLEOTÍDEOS PARA CARACTERIZAÇÃO MOLECULAR 446. CONCLUSÕES................................................................................................................................467. ASPECTOS FORMATIVOS............................................................................................................468. REFERÊNCIAS BIBLIOGRÁFICAS.............................................................................................46
  • LISTAGEM DE FIGURASLISTAGEM DE TABELAS
  • 1. INTRODUÇÃO A antracnose em frutíferas é considerada uma doença economicamente importante, elaataca os ramos novos, folhas, inflorescências e frutos. Nas folhas, há o aparecimento demanchas escuras e de contornos irregulares, que resultam em lesões ou perfurações quando ostecidos necrosados se destacam. As inflorescências afetadas apresentam flores escuras,tomando o aspecto de queimadas pelo fogo, morrendo em seguir. As lesões nos ramos podemlevar à queda dos frutos, antes da maturação fisiológica, ou mumificação quando ainda novos.No período de maturação, há o aparecimento de lesões escuras e deprimidas na superfície dofruto, que podem atingir também a polpa. A doença pode ocasionar prejuízos que variam emfunção do grau de suscetibilidade da planta hospedeira e das condições ambientais (SERRA etal., 2008). Podem provocar perdas de até 100% na produção quando os fatores cultivarsuscetível, ambiente favorável e sementes infectadas estiverem simultaneamente presentesdurante o período de cultivo. Entre as medidas de controle deste patógeno, destacam-se: o uso de sementescertificadas, a rotação de culturas, o controle químico e a resistência genética, sendo estaúltima mais eficaz, por minimizar os custos de produção e reduzir os danos causados aoambiente (SILVA, 2004). A disseminação do fungo de uma planta para outra se dáprincipalmente através de respingos de chuva, pois os conídios estão aglutinados por umasubstância gelatinosa hidrossolúvel e não são facilmente carregados pelo vento. Os conídiosuma vez em contato com o hospedeiro, sob condições de umidade, germinam e o pró-micélioresultante, com prévia formação de apressório, penetra diretamente através da cutícula pelaemissão do tubo de infecção (GALLI et al., 1978). A taxonomia e nomenclatura do gênero Colletotrichum é bastante confusa. Hyde et al.(2009) apontaram que existem 66 espécies de Colletotrichum válidas, e destas, 19permanecem com a nomenclatura obscura. A consequência da infecção por espécies de Colletotrichum é a podridão na pré e pós-colheita, que limitam a produção, comercialização e exportação de frutas, hortaliças e culturasperenes, incluindo diversas frutíferas de regiões tropicais e subtropicais (BAILEY e JEGER,1992; SREENIVASAPRASAD e TALHINHAS, 2005; HINDORF, 2000; HYDE et al., 2009;SERRA et al., 2008). O gênero Colletotrichum é um dos mais importantes entre os fungos fitopatogênicosdo mundo, principalmente nas regiões tropicais e subtropicais, envolve espécies que causam
  • doenças de expressão econômica em leguminosas, cereais, hortaliças e culturas perenes,incluindo diversas frutíferas (SERRA et al., 2008). As espécies de Colletotrichum spp.possuem como teleomorfos espécies de Glomerella spp. (SUTTON, 1992; ARMSTRONG-CHO e BANNIZA, 2006; PFENNING et al., 2007) e os nomes C. gloeosporioides eGlomerella cingulata, bastante utilizados para caracterização das espécies tipo dos gêneros deanamorfos e teleomorfos. Entretanto, o conceito de espécies aplicado para anamorfos eteleomorfos, nem sempre coincide entre si, dificultando a identificação dos táxons (CANNONet al., 2000). Para o anamorfo e teleomorfo, a preferência é o uso de nomes mais antigos(SHENOY et al.,2007; CROUS, 2009) e estes podem ser observados no Index Fungorun(2011). Há necessidade de esclarecimentos sobre a real taxonomia deste importante patógenoinespecífico e hipervariável. Cepas podem produzir teleomorfo (heterotálicas) com frequênciadiferenciada em meios de culturas artificiais, ou seja, em condições artificiais desenvolvem-secomo homotálicas, dificultando a caracterização. Já alguns isolados parecem serem não tãoagressivos aos seus hospedeiros (GUERBER e CORRELL, 2001; ARMSTRONG-CHO eBANNIZA, 2006). Os conídios germinam de seis a nove horas após o contato inicial com o hospedeiro seas condições forem favoráveis. Há formação do tubo germinativo, seguido do apressório, quepenetra mecanicamente pela cutícula e pela epiderme da planta. O aparecimento de sintomaspode ser observado a partir do sexto dia após o início da infecção (KIMATI et al., 1997).Esses fungos são os causadores de uma diversidade de doenças como antracnose, podridão depedúnculo e varicela (BAILEY & JEGER, 1992). Espécies de Colletotrichum spp. são tradicionalmente diferenciadas com base emcaracteres morfológicos e culturais, que devem ser considerados simultaneamente nuncaisoladamente. Características tais como morfologia de conídios, presença de setas e doteleomorfo, coloração de colônia, e taxa de crescimento têm sido usadas para diferenciarespécies morfologicamente próximas (SILVA, 2004). As dificuldades encontradas na identificação das espécies de Colletotrichum estãorelacionadas à grande diversidade fenotípica, influência de fatores ambientais na estabilidadedos caracteres morfológicos e culturais, existência de formas intermediárias e falta depadronização de condições culturais empregadas nos diferentes estudos (SUTTON, 1992;FREEMAN et al., 1998; LOPEZ, 2001). A diferenciação entre espécies com base no círculode hospedeiros ou hospedeiro de origem também não é um critério confiável para espéciescomo, por exemplo, C. gloeosporioides e C. acutatum que infectam diferentes hospedeiras(FREEMAN et al., 1998; PERES et al., 2005). É frequente a ocorrência de mais de uma
  • espécie de Colletotrichum associada a uma mesma hospedeira e uma mesma espécie podeatacar múltiplas hospedeiras (FREEMAN et al., 1998). O fungo Colletotrichumgloeosporioides e C. acutatum causam, em geral, sintomas semelhantes como as podridões defrutos em pós-colheita de morangueiro (PERES et al., 2002). O morangueiro (Fragaria xananassa Duch.), por exemplo, pode ser infectado por C. fragariae Brooks, C. acutatum e C.gloeosporioides (GUNNEL & GUBLER, 1992). As três espécies causam antracnose, mas apodridão do pedúnculo, inflorescências e frutos conhecida como "Flor Preta" é atribuída a C.acutatum na cultura do citros. Outras culturas como a amêndoa (Prunnus amygdalu L.)(FORSTER & ADASKAVEG, 1999), maçã (Malus domestica Borkh.) (BERNSTEIN et al.,1995), abacate (Persea americana Mill.) (JONHSTON&JONES, 1997), pêssego (Prunnuspersica (L.) Batsch.) (ADASKAVEG&HARTIN, 1997); citros (BROWN et al., 1996; GOES& KIMATI, 1997) e algumas solanáceas (TOZZE JR. et al., 2006) são infectadas por C.acutatum e C. gloeosporioides. Nutricionalmente carbono e nitrogênio exercem efeito nos processos fisiológicos defungos, principalmente aqueles relacionados ao crescimento, produção de conídios,germinação e peso seco (Cochrane, 1958) e permitem também, estabelecer diferenças entre osisolados de Colletotrichum spp., pela sua habilidade em usar determinada fonte de carbono enitrogênio. A identificação de fungos por metodologia tradicional baseia-se na morfologiacelular, seguindo as informações supracitadas. No entanto, estes estudos às vezes geramresultados ambíguos, por causa da variabilidade intrínseca ao isolado de uma espécie e dascaracterísticas fisiológicas na condição de cultivo. Atualmente, os estudos da diversidade,taxonomia e identificação de microrganismos estão sendo realizados com base nosconhecimentos atuais da taxonomia polifásica, a qual integra diferentes dados e informaçõesde análises, fenotípicas, genotípicas e filogenéticas, para caracterizar o microrganismo emteste (VALE, 2009). O desenvolvimento dos novos métodos para estudo da diversidade de existente entreisolados de Colletotrichum spp. (YANG et al., 2009; DAMM et al., 2009; PRIHASTUTI etal., 2009). As técnicas moleculares de amplificação são utilizadas devido a sua maior precisãoem comparação com os métodos convencionais. Além dos métodos tradicionais de caracterização, análise cultural e morfológica,outros métodos vêm sendo empregados recentemente com maior frequência, entre eles apatogenicidade, os grupos de compatibilidade vegetativa, a análise isoenzimática, e osmétodos moleculares, como RAPD e RFLP. Recentemente, observa-se a necessidade deutilizar diferentes métodos de caracterização aliados aos métodos moleculares principalmente
  • devido a grande variabilidade genética encontrada dentro do gênero Colletotrichum sp.(MENEZES, 2002). Técnicas moleculares têm sido utilizadas para caracterizar diversos táxons fungicos,particularmente para Colletotrichum sp., e as têm auxiliado grandemente na demonstração davariabilidade inter e intraespecífica. As técnicas mais empregadas com essa finalidade são o“Restriction Fragment Length Polymorphism” (RFLP) e “Random Amplified PolymorficDNA” (RAPD). Braithwaite et al., (1990), utilizaram a técnica de RFLP para demostrar adivergência genética entre C. gloeosporioides tipos A e B, duas populações com diferençasmorfológicas, patogênicas e bioquímicas que ocorrem em Stylosanthes spp., na Austrália.Utilizando essa técnica, esses autores revelaram que ambas as populações são geneticamentehomogêneas, porém distintas entre si. O fato de não ocorrerem nas fases perfeitas de nenhumadessas populações na Austrália, explica a uniformidade genética intrapopulacional e descartaa possibilidade de especialização patogênica dessa espécie. Dessa forma, os autores concluemque a existência de duas populações tão diferentes só pode ser explicada por duas diferentesintroduções do patógeno no pais. A técnica de RAPD foi utilizada no Brasil, numa série de trabalhos, para caracterizarisolados de C. lindemuthianum do feijoeiro (VILARINHOS et al., 1995; ALZATE-MARIN etal., 1997; MESQUITA et al., 1998). Nesses trabalhos, foram utilizados diversos isolados dofungo, numa tentativa de discriminar as diferentes raças por meio da técnica de RAPD.Apesar dos resultados não terem permitido o mesmo agrupamento obtido como os testes deinoculação da variabilidade patogênica de C. lindemuthianum. Além dessa espécie, o RAPDjá foi utilizado, com sucesso, para caracterizar a variabilidade de C. graminicola (GUTHRIEet al., 1992; BROWNING et al., 1999), C. orbiculare (CORRELL et al., 1993) e C.gloeosporioides (ALAHAKONN et al., 1994; HAYDEN et al., 1994; KELEMU et al., 1999). A taxonomia e a filogenia do gênero Colletotrichum é confusa (HYDE et al., 2009a;CAI et al., 2009). Historicamente, a antracnose foi encontrada em um substrato para o qualnão há registros de que a relação fungo/hospedeiro era conhecida, então a espécie foiinterpretada como sendo nova, sendo formalmente descrita (CANNON et al., 2000). Estaprática foi posteriormente rejeitada (von ARX 1957; SUTTON, 1980; BAXTER et al., 1983),mas novas espécies são ocasionalmente, descritas e pertencentes ao gênero Colletotrichum sp.(SIVANESAN et al, 1993;. NAKAMURA et al., 2006; LIU et al., 2007). Há agora mais doque 706 táxons listados no Índex Fungorum (INDEX FUNGORUM, 2011). Baseado em umestudo morfológico, von Arx (1957) incluiu mais de 600 sinônimos em C. gloeosporioides e84 sinônimos em C. dematium. Sutton (1992) listou 39 espécies válidas de Colletotrichum
  • spp. Nos últimos anos, ferramentas moleculares têm sido empregadas para inferir a evoluçãorelações das espécies de Colletotrichum. Baseado em rDNA ITS dados de sequência emorfológicas características, algumas espécies têm sido segregados do Colletotrichumgloeosporioides complexas, como C. boninense Moriwaki, Toy. Sato & Tsukib. (MORIWAKIet al., 2003). Embora a sua sequência de dados ajude na identificação das espéciesColletotrichum, não pode ser usado sozinho por tratar-se que muitas espécies sãoestreitamente relacionadas (CROUCH et al., 2009a). Pesquisadores recentemente tentaramexaminar genes múltiplos dados de sequência para distinguir espécies em Colletotrichum (DUet al, 2005; JOHNSTON et al., 1997; CROUCH et al., 2009b; FARR et al., 2006; SHENOYet al., 2007abc; QUE et al., 2008ab; MORIWAKI e TSUKIBOSHI, 2009). Usando estudosfilogenéticos, CROUCH et al. (2006, 2009b). São conhecidos outros métodos como sequenciamento do material genético, oucaracterização com utilização de marcadores moleculares, que vêm apresentando bonsresultados em estudos com o gênero Colletotrichum (CANNON et al., 2000; MENEZES,2002).2. OBJETIVO2.1. Objetivo geral O objetivo deste projeto é caracterizar um complexo de isolados de Colletotrichumspp. utilizando marcadores morfo-culturais, biológicos, bioquímicos e moleculares.2.2. Objetivos específicos • Verificar aspectos culturais como coloração, esporulação e padrões de crescimento. • Identificar a presença da forma teleomórfica. • Verificar a morfologia do apressório a fim de adequar as morfologias das espécies propostas por SUTTON (1992). • Realizar uma análise morfométrica dos conídios e suas estruturas morfológicas a fim de verificar divergências para a espécie. • Caracterizar a fisiologia do crescimento utilizando como parâmetros a taxa de crescimento e a área abaixo da curva de progresso do crescimento micelial. • Verificar a agressividade e patogenicidade de isolados de Colletotrichum spp. nos seus hospedeiros de origem.
  • • Verificar a especificidade em avaliações de inoculação cruzada. • Efeito da relação carbono/nitrogênio no crescimento micelial. • Identificar a partir de oligonucleotídeos universais (primer) uma região gênica exclusiva para isolados de Colletotrichum spp.3. REVISÃO DE LITERATURA3.1. Hospedeiros A seguir serão apresentadas algumas características gerais dos hospedeiros de origemdos isolados de Colletotrichum estudadas neste trabalho.3.1.1. Abacate (Persea americana Mill – Lauraceae) Presente em regiões colonizadas pelos espanhóis (México, Guatemala e Antilhas), oabacate se espalhou até a América do Sul e pode ser encontrado em todas as regiões do globoque possuam solos férteis e onde haja calor que seja suficiente. Produtores e exportadores deabacate distribuem-se entre os vários países da África e das américas do Sul e Central, alémde Israel, Espanha e Estados Unidos, na região da Califórnia. Segundo Pio Corrêa, o abacate foi introduzido no Brasil como espécie cultivávelapenas no início do século XIX e, atualmente, encontra-se à venda nas feiras livres esupermercados ao longo de quase todo o ano. As plantações do interior dos estados de São Paulo e Minas Gerais são responsáveispor quase dois terços do total da produção nacional (THOMSEN, 1999).3.1.2. Amora (Morus nigra Linneu - Moraceae) A amoreira é uma frutífera de grande potencial para as regiões brasileiras com períodode inverno marcante que propícia para pequenas propriedades agrícolas. Os frutos podem serutilizados para consumo in natura e para produção de geleificados e doces caseiros, sendoassim, potencial para as famílias que trabalham com o ecoturismo regional. Além destascaracterísticas, praticamente não necessita de insumos químicos, sendo ótima opção para ocultivo orgânico, além das propriedades nutricionais e medicinais dos frutos. Amora apresentaduas espécies principais: a preta (Morus nigra L.) e a branca (M. alba L.). Ambas são
  • medicinais e alimentícias. A amoreira branca (Bombyx mori L.) é cultivada quase queexclusivamente para a criação do bicho-da-seda muito comum no Oriente. Este insetoalimenta-se das folhas da amoreira-branca. Também pertencem à família botânica, a jaca,figo, a fruta-pão, fícus, umbaúba, entre outros (MIRANDA, 2010).3.1.3. Antúrio (Anthurium andreanum Linden. - Araceae) O antúrio, é uma das flores mais comercializadas do mundo, ainda é pouco difundida epode ser plantada em todo o país. Seu centro de origem abrange a Venezuela e Colômbia. NoVelho Mundo, passou pelos primeiros de muitos os programas de melhoramento, antes de setornar a segunda flor tropical mais comercializada no mundo, perdendo apenas para asorquídeas. Existem mais de 500 espécies de antúrios, muitos deles nativos no Brasil, como oA. harrisi (LORENZI & SOUZA, 2001). Antúrio ou A. andreanum trata-se de uma planta semi-herbácea, ereta, perene, possuide 0,30-1,0 m de altura, sua folhagem e inflorescência possui caráter ornamental. As floressão formadas na primavera e verão. Suas brácteas possuem diversas cores e tamanhos.Cultivadas sempre a meia-sombra em canteiros. Também são utilizadas para corte,proporcionando flores muito duráveis (LORENZI & SOUZA, 2001).3.1.4. Árvore da Fortuna (Polyscias fructicosa Linneu – Araliaceae) Esta é uma planta originária da Polinésia e cercada por lendas urbanas curiosas,existem duas espécies pertencentes ao gênero das Polyscias spp. que recebem o nome deárvore-da-felicidade, a Polyscias guilfoylei e a P. fructicosa, que são respectivamentechamadas de “macho” e “fêmea”, embora não sejam plantas da mesma espécie e quenecessitem trocar gametas entre si. Existe o hábito de sempre plantar essas duas plantas juntaspara atrair boa sorte. Embora o nome popular dessa planta faça-nos pensar em uma árvore,devido a seu porte máximo de cinco metros ela é mais corretamente classificada como umarbusto, podendo ser cultivada em lugares sem muito espaço (LORENZI, 2001).3.1.5. Banana (Musa paradisíaca Linneu – Musaceae) A banana é a fruta mais popular no Brasil, sendo consumida tanto sob forma frescaquanto cozida, frita ou processada industrialmente como doces ou passas. Excetuando
  • algumas regiões sob baixo nível tecnológico, resultado em plantios onde os problemasfitossanitários, especialmente doenças, ocorrem em elevadas intensidade, contribuindo parauma baixa produtividade e qualidade dos frutos. Considerando-se que a bananeira é cultivadaem todas as regiões do País, sob diferentes condições de clima e solo, as doenças que ocorremnessa cultura assumem, portanto, importância regional, sendo também influenciadas pelavariedade cultivada. Dentre os fitopatogênicos que incita doenças na cultura da bananeiradestacam-se os fungos, por serem responsáveis pelo maior número de enfermidades queocorrem na cultura, por causarem perdas elevadas na produção e por depreciarem a qualidadedos frutos. Outras enfermidades importantes para a cultura são também causadas por bactériase vírus. A antracnose é a doença mais importante dos frutos da bananeira, ocorrendo infecçõestanto na pré quanto na pós-colheita. As lesões de antracnose originam-se de duas formasdistintas: lesões originadas de infecções que ocorreram em frutos verdes, permanecendolatentes até seu amadurecimento; lesões oriundas de infecções ocorridas em pós-colheita,decorrentes de ferimentos na superfície dos frutos, resultando em lesões não latentes(STOVER, 1972; FEAKIN, 1977).3.1.6. Cana (Saccharum officinarum Linneu - Poaceae) A cana-de-açúcar é originária da Nova-Guiné e foi levada para o sul da Ásia onde foiusada, de início, principalmente em forma de xarope. A primeira evidência do açúcar em suaforma sólida, data do ano 500, na Pérsia (MOZANBANI et. al., 2006). A cana-de-açúcar é umproduto de suma importância econômica e social no Brasil, em virtude dos seus derivados,principalmente o álcool e o açúcar. Atualmente, o Estado de São Paulo destaca-se porcontribuir com cerca de 60 % da produção nacional, o que equivale a aproximadamente 300milhões de toneladas anuais (RAIZER, 1998). Dentre as principais doenças que ataca a cana-de-açúcar destaca-se a podridão-vermelha-da-cana-de-açúcar, doença essa que causa grandes prejuízos à cultura. Esta doençaocorre em épocas quentes e chuvosas, podendo incidir de maneira drástica nas folhas, toletese principalmente em colmos, prejudicando a produção e a qualidade do produto para acomercialização e a industrialização (RAGO e TOKESHI, 2005). A doença existe desde oinício do cultivo da cana e ocorre no mundo todo. A podridão vermelha causa prejuízosimportantes à cultura, sobretudo pela inversão de sacarose, o que diminui o rendimento noprocessamento da cana. São frequentes os relatos de perdas de 50 % a 70 % de sacarose em
  • colmos atacados simultaneamente pelo fungo e pela broca-da-cana, pois ao perfurar o colmoela abre caminho para a entrada do fungo (SANTIAGO e ROSSETTO, 2010).3.1.7. Caqui (Diospyros kaki Linneu - Ebenaceae) O caqui é um fruto subtropical cuja cultura vem despertando grande interesse, devidoaos elevados rendimentos que proporciona aos produtores (SARRIA, 1998). O Brasil possui8.322ha plantados com caqui com uma produção de 164.849 ton e produtividade de19.839kg/ha (REETZ, 2007). No entanto, a produção brasileira se concentra na cv. Fuyu, quetem sua colheita nos meses de março e abril. O curto período de colheita e o baixo tempo deconservação pós-colheita (FAGUNDES et al., 2006) causam um excesso de oferta no períodode safra, ocorrendo queda do preço do produto. A maturação é concentrada em um curtoperíodo de tempo e pode levar a perda de frutos no início da colheita, principalmente emcondições adversas de campo (MASIA et al., 1998).3.1.8. Chuchu (Sechium edule Jacq. - Cucurbitaceae) O chuchu, espécie da família das cucurbitáceas, é nativo da América Latina é umaplanta herbácea, perene e trepadeira, muito conhecida, sendo cultivado em várias regiõestropicais e subtropicais no mundo. O Brasil é o maior produtor de chuchu do mundo que éuma das dez hortaliças mais consumidas no país, sendo cultivado em várias regiões tropicais esubtropicais e é usado como alimento, na indústria de compotas de frutas, forragem eremédio. (FILGUEIRA, 2003). A família Cucurbitaceae compreende cerca de 118 gêneros e 825 espécies, com umadistribuição predominantemente tropical. Mais de 90 % das espécies estão localizadas naÁfrica, América Latina e Ásia. Aproximadamente nove gêneros e 30 destas espécies sãoutilizadas com fins econômicos, destacando-se as abóboras, buchas vegetais, porongos,chuchus, melancias, melões e pepinos (BARBIERI, 2007). Antracnose causada pelo fungo Colletotrichum pode ser considerada a principaldoença do chuchu no Brasil. O fungo ataca diversas outras cucurbitáceas, causandoprincipalmente podridões de frutos. No chuchu, o ataque se dá principalmente nas folhas efrutos, em qualquer estádio de desenvolvimento. Nas folhas são formadas lesões circularesgrandes, que podem coalescer (juntar-se) e provocar queima das mesmas. No caule ou nosfrutos as lesões são elípticas deprimidas. Ataques severos causam queda de folhas e
  • apodrecimento dos frutos. A doença também é muito comum em pós-colheita em frutos dechuchu, que são colhidos aparentemente sadios e desenvolvem os sintomas após alguns diasda colheita. Nas lesões, pode aparecer um mofo de coloração pálido-róseo, que são os esporosdo fungo. A doença é favorecida por chuvas ou irrigações excessivas, alta temperatura e altaumidade relativa do ar (REIS, 2008).3.1.9. Coco (Cocus nucifera Linneu - Arecaceae) O coco pertencente à família Arecaceae, da ordem das Arecales, possui mais de 240gêneros e cerca de 2.600 espécies. São elementos importantes na composição do paisagismonacional, pois, juntamente com as árvores, arbustos, gramados e plantas rasteiras, sãosatisfatoriamente utilizadas pelos paisagistas na formação de parques e jardins. São as plantasmais características da flora tropical, podendo transmitir ao meio onde são cultivadas, algo doaspecto luxuriante e do fascínio das regiões tropicais O mercado das palmeiras ornamentaiscresceram consideravelmente nos últimos anos, sendo cultivadas as mais diferentes espéciespor viveiristas e produtores (LORENZI et al., 2004).3.1.10. Conde (Annona squamosa Linneu - Annonaceae) A pinha, conde, ata ou fruta-do-conde, pertence à família das Anonáceas epossivelmente originária da ilha de Trindad, nas Antilhas. Essa família compreende mais 120gêneros e 2.000 espécies, sendo o gênero Annona sp. um dos mais importantes, comaproximadamente 90 espécies, das quais se destacam: pinha (A. squamosa L.), cherimóia (A.cherimoia Mill.), graviola (A. muricata L.), condessa (A. reticularta L.), araticum-do-campo(A. dioca) e a atemóia (híbrido de A. cherimoia Mill. com A. squamosa L.). Vegeta melhor emclima quente, com poucas chuvas e estação seca bem definida, como ocorre no Nordeste. Afruta-do-conde começa a produzir três anos após o plantio. O período de colheita vai defevereiro a junho, podendo estender-se um pouco mais em culturas irrigadas. A produçãovaria de 150 a 200 frutos por pé/ano, sendo consumidos ao natural (LOPEZ, 2005).3.1.11. Dracena (Dracena fragans Linneu - Liliaceae)
  • A dracena, coqueiro-de-vênus ou pau-d’agua é uma planta oriunda da África éamplamente cultivada no mundo. Possui porte arbustivo, podendo alcançar de 3 a 6 metros.Apresenta tronco colunar e geralmente nu, com rosetas de folhas ornamentais coriáceas,lanceoladas e arqueadas em seu ápice (LORENZI & SOUZA, 1995).3.1.12. Falso massambará (Sorghum arundinaceum Linneu- Poaceae) O gênero Sorghum apresenta duas espécies representativas S. arundinaceum e S.halepense. No Brasil a distribuição ainda está restrita em algumas regiões, mas nos paísesonde mais ocorrem causam grandes prejuízos. Com o avanço de cultura tem se deparado cominfestações onde estas espécies predominam. O capim-falso-massambará é uma planta anual,herbácea, cespitosa, ereta com inflorescências grandes do tipo panícula aberta do tipopendente com 40 a 60 cm de comprimento e coloração marrom-avermelhada quando maduras(LORENZI, 1991). O capim-massambará é muito similar, mas é uma planta perene eentouceirada que apresenta inflorescência menor (15 a 30 cm). Além disso, apresenta rizomassubterrâneos que auxiliam no seu alastramento (LORENZI, 1991).3.1.13. Goiaba (Psidium guajava Linneu - Myrtaceae) De origem asiática ou americana a goiabeira é um assunto muito discutido. Durante operíodo entre 1514-1557, o cronista espanhol Oviedo escreveu “as goiabeiras”, utilizando onome de “guayabo” e fazendo considerações sobre o seu comportamento vegetativo emalgumas regiões das Índias (RUEHLE, 1964, KOLLER 1979) refere-se à goiabeira comosendo originárias de regiões de clima tropical “Américas”. A goiabeira é a espécie maisimportante do gênero Psidium sp., onde estão agrupadas mais de 150 espécies, sendo todasconsideradas plantas nativas da América, com espécies produtoras de frutos com grandenúmero de sementes. Os frutos da goiabeira são bagas de tamanho, forma e coloração dapolpa variável, em função da variedade (KOLLER, 1979) No Brasil, um dos maiores produtores mundiais de goiaba, destaca-se a produçãopaulista com 60% da produção nacional, com mais de um milhão de pés de goiaba queocupam 2,7 mil hectares, produzindo 51 mil toneladas ano e empregando 3812 pessoas. Osprincipais municípios produtores são Mirandópolis (32%) e Valinhos (16%). Maior produtor econsumidor, o Estado de São Paulo é o centro de origem (95%) e destino (77%) das 4,3 miltoneladas de goiaba recebidas anualmente pela CEAGESP (IRRIGAR, 2009).
  • 3.1.14. Iuca (Yucca elephantipes Regel - Agavaceae) A família é constituída de mais de 18 gêneros, distribuída em regiões tropicais esubtropicais de todo o mundo, especialmente nas regiões áridas. É originário do México eGuatemala. Faz parte da ordem Asparales, da classe Liliopsida (LORENZI et al., 2001). Sãoplantas herbáceas ou lenhosas, possuem folhas carnosas. Em geral, grande e longa,paralelinérvea, muitas vezes nota-se a presença de fibras. As flores são pequenas em geralreunidas em grandes inflorescências brancas muito utilizadas em arranjos e na arborizaçãourbana é uma planta tolerante a solo árido. Tem folhas verde-brilhante, rígidas, eretas oucurvadas, e possuem até 2 m de comprimento (JOLY, 2002).3.1.15. Mamão (Carica papaia Linneu - Caricaceae) O mamão pertence à família Caricaceae, é a espécie mais cultivado em todo o mundo,tendo sido descoberto pelos espanhóis no Panamá. É uma planta herbácea, tropical, comorigem proveniente da América do Sul. O mamão é uma fonte importante de papaína, enzimaproteolítica de ação semelhante à da pepsina, usados na indústria têxtil, farmacêuticas dealimentos e de cosméticos (DANTAS, 2002). O Brasil possui cerca de 22.820 ha cultivados com mamoeiro, destaca-se por ser omaior produtor de mamão, 29 % da oferta mundial sendo o Estado do Espírito Santo um dosseus principais produtores (SEAGRI, 2002). O Brasil exporta menos de 1 % de sua produção,que correspondeu a 11 % do comércio internacional de mamão, em 1999 (FAO, 2000). Umdos fatores limitantes à exportação de mamão são as doenças pós-colheita, principalmente aantracnose causada por Colletotrichum gloeosporioides (Penz.) e a podridão peduncular,causada por diversos outros fungos (ALVAREZ & NISHIJIMA, 1987).3.1.16. Mandioca (Manihot esculenta - Euphorbiaceae) A antracnose da mandioca ocorre em vários países produtores. No Brasil, a doençaesta presente em todas as regiões produtoras, porém é mais severa no Nordeste e no Sudeste,onde as condições ambientais são mais favoráveis à sua ocorrência (Embrapa 2010).
  • Originária da América do Sul, a mandioca constitui um dos principais alimentosenergéticos para cerca de 500 milhões de pessoas, sobretudo nos países em desenvolvimento,onde é cultivada em pequenas áreas com baixo nível tecnológico. Mais de 80 países produzemmandioca, sendo que o Brasil participa com mais de 15% da produção mundial (Embrapa2010). De fácil adaptação, a mandioca é cultivada em todos os Estados brasileiros, situando-se entre os nove primeiros produtos agrícolas do País, em termos de área cultivada, e o sextoem valor de produção (Embrapa 2010).3.1.17. Manga (Mangifera indica Linneu - Anacardiaceae) A cultura da manga foi introduzida no Brasil durante o século XVI e logo em seguidadisseminou-se por todas as regiões do país. No nordeste brasileiro a fruteira encontrou asmelhores condições para o seu desenvolvimento atingindo altas produtividades e frutos comalta qualidade. A manga é hoje a principal fruta exportada para países europeus e os EstadosUnidos, que são os maiores consumidores, mas na sua grande maioria a manga é absorvidapelo mercado interno que não possui muitas exigências de qualidade e variedade, tãorigorosas como o consumidor europeu e americano, que exige frutos com alta qualidadefitossanitária e isento de resíduos químicos (GENÚ e PINTO, 2002).3.1.18. Mangaba (Hancornia speciosa Gomes - Apocynaceae) É nativa dos tabuleiros costeiros, baixada litorânea e cerrados do Brasil, constitui-seem uma das mais importantes matérias primas para a indústria de sucos e sorvetes doNordeste e está entre as dez espécies selecionadas como de altíssima prioridade peloprograma Plantas do Futuro do CNPq/World Bank/GEF/MMA/Probio, com maior potencialde uso imediato entre as fruteiras nativas da região Nordeste (FERREIRA et al., 2005). Amangabeira é agrupada botanicamente nos táxons, segundo classificação de Cronquist (1988),citado por Silva Junior & Lêdo (2006): Reino Platae, Divisão Magnoliophyta, ClasseMagnoliopsida, Subclasse Asteridae, Ordem Gentianales, Família Apocynaceae e GêneroHancornia sp. O gênero Hancornia sp. é considerado monotípico e, assim, constituído de sua únicaespécie é H. speciosa Gomes (SILVA JUNIOR & LÊDO 2006). A mangabeira é uma árvore
  • de porte médio, com 2 a 10 m de altura, podendo chegar até 15 m, e copa ampla, às vezesmais espalhada que alta (LEDERMAN et al., 2000), sendo que as mangabeiras do Cerradopossuem de 4 a6 m de altura e de diâmetro da copa (SILVA et al., 2001). É uma planta originária Brasil e encontrada em várias regiões. Apresenta frutosaromáticos, saborosos e nutritivos, com ampla aceitação de mercado, tanto para o consumo innatura, quanto para a indústria. Apesar disso, pelo fato da cultura ainda continuar sendomantida no habitat natural, sua exploração é feita de modo extrativista. As áreas em que seprática o cultivo tecnificado, são quase inexistentes. Os maiores produtores da fruta são osEstados de Sergipe, Minas Gerais e Bahia, com produções respectivas de 524, 478 e 170toneladas de mangaba no ano de 2000 (SOUSA et al., 2005).3. 1.19. Negramina (Siparuna guianensis Aublet - Siparunaceae) Apesar da Siparuna sp. ser reconhecida por muitos taxonomistas como pertencente afamília Monimiaceae e citada sob essa classificação em inúmeros artigos, o sistema APG II(Grupo para a Filogenia das Angiospermas), de 2003, segregou o gênero Siparuna sp.,reconhecendo-o como sendo da família Siparunaceae, o que será também adotado nestarevisão. Siparunaceae consiste em dois gêneros, Glossocalyx sp., uma espécie da ÁfricaOcidental, e Siparuna sp., com aproximadamente 65 espécies nos neotrópicos, a maior partenos Andes (RENNER,1997). A única espécie de Glossocalyx sp., reconhecida é uma arvoreta,que geralmente não ultrapassa 12 metros de altura. O gênero Siparuna sp. compreendeespécies de arbustos e arvoretas, exceto para 15 espécies que são árvores de 20 a 40 metros dealtura, com troncos com diâmetros maiores que 120 cm, que ocorrem geralmente naAmazônia (RENNER & HAUSNER, 2005). O gênero Siparuna sp. ocorre na maioria dos tipos de vegetação neotropical emelevações entre o nível do mar e 3800 metros (RENNER & HAUSNER, 2005). Comparandoa escassa presença no Velho Mundo Tropical (uma espécie), Siparunaceae tem sediversificado de forma impressionante nos Andes (45 espécies). Baseado nesta atualdistribuição, Siparunaceae poderá ser uma grande família ocidental. As espéciesfilogeneticamente basais desta família ocorrem em todas as áreas da planície Amazônica e nasáreas protegidas das Guianas, sugerindo que este grupo inicialmente diversificou depois daadaptação em grandes altitudes, como nas elevações dos Andes.
  • 3.1.20. Soja (Glycine max Linneu - Fabacaeae) A cultura da soja é originária da Ásia, mais precisamente da China e, somente noséculo passado, iniciou-se o seu cultivo na América Latina. Um dos principais produtosagrícolas nacionais ocupa lugar de destaque no país, gerando importante fonte de divisas (ITO& TANAKA, 1993). Nas últimas cinco décadas, a soja tem apresentado uma taxa decrescimento superior à taxa de crescimento populacional, ocupando papel fundamental naalimentação humana e animal nos cinco continentes (CARRARO, 2003). Segundo Black (2000), do total mundial de produção das sete oleaginosas: soja,algodão, amendoim, girassol, colza, linho e palma, estimada em 280 milhões de toneladas, asoja participa com cerca de 56 % ou seja, cerca de 157 milhões de toneladas, sendo aleguminosa de maior expressão econômica do planeta, com teor de óleo compreendido entre20 e 22 % e apresentando alto teor de proteína, de 40 a 42 % nas variedades difundidas,características essas que levaram à formação de um complexo industrial destinado ao seuprocessamento. Nos últimos vinte anos foi surpreendente o desenvolvimento do complexo soja emtodo o planeta, a produção global, da ordem de 62 milhões de toneladas, no início da décadade 1980, atingiu o recorde de 196 milhões de toneladas na safra de 2002/2003. Esse aumentode produção se deveu à elevada expansão da demanda nos principais países consumidores dogrão de soja e seus derivados. O consumo, no mesmo período, saltou de 68 milhões para 192milhões de toneladas (AGRIANUAL, 2004). Acredita-se que no território brasileiro existam,atualmente, cerca de 120 milhões de hectares cultiváveis, dos quais somente 50 milhões dehectares são atualmente explorados. Assim, a produção poderá apresentar um crescimento de69 % no período subsequente, atingindo o volume de 89 milhões de toneladas.3.1. 21. Tomate (Lycopersicon esculentum Linneu - Solanaceae) O tomateiro tem como centro de origem as ilhas Galápagos (DARWIN et al., 2003;PERALTA et al., 2005), Chile, Peru, Bolívia, Equador e Colômbia (RICK & HOLLE, 1990;ESQUINAS-ALCÁZAR & NUEZ, 1995; FONTES & SILVA, 2002). Este gênero abrange 13espécies que podem ser agrupadas em dois complexos de acordo com a presença de barreirasde cruzamento com a espécie cultivada S. lycopersicum: o complexo Esculentum e ocomplexo Peruvianum (PERALTA et al., 2005). O cultivo do tomateiro foi introduzido emquase todos os países (FONTES & SILVA, 2002) e em poucos anos a tomaticultura espalhou-
  • se em todos os continentes. A cultura apresenta grande importância econômica no país pelovolume e valor da produção. Atualmente, o Brasil ocupa a nona posição no ‘ranking’ mundial, com produção de 3,4milhões de toneladas, sendo a região Sudeste a maior produtora, responsável por 43% do totalproduzido (CNPH, 2011). O cultivo do tomateiro em quase todas as regiões brasileiras epraticamente o ano todo propicia condições favoráveis ao desenvolvimento de pragas epatógenos, tanto em lavouras destinadas ao consumo in natura como para indústria (SOUZA& REIS, 2003).3.1.22. Uva (Vitis vinifera Linneu - Vitaceae) A videira, vinha ou parreira tem sua origem no Oriente, no árido Cáucaso. É uma dasfrutas mais antigas e mais cultivadas no mundo com uma produção que se espalha desde aantiguidade. Mas só a partir do descobrimento da poda em 600 a.C é que o cultivo obteve-semelhores frutos. No Brasil o cultivo predomina desde 1532, introduzido por Martim Afonsode Souza, onde se registram o transporte de bacelos das videiras portuguesas para o Brasil,sendo os estados da Bahia e Pernambuco os pioneiros (TODA FRUTA, 2007). No Estado de Goiás a produção de uva está se iniciando, mas já podemos destacarproduções com sucesso. Em Goiás a cultura esta restrita a vinhedos no sul (Goiatuba), nosudoeste (Santa Helena) e centro do Estado (Anápolis e Hidrolândia). A produçãopredominante é a de uva de mesa, destinada ao consumo in natura. A produção goiana podereforçar o abastecimento do mercado interno de uva de mesa que está em expansão. Nosúltimos dez anos, quase dobrou. Saltou de cerca de 300 mil toneladas ao ano pra 580 miltoneladas. O consumo da fruta in natura passou de 2,79 quilos por pessoa em 1993 para 3,42quilos por pessoa em 2002. Além dessa demanda, o país exporta 20,5 mil toneladas de uva demesa (VAZ, 2008).3.2. A doença – Antracnose A antracnose é uma doença causada por fungos pertencentes principalmente ao gêneroColletotrichum. Contudo existem registros em Kimati et al.,( 2005), são doenças de grandeimportância para muitas plantas cultivadas. Parmagnani (2004) relata que esta doença podeser considerada comum, de ocorrência generalizada no Brasil, especialmente quando o
  • período de cultivo coincide com chuvas e a incidência de clima quente e úmido. O fungo édisseminado pela água de chuva e vento, e pode ser transmitido por sementes, sobrevivendoainda em restos de cultura. O patógeno pode afetar toda a parte aérea da planta, porém, sua ação mais importantese dá nos frutos. Em um ataque severo, até 100 % dos frutos podem ser afetados, ocasionandoperda total para o produtor. As hastes afetadas têm lesões escuras em forma de estrias, e asfolhas manchas necróticas, secas, irregulares e de coloração parda. Nos frutos, onde as lesõessão mais típicas, essas são deprimidas, circulares, de bordos elevados e de diferentestamanhos (VIANA et al., 2007). A antracnose é responsável também por antracnose pós-colheita, a infecção que ocorre no campo dificilmente é detectada até a colheita, pois ossintomas da doença normalmente surgem durante ou após o transporte dos frutos para osmercados consumidores (TATAGIBA et al., 2002). A sobrevivência e a atividade da maioriados fungos fitopatogênicos depende das condições predominantes de temperatura e umidadeou da presença de água em seu meio ambiente (MICHEREFF, 1997). Dentre as espécies deste gênero, C. gloeosporioides é considerada a mais disseminada,heterogênea e importante, principalmente nos trópicos. Seus conídios são hialinos eunicelulares produzidos no interior de acérvulos subepidérmicos dispostos em círculos(REZENDE et al., 2005), geralmente formados em conjuntos de coloração salmão, retos ecilíndricos, com ápices obtusos e bases às vezes truncadas, medindo 12-17 x 3,5-6 µm. Osapressórios formados por esta espécie são clavados, ovóides, obovados ou lobados, decoloração castanha e medindo 6-20 x 4-12 µm. Forma colônias variáveis, de coloraçãobranco-gelo a cinza escuro e micélios aéreos geralmente uniformes–aveludado ou repleto deconidiomas (SUTTON, 1992). O gênero Colletotrichum engloba os fungos imperfeitos pertencentes à ordemMelanconiales da classe Coelomycetes, os quais apresentam uma associação teleomófica comestirpes homotálicas ou heterotálicas de ascomicetos do gênero Glomerella (SKIPP et al.,1995). As espécies de Colletotrichum apresentam uma ampla distribuição geográfica,particularmente em ambientes quentes e úmidos dos trópicos (JEFFRIES et al., 1990;WALLER, 1992) e são extremamente diversas, incluindo saprófitas e fitopatógenos. Ospatógenos ocorrem em diversas espécies de hospedeiros, desde culturas agrícolas e plantasmedicinais, aos arbustos e árvores silvestres, causando podridões de colmos, caules e frutos,seca de ponteiros, manchas foliares, infecções latentes e antracnoses. O último termo descrevedoenças caracterizadas por lesões necróticas profundas e delimitadas nos tecidos(AINSWORTH, 1971).
  • A antracnose (Colletotrichum gloeosporioides Penz.) ou podridão-negra-dos-frutos éconsiderada a moléstia mais importante da fruteira do conde, chegando a provocar até 70 %de perdas de frutos quando as chuvas são prolongadas durante a floração e a formação defrutos. Ocorrem em todos os países que cultivam anonáceas. Incide, preferencialmente nostecidos jovens de folhas, ramos, folhas e frutos. Na folhagem, produz lesões irregulares nolimbo ou nas nervuras, sendo inicialmente pardo-escuras e, depois, esbranquiçadas no centro ecercadas de pontuações pretas e salientes. As folhas atacadas podem cair. Em frutos madurosobservam-se pontos escuros que coalescem. O resultado é uma podridão de rápida (LOPEZ,2005). Além do Brasil, houve relatos do Colletotrichum gloeosporioides no fruto-do-conde,na China, Cuba, EUA, Índia, Porto Rico e nas Ilhas Virgens (FARR e ROSSMAN, 2010). A doença é causada pelo fungo Colletotrichum gloeosporioides Penz. que na formaperfeita ou teleomorfa, corresponde ao fungo Glomerella cingulata (ston.) Spauld e Scherenk.Esse fungo sobrevive de um período ambiental favorável para outro em ramos secos, lesõesantigas, frutos e partes afetados remanescentes no chão ou na planta, sobre os quais esporulaquando há calor e umidade. A disseminação é feita principalmente pelo vento e por respingosde chuva. A umidade é o principal fator determinante da gravidade da doença. Longosperíodos de chuva e de dias nublados, bem como o orvalho noturno intenso são condiçõesfavoráveis ao desenvolvimento da doença. Alta umidade, aliada a temperaturas noturnas de 20ºC a 24 ºC, adubações inadequadas da planta ou ataque de pragas, favorece a doença que seencontra disseminada em todas as regiões produtoras de fruta-do-conde e de outras anonáceas.(BERGAMIN FILHO et al., 1995). A antracnose é considerada uma das mais graves doenças em frutos de goiabeiras,causada pelo fungo Colletotrichum (Penz) (FRUPEX, 1996). O patógeno pode afetar folhasem qualquer fase de desenvolvimento, ramos novos, flores e frutos. Os sintomas nas folhas efrutos são geralmente áreas mais ou menos circulares e de coloração escura. Quando ainfecção se dá pelo botão floral, o fruto apresenta podridão, ocorrendo escurecimento a partirdo pedúnculo em parte ou em toda a fruta. Nos frutos com ataque precoce, na fase inicial,aparecem manchas circulares, secas, elevadas. Em ataques mais severos, as lesões sãodeprimidas, encharcadas, de coloração marrom, principalmente em locais danificados porinsetos, podem coalescer resultando em uma grande mancha de formato irregular. A áreaatacada não acompanha o crescimento do fruto e se rompe. A infecção não penetra na polpa,mas inutiliza os frutos para o mercado de consumo. No caso de infecção severa, os frutostornam-se mumificados e pretos. A penetração do fungo se dá por meio de ferimentoscausados por insetos, lesões durante o manuseio e pela cavidade floral. Pela superfície intacta
  • do fruto, ocorre a penetração direta pela prévia formação de apressórios (JUNQUEIRA,2000). Dentre as doenças que ataca a cultura da mandioca, podemos citar a antracnose. Aindanão se teve registro de danos econômicos, porém está presente em todos os Estadosprodutores do Brasil, e é mais severa no Nordeste e no Sudeste, onde as condições ambientaissão mais favoráveis à sua ocorrência (MASSOLA et al., 2005). A antracnose é uma das doenças mais sérias do mamoeiro e não só ataca os frutoscomo também causa amarelecimento e danos aos pecíolos das folhas. Ainda que os frutoscolhidos não apresentem sintomas da doença, ela se manifesta na fase de embalagem,transporte, amadurecimento e comercialização (OLIVEIRA et al., 2000). O mamão se caracteriza por uma série de doenças ou podridões que surgem após acolheita, devido a sua pouca resistência e por ser desprovido de uma casca em maiorresistência barreira natural à penetração de fungos e bactérias (GAYET et al., 1995). Em geral, os agentes causadores de podridões em pós-colheita apresentam umacaracterística comum, que é a capacidade de se estabelecerem no fruto imaturo epermanecerem em estado latente, sem o aparecimento de sintomas, até que haja condiçõespara que o processo de infecção tenha lugar (NERY-SILVA, 2001). Na cultura da manga, noBrasil, já foram descritas 56 patógenos associados à cultura (CENARGEN, 2010),provocando danos ao seu desenvolvimento e rendimento potencial, o que nos traz anecessidade de um controle eficiente dos patógenos na cultura, diminuindo as injúriasprovocadas pelos mesmos. As doenças mais importantes da cultura da manga são devidas só ataque de fungos ebactérias, não sendo conhecidas doenças causadas por vírus e similares ou por nematóides. Asflores e os frutos são órgãos mais prejudicados pelas doenças, destacando-se a antracnose, aseca-da-mangueira, a morte-descendente, a mancha-angular e os distúrbios fisiogênicos,embonecamento ou malformação e colapso interno. Essas doenças, além de reduzirem aquantidade de frutos produzidos, interferem a quantidade de frutos produzidos, interferem nasua qualidade onerando, sobremaneira, os custos de produção, principalmente, para aobtenção de frutos destinados á exportação (SINGH, 1978). A antracnose causa perdas consideráveis em panículas florais, diminuindo a produçãode frutos. Nestes, os sintomas podem aparecer em qualquer estádio, porém as maiores perdasse verificam em condições ambientais favoráveis ao patógeno durante o período deamadurecimento do fruto, com reflexos posteriores durante o armazenamento e transporte.Nos frutos jovens, causa podridões e abscisão (SINGH, 1978). Além de reduzir a
  • produtividade e desqualificar comercialmente os frutos, a antracnose provoca ferimentos oulesões nos frutos que beneficiam a infestação de fungos oportunistas e insetos (pragas), osquais podem provocar rapidamente a morte da planta ou parte desta que foi afetada (CUNHAet al., 2000). No Brasil, em torno de 40 doenças causadas por fungos, bactérias, nematóides e vírusjá foram relatadas (identificadas). Esse número tende a aumentar devido à expansão da sojapara novas áreas de cultivo e também como consequência da monocultura. Atualmente asdoenças mais comuns são: ferrugem asiática, oídio, mofo branco, doenças de final de ciclo,podridão negra da raiz (ou podridão de carvão), podridão de fitóftora, mancha alvo eantracnose (HENNING, 2009).3.3. Gênero Colletotrichum A história da taxonomia de Colletotrichum spp. envolve vários outros gêneros a qualtem sido descritos como deuteromicetos tal como 11 sinonímias genéricas descritas. Algunsdesses são sinônimos taxonômicos e outros sinônimos nomenclaturais. A evolução dosdiferentes sistemas de classificação para identificação das espécies em 200 anos tem sidomodificado devido trocas de conceitos de espécies, agregando elementos que ressaltam aimportância dos diferentes aspectos da morfologia dos fungos, combinados com os avançosdos conhecimentos da interação patógeno-hospedeiro e círculo de hospedeiros (SUTTON etal., 1992). O fungo Colletotrichum spp. e seu teleomorfo Glomerella spp. tem sido apresentadono mundo especialmente causando doenças pós-colheita nos trópicos, no entanto, pode serencontrado causando tombamentos e manchas foliares. Com sua infecção pode causarinfecções locais latentes ou quiescentes representando o mais importante patógeno pós-colheita. O conceito de espécie é baseado na morfologia do fungo, no substrato natural,cultivo em meio de cultura e especificidade no seu hospedeiro (SUTTON et al., 1992). O teleomorfo de Colletotrichum é um coelomiceto que engloba muitas espéciescausadoras de doenças em possui uma ampla e extensiva gama de hospedeiros (BAILEY &JEGER, 1992). Fungos do gênero Colletotrichum são tidos como modelos para processos deinfecções, sendo o gênero patogênico mais estudado (BAILEY & JEGER, 1992).
  • Estes patógenos desenvolvem uma série de estruturas de infecção especializadas,incluindo tubos germinativos, apressórios, haustórios, hifas intracelulares necrotróficassecundárias e acérvulos (SUTTON, 1980). Trata de um fungo mitospórico sensu Kirk et al., (2001), pertencente ao grupo dosCoelomicetos muito estudado por Sutton (1980) e Nag Raj (1993) que apresenta micélio bemdesenvolvido, septado e ramificado (AGRIOS, 2005). O processo de infecção no gênero Colletotrichum é composto por uma sequênciacomum de eventos: adesão do conídio, germinação, elongação do tubo germinativo, formaçãodo apressório, desenvolvimento de peg de infecção, penetração de células epidérmicas,crescimento das hifas intracelularmente, necrose celular e desenvolvimento de lesões(JEFFRIES et al., 1990 apud PEREIRA, 2009). Este fungo é frequentemente relatado em diferentes espécies de plantas cultivadas emtodo o mundo causando doenças em plantas vivas e/ou de sobrevivendo em condições desaprofitismo (LOPEZ, 2001). Representa um patógeno que causa destruição de órgãos dereserva sendo expressa através de podridões moles, além de ocasionar manchas foliares. Asintomatologia típica das podridões moles efetiva-se devido à produção de enzimaspectolíticas e toxinas pelo patógeno, as quais promovem desorganização a nível celularcorrespondente às lesões de aspecto encharcado que se desenvolvem com rapidez, além dedeprimidas apresentam massa cotonosa constituída de hifas e estruturas de frutificação(BEDENDO, 1995). O fungo Colletotrichum gloeosporioides é conhecido como um dos patógenos maisimportantes, pois infecta pelo menos 1000 espécies de plantas (PHOULIVONG et al., 2010).A consequência da infecção por espécies de Colletotrichum é a podridão na pré e pós-colheita,que limitam a produção, comercialização e exportação de frutas, hortaliças e culturas perenes,incluindo diversas frutíferas de regiões tropicais e subtropicais (BAILEY e JEGER, 1992;SREENIVASAPRASAD E TALHINHAS, 2005; HINDORF, 2000; HYDE et al., 2009a;SERRA et al., 2008). O número de espécies validas de Colletotrichum é variável sendo apontadas 11 porvon Arx (1957), 22 por Sutton (1980), cerca de 40 espécies por Sutton (1992), mais de 60 no“Dictionary of Fungi” (KIRK et al., 2008), enquanto que há 706 espécies, variedades eformae speciales deste fungo (INDEX FUNGORUN, 2011). Além disso, este fungo pertenceao Reino Fungi, grupo dos Fungos Mitospóricos e sub-grupo dos Coelomicetos. Sua faseteleomórfica pertencente ao gênero Glomerella sp., Reino Fungi, Divisão Ascomycota (KIRKet al., 2001).
  • O gênero Colletotrichum é um dos mais importantes entre os fungos fitopatogênicosdo mundo, principalmente nas regiões tropicais e subtropicais, envolve espécies que causamdoenças de expressão econômica em leguminosas, cereais, hortaliças e culturas perenes,incluindo diversas frutíferas (SERRA et al., 2008). As espécies de Colletotrichum spp.possuem como anamorfos Glomerella spp. (SUTTON, 1992; ARMSTRONG-CHO eBANNIZA, 2006; PFENNING et al., 2007) e os nomes C. gloeosporioides e Glomerellacingulata, bastante utilizados, para caracterização das espécies tipo dos gêneros de anamorfose teleomorfos. Entretanto o conceito de espécies aplicado para anamorfos e teleomorfos, nemsempre coincide entre si, dificultando a identificação dos táxons (CANNON et al., 2000).Para anamorfo e teleomorfo, a preferência é o uso de nomes mais antigos (SHENOY et al.,2007; CROUS, 2009) e estes encontram-se listados no Index Fungorun (2011). Hánecessidade de esclarecimentos sobre a real taxonomia deste importante patógeno até o nívelde espécie. Cepas podem produzir teleomorfos (heterotálicas) com frequência diferenciada emmeios de culturas artificiais, ou seja, em condições artificiais desenvolvem-se comohomotálicas, dificultando a caracterização. Já alguns isolados parecem serem não tãoagressivos aos seus hospedeiros (GUERBER e CORRELL, 2001; ARMSTRONG-CHO eBANNIZA, 2006). Os conídios germinam de seis a nove horas após o contato inicial com o hospedeiro seas condições forem favoráveis. Há formação do tubo germinativo, seguido do apressório, quepenetra mecanicamente pela cutícula e pela epiderme da planta. O aparecimento de sintomaspode ser observado a partir do sexto dia após o início da infecção (KIMATI et al.,1997). Essesfungos são os causadores de uma diversidade de doenças como antracnose, podridão depedúnculo e varicela (BAILEY & JEGER, 1992). Espécies de Colletotrichum spp. são tradicionalmente diferenciadas com base emcaracteres morfológicos e culturais, que devem ser considerados simultaneamente nuncaisoladamente. Características tais como morfologia de conídios, presença de setas e doteleomorfo, coloração de colônia, e taxa de crescimento têm sido usadas para diferenciarespécies morfologicamente próximas (SILVA, 2004). As dificuldades encontradas na identificação das espécies de Colletotrichum estãorelacionadas à grande diversidade fenotípica, influência de fatores ambientais na estabilidadedos caracteres morfológicos e culturais, existência de formas intermediárias e falta depadronização de condições culturais empregadas nos diferentes estudos (SUTTON, 1992;FREEMAN et al., 1998; LOPEZ, 2001). A diferenciação entre espécies com base no círculode hospedeiros ou hospedeiro de origem também não é um critério confiável para espécies
  • como, por exemplo, C. gloeosporioides e C. acutatum que infectam diferentes hospedeiras(FREEMAN et al., 1998; PERES et al., 2005). É frequente a ocorrência de mais de umaespécie de Colletotrichum associada a uma mesma hospedeira e uma mesma espécie podeatacar múltiplas hospedeiras (FREEMAN et al., 1998). O fungo Colletotrichumgloeosporioides e C. acutatum causam, em geral, sintomas semelhantes como as podridões defrutos em pós-colheita de morangueiro (PERES et al., 2002). O morangueiro (Fragaria xananassa Duch.), por exemplo, pode ser infectado por C. fragariae Brooks, C. acutatum e C.gloeosporioides (GUNNEL & GUBLER, 1992). As três espécies causam antracnose, mas apodridão do pedúnculo, inflorescências e frutos conhecida como "Flor Preta" é atribuída a C.acutatum. Outras culturas como a amêndoa (Prunnus amygdalus L.) (FORSTER &ADASKAVEG, 1999), maçã (Malus domestica Borkh.) (BERNSTEIN et al., 1995), abacate(Persea americana Mill.) (JONHSTON & JONES, 1997), pêssego (Prunnus persica (L.)Batsch.) (ADASKAVEG & HARTIN, 1997); citros (BROWN et al., 1996; GOES & KIMATI,1997) e algumas solanáceas (TOZZE JR. et al., 2006) são infectadas por C. acutatum e C.gloeosporioides. Nutricionalmente carbono e nitrogênio exercem efeito nos processos fisiológicos defungos, principalmente aqueles relacionados ao crescimento, produção de conídios,germinação e peso seco (COCHRANE, 1958) e permitem também, estabelecer diferençasentre os isolados de Colletotrichum spp., pela sua habilidade em usar determinada fonte decarbono e nitrogênio. A identificação de fungos por metodologia tradicional baseia-se namorfologia celular, seguindo as informações supracitadas. No entanto, estes estudos às vezesgeram resultados ambíguos, por causa da variabilidade intrínseca ao isolado de uma espécie edas características fisiológicas na condição de cultivo. Atualmente, os estudos da diversidade,taxonomia e identificação de microrganismos estão sendo realizados com base nosconhecimentos atuais da taxonomia polifásica, a qual integra diferentes dados e informaçõesde análises, fenotípicas, genotípicas e filogenéticas, para caracterizar o microrganismo emteste (VALE, 2009). O desenvolvimento dos novos métodos para estudo da diversidade de existente entreisolados de Colletotrichum spp. (YANG et al., 2009; DAMM et al., 2009; PRIHASTUTI etal., 2009). As técnicas moleculares de amplificação são utilizadas devido a sua maior precisãoem comparação com os métodos convencionais. Além dos métodos tradicionais de caracterização, análise cultural e morfológica,outros métodos vêm sendo empregados recentemente com maior frequência, entre eles apatogenicidade, os grupos de compatibilidade vegetativa, a análise isoenzimática, e os
  • métodos moleculares, como RAPD e RFLP. Recentemente, observa-se a necessidade deutilizar diferentes métodos de caracterização aliados aos métodos moleculares principalmentedevido a grande variabilidade genética encontrada dentro do gênero Colletotrichum(MENEZES, 2002). Técnicas moleculares tem sido utilizadas para diversos fungo, porém, naparticularidade para o gênero Colletotrichum, e as têm auxiliado grandemente nademonstração da variabilidade inter e intraespecífica. As técnicas mais empregadas com essafinalidade são o “Restriction Fragment Length Polymorphism” (RFLP) e “Random AmplifiedPolymorfic DNA” (RAPD). Braithwaite et al. (1990), utilizaram a técnica de RFLP parademostrar a divergência genética entre C.gloeosporioides tipos A e B, duas populações comdiferenças morfológicas, patogênicas e bioquímicas que ocorrem em Stylosanthes spp., naAustrália. Utilizando essa técnica, esses autores revelaram que ambas as populações sãogeneticamente homogêneas, porém distintas entre si. O fato de não ocorrerem nas fasesperfeitas de nenhuma dessas populações na Austrália, explica a uniformidade genéticaintrapopulacional e descarta a possibilidade de especialização patogênica dessa espécie. Dessaforma, os autores concluem que a existência de duas populações tão diferentes só pode serexplicada por duas diferentes introduções do patógeno no pais. A técnica de RAPD foi utilizada no Brasil, numa série de trabalhos, para caracterizarisolados de C. lindemuthianum do feijoeiro (VILARINHOS et al., 1995; ALZATE-MARIN etal., 1997; MESQUITA et al., 1998). Nesses trabalhos, foram utilizado diversos isolados dofungo, numa tentativa de discriminar as diferentes raças por meio da técnica de RAPD.Apesar dos resultados não terem permitido o mesmo agrupamento obtido como os testes deinoculação da variabilidade patogênica de C. lindemuthianum. Além dessa espécie, o RAPDjá foi utilizado, com sucesso, para caracterizar a variabilidade de C. graminicola (GUTHRIEet al., 1992; BROWNING et al., 1999), C. orbiculare (CORRELL et al., 1993) e C.gloeosporioides (ALAHAKONN et al., 1994; HAYDEN et al., 1994; KELEMU et al., 1999). A taxonomia e a filogenia do gênero Colletotrichum é confuso (Hyde et al., 2009; Caiet al., 2009). Historicamente, antracnose encontrada em um substrato para o qual não háregistros de que a relação fungo/hospedeiro era interpretada como uma nova espécie(CANNON et al., 2000). Esta prática foi posteriormente rejeitado (von ARX 1957; SUTTON,1980; BAXTER et al., 1983), sendo as descrições para o gênero Colletotrichum apresentadaspor muitos autores em literaturas (SIVANESAN et al., 1993; NAKAMURA et al., 2006; LIUet al., 2007).
  • Mais do que 706 táxons encontram-se listados no Índex Fungorun (Index Fungorum,2011). Baseado em um estudo morfológico, von Arx (1957) incluiu mais de 600 sinônimosem C. gloeosporioides e 84 sinônimos em C. dematium. Sutton (1992) listou 39 espécies deColletotrichum. Nos últimos anos, ferramentas moleculares têm sido empregadas para inferira evolução relações das espécies de Colletotrichum. Baseado em nu-rDNA ITS dados desequência e morfológicas características, algumas espécies têm sido segregados doColletotrichum gloeosporioides complexas, como C.boninense Moriwaki, Toy. Sato &Tsukib. (MORIWAKI et al., 2003). Embora a sua sequência de genes importantes do genomapode ajudar na identificação das espécies Colletotrichum, não pode ser usado sozinha por setratar adequadamente da delimitação das espécies estreitamente relacionadas (CROUCH etal., 2009a). Inúmeras sequencias foram estudadas em literaturas para distinguir espécies deColletotrichum spp. (DU et al, 2005; JOHNSTON et al, 1997; CROUCH et al., 2006,2009bc;FARR et al, 2006; SHENOY et al., 2007ab; QUE et al, 2008ab; MORIWAKI eTSUKIBOSHI, 2009; Crouch et al. 2006; 2009b). A seguir serão apresentados alguns elementos morfológicos essenciais para aidentificação de espécies de Colletotrichum spp. identificadas nesse trabalho.3.3.1. Colletotrichum gloeosporioides (Penz.) Penz e Sacc. (1884). Esta espécie bastante polífaga e presente e muitas hospedeiras é considerado umaespécie complexo devido apresentar imensa variabilidade genética dentre os isoladosanalisados, contudo apresenta imensa variabilidade biológica e molecular. Este táxon pertencente ao subgrupo dos coelomicetos apresenta como teleomorfo oascomiceto Glomerella cingulata (Stonem.) Spauld. e Von Schrenk (1903). Em meio de cultura possui colônias variáveis, de coloração cinza claro a cinza escuro,seu micélio é aéreo, formando aglomerações associadas ao acérvulo, no lado reverso da placatambém possui coloração branca acinzentada com a idade. As setas podem ou não estarempresentes. Escleródios são ausentes. Apressórios clavados, sua forma pode apresentar-se comoovados, obovados, algumas vezes lobados, de coloração marrom escura, apresenta dimensõesde 6-20 x 4-12 µm, seus conídios formados em massas de colorações salmão, possuemformato reto, cilíndrico, ápice obtuso, base truncada, 12-17 x 3,5-6 µm. A produção deconídios é bastante heterogênea em meio de cultura (SUTTON, 1992).
  • A variabilidade fisiológica de C. gloeosporioides é representada por 21 formaespecialis e variedades [C.gloeosporioides (C.g.) f.sp. alatae, C.g. f.sp. gloeosporioides, C.g.f.sp. heveae, C.g. f.sp. melongenae, C.g. f.sp. nectrioides, C.g. f.sp. aeschynomenes, C.g. f.sp.clidemiae, C.g. f.sp. cucurbitae, C.g. f.sp. cuscutae, C.g. f.sp. manihotis, C.g. f.sp. pilosae,C.g. f.sp. uredinicola, C.g. var. aleritidis, C.g. var. cephalosporioides, C.g. var.gloeosporioides, C.g. var. gomphrenae, C.g. var. hederae, C.g. var. minus, C.g. var. minus,C.g. var. nectrioidea] registradas em literatura (INDEX FUNGORUM, 2011).3.3.2 Colletotrichum capsici (H.Syd.) E. Butl. e Bisby (1931) Possuem colônias densas, de coloração branca a cinza escuro, marrom reversos,escleródios ausentes, setas abundantes, apressórios abundantes de formato clavado a ovado,marginado, forma cadeia irregular, de 14 x 6,5-11,5 µm. Conídios formados em massas decoloração salmão, de forma falcada, fusiforme, gradualmente afilada nas extremidades,apresentam dimensões de 18-23 x 3,5-4 µm. Considerando o sinônimo de C. dematium porvon Arx. (1957) e mais tarde uma distinta espécie em Capsicum sp. Sutton (1980) distinguiuP. capsici de C. dematium pela espessura do conídio e a patogenicidade em pimentão. A variabilidade fisiológica de C. capsici é representada por duas formae specialis C.capsici f. sp. capsici e C. capsici f.sp. Cyamopsidicola (INDEX FUNGORUM, 2011).3.3.3 Colletotrichum musae (Berkeley & M.A. Curtis) Arx (1957) Este patógeno produz acérvulos em frutos, caules, pecíolos e ocasionalmente folhas.Produz lesoes esfericas ou alongadas de 400 µm de diâmetro, e nesta lesão pode apresentarfinas setas. Os conidióforos formados a partir de um pseudo-parenquima, são cilíndricos, e notopo da célula conidiogênica podem apresentar um estreitamento, são hialinos, septados,apresentam 30 µm de comprimento, 3-5 µm de largura, na sua porção terminal possui umaabertura fialídica. O conídio é hialino, asseptado, de formato oval a elíptico ou cilíndrico,muitas vezes achatado na base, seu ápice é obtuso, variavelmente gutulado, suas dimensõessão de 11-17 x 3-(4,5)-6 µm, os esporos são produzidos em massas de coloração marrom alaranja. As colônias em meio de cultura batata-dextrose-ágar possuem coloração branca.Cinza ou oliváceas com micélio aéreo flocoso. Os acérvulos podem ser marrons escuros ounegros, abundantes distribuídos uniformemente, as setas raramente são formadas em meio de
  • cultura; os conídios também podem ser produzidos por fiálides produzidas pelo micéliovegetativo; o apressório possui formato navicular a ovado, tornando-se ao final lobado,marrom escuro, e apresenta de 6-12 µm de comprimento por 5-10 µm de largura. Os principais hospedeiros deste patógeno são espécies de Musa spp. como M. textilis, contudo foi registrada sua ocorrência em Malus pumila (maça), Mangifera indica (manga), Persea americana (abacate), Psidium guajava (goiaba) and Vigna sp. (através de nodulações). Colônias muitas vezes com micélio branco abundante aéreo tornando-se cinza com aidade, a canela, ocre, abundante massas de conídios, geralmente coalescentes ausentes. Cerdasescleróticas ausentes, conídios reto, cilíndrico, com lóbulos grandes ou profundos, 9-13 x 9-11,5 µm, muitas vezes tornando-se complexa. (SUTTON 1980). Apresenta como bainômio Myxosporium musae Berk. & M.A. Curtis 1874, e sinonímia Gloeosporium musarum Cooke & Massee 1887. Para este anamorfo ainda não foi identificado em literatura a sua forma teleomórfica.3.3.4 Colletotrichum falcatum (Berk. & Curt.) (1957) Colônias acinzentadas com micélio aéreo esparsas e pequenas manchas densa, emoutros lugares reverter cinza branco, salmão massas de conídios (corrida leve) rosa algumasculturas abundante micélio branco acinzentado aérea com esporulação pobres e não acérvulodistintos (raça escura). Escleródios ausentes ambas as raças. Cerdas esparsas. Conídiosfalciformes (mas não muito), fusiformes, ápices obtusos, 15,5 26.5 x 4-5 µm. esparsasapressórios, clavado parda ou circular, borda inteira, 12,5-14.5 x 9.5-12 µm (SUTTON, 1980).4. MATERIAL E MÉTODOS O presente trabalho foi realizado no Laboratório de Microbiologia. Os isolados foramobtidos folhas e frutos com sintomas de diversos locais. Os hospedeiros analisados foram:(Persea americana) abacate (Urutaí-GO), (Morus nigra) amora (Urutaí-GO), (Anthuriumandraeanum) antúrio (Ipameri-GO), (Polycias frusticosa) árvore da fortuna (Urutaí-GO),(Musa paradisiaca ) banana (Brasília-DF), (Musa paradisiaca) banana (folha) (Brasília-DF),(Saccharum officinalis) cana (Urutaí-GO), (Diospyros kaki) caqui (Urutaí-GO), (Sorghum
  • arundinaceum) cevadilha (falso massambará) (Urutaí-GO), (Sechium edule) chuchu (Brasília-DF), (Cocos nucifera) coco (Urutaí-GO), (Annona coriacea) conde (Urutaí-GO), (Dracenafragans) dracena (Urutaí-GO), (Psidium guajava) goiaba (Brasília-DF), (Psidium guajava)goiaba(folha) (Brasília-DF), (Yucca elephantipes) iuca (Brasília-DF), (Carica papaia) mamão(Brasília-DF), (Manihot esculenta) mandioca (folha) (Urutaí-GO), (Anacardium mangiferae)manga (Brasília-DF), (Hancornia speciosa) mangaba (Goiânia-GO), (Sipurana guianensis)negramina (Urutaí-GO), (Glycine max) soja (Urutaí-GO), (Solanum lycopersicum) tomate(Urutaí-GO), (Vitis vinifera) uva (Brasília-DF) (Tabela 1).Tabela 1. Informações dos hospedeiros por onde os isolados foram obtidos considerando o nome científico, família botânica e local de coleta. Hospedeiro Nome científico Família botânica Local de coleta 1 Abacate Persea americana Lauraceae Urutaí/GO 2 Amora Morus nigra Moraceae Urutaí/GO 3 Antúrio Anthurium andraeanum Araceae Ipameri/GO 4 Árvore da Fortuna Polycias frusticosa Araliaceae Urutaí/GO 5 Banana Musa paradisiaca Musaceae Brasília/DF 6 Banana (folha) Musa paradisiaca Musaceae Brasília/DF 7 Cana Saccharum officinalis Poaceae Urutaí/GO 8 Caqui Diospyros kaki Ebenaceae Urutaí/GO 9 Chuchu Sechium edule Cucurbitaceae Brasília/DF 10 Coco Cocos nucifera Arecaceae Urutaí/GO 11 Conde Annona coriacea Annonaceae Urutaí/GO 12 Dracena Dracena fragans Liliaceae Urutaí/GO 13 Falso Massambará Sorghum arundinaceum Poaceae Urutaí/GO 14 Goiaba Psidium guajava Myrtaceae Brasília/DF 15 Goiaba (folha) Psidium guajava Myrtaceae Brasília/DF 16 Iuca Yucca elephantipes Agavaceae Brasília/DF 17 Mamão Carica papaia Caricaceae Brasília/DF 18 Mandioca Manihot esculenta Euphorbiaceae Urutaí/GO 19 Manga Anacardium mangiferae Anacardiaceae Brasília/DF 20 Mangaba Hancornia speciosa Apocynaceae Goiânia/Go 21 Negramina Sipurana guianensis Siparunaceae Urutaí/GO 22 Soja Glycine max Fabacaeae Urutaí/GO 23 Tomate Solanum lycopersicum Solanaceae Urutaí/GO 24 Uva Vitis vinifera Vitaceae Brasília/DF
  • 4.1. Caracterização morfocultural e morfologia de estruturas reprodutivas. Fragmentos de tecidos foram retirados das regiões marginais, desinfestadossuperficialmente em solução de hipoclorito de sódio [1%] e, em seguida, lavados com águadestilada e esterilizada. Os fragmentos foram depositados em meio de cultura ágar-água (AA)e, incubados à temperatura ambiente por dois dias. As colônias que se desenvolveram a partirdos tecidos lesionados foram transferidas para novas placas de Petri contendo meio BDA, eincubadas em uma câmara com temperatura a 25°C por sete dias. A multiplicação do inóculofoi feita por repicagem de fragmentos de micélio (cultura monospórica) que se encontravamem placas de Petri em meio BDA (batata-dextrose-ágar) e transferidas para novas placas.Logo após, discos de meio de cultura de aproximadamente 10 mm contendo fragmentosmiceliais, foram acondicionados em câmara de incubação sob temperatura de 25°C por setedias. O experimento foi constituído de 24 tratamentos, três repetições, totalizando 72 unidadesexperimentais. A avaliação do crescimento das colônias foi determinada medindo-se os dois diâmetrosortogonais da colônia, com auxilio de uma régua. Fez-se a média destas leituras, as medidasforam realizadas a partir do segundo dia de crescimento, sendo avaliada com intervalos de 24horas, totalizando sete avaliações. Discos de micélios de aproximadamente 10 mm foram transferidos para outra placa dePetri contendo BDA. As placas foram mantidas à temperatura de 25°C. Após sete dias foramrealizadas observações do tipo de micélio (cotonoso, rosáceo e crisantêmico), altura do
  • micélio (elevado, intermediário e raso), coloração das colônias no verso e reverso da placa(acinzentado, branca, creme, salmão e vermelho), presença de esporulação, foram borda domicélio (irregular ou lisa) (Tabela 2). Os conídios foram submetidos ao teste de germinação para indução de formação deapressórios e preparo de laminas semi-permanentes. Os conídios e apressórios (total de 50)foram medidos em microscópio ótico.4.2.Caracterização biológica (Teste de patogenicidade cruzada) Utilizou-se o método da folha destacada no teste de patogenicidade. Depositou-sefrutos e folhas sadios de seus respectivos hospedeiros (Tabela 1), assepticamentedesinfestados com álcool (70%), por dois minutos e depois em hipoclorito de sódio, 1%,durante dois minutos, e então, lavados em água destilada (3 vezes). Após a secagem, os frutos e folhas foram dispostos em potes de polietileno de baixadensidade (PPEBD), previamente desinfestadas com as soluções anteriores. No fundo dosrespectivos potes, foram colocados papel mata-borrão umedecidos om água destilada, emquantidade suficiente para manter o papel umedecido sem excesso. Em cada embalagem, folhas ou estruturas vegetativas das hospedeiras de origemforam adicionadas. Depositou-se um bloco de meio de cultura (10 mm 2) contendo micélio dosisolados nas áreas da folha com ferimento (CF) e sem ferimento (SF) com um perfuradorflambado com pontas. Após este procedimento os potes foram cobertos, identificados comfilme de polietileno para a formação de câmara úmida, por um período de sete a dez dias emtemperatura entre 25 a 30 ºC. A avaliação da infecção foi realizada com o aparecimento delesões formadas nas superfícies. O delineamento experimental utilizado foi o delineamentointeiramente casualizado (DIC) constituído de 24 tratamentos e 24 repetições, totalizando 576unidades experimentais (UE).4. 3. Caracterização bioquímica As fontes de carbono utilizadas neste estudo (dextrose, sacarose e sorbitol) foramcombinadas com três fontes de nitrogênio (asparagina, peptona e nitrato de potássio), naproporção de 10:1 (10 g de C para 1 g de N). O meio basal para adição das combinaçõescarbono/nitrogênio foi composto de: 0,5 g de MgSO4.7H2O; 1,0 g de KH2PO4; 17 g de ágar,q.s.p. 1.000 mL de água destilada (LILLY & BARNETT, 1951), sendo o pH ajustado para 5,5.Após a autoclavagem, os meios foram vertidos em placas de Petri, em volume aproximado de
  • 20 mL/placa. Discos de micélio (10 mm 2 de diâmetro) dos 24 isolados, oriundos de colôniasjovens (cinco dias de crescimento), foram transferidos para o centro das placas de Petri, e asculturas foram incubadas em condições de claro contínuo e temperatura de 25 °C, durante setedias. A avaliação do crescimento micelial consistiu na determinação do diâmetro das colôniasde cada isolado usando-se a média de duas leituras efetuadas em dois sentidos diametralmenteopostos. O experimento foi constituído de nove (dextrose x asparagina, dextrose x peptona,dextrose x nitrato de potássio, sacarose x asparagina, sacarose x peptona, sacarose x nitrato depotássio, sorbitol x asparagina, sorbitol x peptona, sorbitol x nitrato de potássio)tratamentospara cada isolado, duas repetições repetições, totalizando 432 unidades experimentais. A determinação da esporulação foi realizada logo após a avaliação do crescimentomicelial, mediante o preparo de uma suspensão de conídios de cada placa de Petri, contendoas diferentes combinações carbono/nitrogênio. Para o preparo da suspensão, foramadicionados 20 mL de água destilada esterilizada em cada placa de Petri, para facilitar aremoção dos conídios do micélio, foi utilizado uma lâmina de vidro, cuidadosamente passadana superfície da colônia. O material removido foi filtrado em duas camadas de gaze, e aconcentração de conídios determinada em câmara de Neubauer, obtendo-se uma média deduas leituras para cada repetição dos tratamentos. Para a determinação do peso seco, os isolados serão cultivados individualmentedurante cinco dias em frascos de Erlenmeyer, sem agitação das culturas, contendo 50 mL decada combinação C/N, adicionados ao meio líquido basal. As condições de incubação serão asmesmas anteriormente citadas. Ao final do período de incubação, as culturas serão filtradasem gaze dupla, e a massa micelial coletada será depositada em caixas de papel alumínio, compeso previamente determinado e isentas de umidade. As caixas serão colocadas em estufa a 50°C, durante quatro dias e, ao final deste período, serão determinadas por diferença, o pesoseco da massa micelial de cada isolado, o qual será expresso em miligrama.4.4. Seleção molecular de primers específicos para detecçaoIsolados de Colletotrichum spp.: Vinte e quatro isolados de Colletotrichum spp. foramselecionados da coleção de fungos do laboratório Microbiologia do Instituto Federal Goianocampus Urutaí. Dentre estes destacam-se os isolados tidos como “espécie-tipo” deC.gloeosporioides, C. dematium e C. falcatum para comparação entre os isolados.Crescimento dos isolados para extração de DNA: Discos de micélio (aproximadamentenove mm) foram retirados da margem de culturas, aos sete dias de idade, sendo adicionadosem Erlemeyers contendo meio de cultura líquido de ervilha (100 g de ervilha, 1,5 g CaCO 3 e 1
  • L água destilada), num volume de 100 mL por Erlemeyer com capacidade de 250 mL. Apósincubação por um período de 10 dias o micélio foi coletado, retirado assepticamente econgelado a –70ºC para conservação e posterior extração de DNA.Extração do DNA: Isolados de Colletotrichum spp. foram submetidos à extração de DNAsegundo protocolo CTAB + Solventes. Identificou-se os tubos (EPPENDORF), com o número de acesso, sendo as espéciesestudadas Persea americana, Morus nigra, Anthurium andraeanum, Polyscias fructicosa,Musa paradisiaca, Saccharum officinalis, Diospyros kaki, Sorghum arundinaceanum,Sechium edule, Cocos nucifera, Annona coriacea, Dracena fragans, Psidium guajava, Yuccaelephantipes, Carica papaia, Manihot esculenta, Anacardium mangiferae, Hancorniaspeciosa, Siparuna guianensis, Glycine max, Solanum lycopersicon e Vitis vinifera., cujonúmero de acesso era 1, 2, 3, 4, 5, 6, 7,9, 10, 11,13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 e 24.Deste modo, foram pesadas de cada amostra, aproximadamente 0,2 g a 0,5 g. Em seguida foi feita a maceração da amostra utilizando-se pistilos (bastão) devidamenteautoclavados, assim, após a adição de Nitrogênio líquido, o material foi macerado. Em seguida adicionou-se CTAB + β-mercaptaetanol, sendo este um agente redutor quedesnatura peroxidases e polifenoloxidases, impedindo a ação destas enzimas sobre ao DNA.Após a adição do mesmo misturou-se para que ocorresse a homogeneidade. Na sequência todas as amostras foram levadas para o banho-maria a 65 ºC por 30minuto (agitando a cada 10 minutos as amostras manualmente até completar 30 minutos). Após o banho-maria adicionou-se 600 µl de CIA (Clorofil-24-Clorofórmio para 1 álcoolisoamílico) Agitou-se com auxílio do agitador, em seguida as amostras foram levadas para acentrifuga á 12000 rpm por 10 minutos. Extraiu-se o sobrenadante de cada amostra com o auxílio de pipetas de 1000 µL e emseguida transferiu para um novo microtúbulo. Adicionou aos tubos de sobrenadante a 400 µL de isopropanol para proporcionar oaparecimento do pellet. Deixou precipitar por pelo menos 1 hora no freezer. Em seguida, foi centrifugado novamente todas as amostras por um período de 10 a 15minutos a 12.000 rpm. Lavou-se o pellet com 600 µL de etanol a 70 % e depois com o álcool 95 %. Descartou-se o etanol, tendo sempre o cuidado para não descartar o pellet juntamentecom o etanol.
  • Deixou secar e depois ressuspendeu o pellet com água destilada ou MilliQ.Reação de PCR: As reações de amplificação foram preparadas para um volume final de 552µL, contendo, 2 µL de cada primer ITS4 (5’-TCCTCCGCTTATTGATATGC-3’), ITS5 (5’-GGAAGTAAAAGTCGTAACAAGG-3’), ACT 512F(ATGTGCAAGGCCGGTTTCGC),ACT 783R (TACGAGTCCTTCTGGCCCAT), CL1 (GARTWCAAGGAGGCCTTCTC),CL2 (TTTTTGCATCATGAGAGTTTGAC), BT2b (ACCCTCAGTGTAGTGACCCTTGGC)57,5 µL de tampão 10X; 18,4 µL de MgCl2; 46 µL de dNTP; 5,75 µL de Taq DNApolimerase; 2 µL de DNA. A reação foi realizada utilizando um termociclador com o ciclo de35 a 94 ºC 30 segundos, a 58 ºC por 30 segundos a 72 ºC a 1 minuto. M 1 1 3 3 9 9 10 10 13 13 14 14 15 15 17 17 21 21 24 24Figura 1.Gel de agarose do DNA total de isolados de Colletotrichum spp. quantificados inicialmente.
  • 5. RESULTADOS E DISCUSSÃO5.1.Caracterização cultural e morfológica dos isolados A maioria dos isolados identificados foram oriundos de plantas pertencentes a 20famílias botânicas, demonstrando a imensa gama de hospedeiras e pouca especificidadeperante famílias botânicas ou grupos de hospedeiros. Jerger (1992) apontou também que ogênero Colletotrichum sp. é polígafo e algumas espécies possuem variabilidades fisiológicas(INDEX FUNGORUN, 2011).A maioria dos isolados foram coletados na região Centro-oestedo Brasil, sendo principalmente coletados nos estados do Distrito Federal e Goiás (Tabela 1). Os 24 isolados de Colletotrichum spp. cultivados em meio BDA, obtidos a partir dosfrutos e folhas de plantas com sintomas de antracnose, coletadas na região de Brasília-DF,Ipameri-GO, Urutaí-GO, de acordo com as características observadas todos foramidentificados como sendo pertencentes ao gênero Colletotrichum e ainda a maioria dosisolados pertencem a espécie-tipo Colletotrichum gloeosporioides sensu Sutton (1992). Foi observado heterogeneidade na coloração da colônia variando de tons entre branco,acinzentado, salmão, vermelho e creme com o reverso da placa variando entre as coressalmão, branco, vermelho, creme e acinzentado (Figura 8 e Figura 9). Foi verificadadiferenciações entre as cores na frente e reverso das placas de Petri. Em relação à altura domicélio foi classificado como micélio elevado e o tipo de micélio foi identificado comomicélio cotonoso, e sua borda variou entre irregular e lisa (Tabela 2). Apenas 17 % dosisolados tiveram esporulação em procedimentos padrões de cultivo (meio de cultura BDA),confirmando a dificuldade esporulativa de algumas cepas em condições de crescimentoartificial (Tabela 2). A taxa de crescimento micelial entre os isolados apresentou uma amplitude de 2,9mm.dia-1(isolado mangaba) a 8,4 mm.dia-1 (isolado chuchu), demonstrando maior e menoratividade fisiológica, respectivamente, dos isolados em condições artificiais (Figura 8 eTabela 3). Os isolados tomate e abacate são fortes candidatos em programas de seleção deplantas resistentes a antracnoses, devido ao fato de oferecer rápido crescimento e produçãomicelial (Tabela 3), e ainda mais além e mais importante os isolados de banana, coco, mamãoe negramina, merecem destaque por produzirem em abundância conídios em condiçõesartificiais sendo importantes para processos de inoculação e estudos de resistência (Tabela 2). Os isolados de mangaba (2,9 mm.dia-1 121,8) e abacate (11,6 mm.dia-1 271,6) queapresentaram as maiores taxas de crescimento apresentaram os maiores valores de AACPCM,
  • representando que estes, em condições artificiais apresentaram maior atividade fisiológica (Tabela 3 e Figura 2). A partir do terceiro dia de incubação os isolados divergiram quanto à velocidade de crescimento merecendo destaque o isolado oriundo de abacate, acompanhado pelo isolado de chuchu, por apresentarem maiores crescimentos miceliais (Figura 1 e 2). Ao primeiro (Figura 4A) e segundo (Figura 4B) dia os isolados não apresentaram diferenças significativas do diâmetro da colônia. Somente a partir do terceiro dia (Figura 3A) o isolado abacate diferiu numericamente dos demais isolados quanto ao diâmetro da colônia, não igualando-se sua média ao demais isolado ao sexto dia (Figura 4B). Houve uma diversidade da atividade fisiológica dos isolados provavelmente associada à característica genéticas e de interação com o substrato para crescimento. A diversidade da colônia pode ser observada pelos aspectos coloniais e diâmetro da colônia podem ser observados na Figura. 8 e 9. Tabela 2. Características morfo-culturais dos isolados de Colletotrichum spp., de acordo com seu hospedeiro de origem, presença de esporulação, cor do micélio na frente e verso da placa de Petri, forma do micélio, borda micelial e altura da colônia, observadas em meio BDA após 7 dias incubados a 25°C. Hospedeiro Esporulação Cor do micelio frente cor do micelio reverso Forma micelio Borda Altura Amora - salmão salmão cotonosa irregular elevado Abacate - branco/azincentado azincentado cotonosa lisa elevado Antúrio - salmão salmão cotonosa lisa elevadoÁrvore da Fortuna - branca/salmão/claro salmão cotonosa lisa elevado Banana + branco/salmão salmão cotonosa lisa elevado Banana (folha) - branco/salmão salmão cotonosa irregular elevado Cana - branco/salmão salmão cotonosa lisa elevado Caqui - branco branco cotonosa lisa elevado Chuchu - vermelho vermelho cotonosa lisa elevado Conde - azincentado azincentado cotonosa lisa elevado Coco + creme/salmão salmão cotonosa lisa elevado Dracena - azincentado azincentado cotonosa irregular elevadoFalso Massambará - branco salmão cotonosa lisa elevado Goiaba - branco creme cotonosa lisa elevado Goiaba (folha) - branco/salmão salmão cotonosa lisa elevado Iuca - branco/salmão salmão cotonosa lisa elevado Mamão + branco/salmão salmão cotonosa lisa elevado Mandioca - branco/salmão salmão cotonosa irregular elevado Manga - creme salmão cotonosa lisa elevado Mangaba - branco creme cotonosa irregular elevado Negramina + branca/salmão salmão cotonosa irregular elevado Soja - branco salmão cotonosa lisa elevado Tomate - salmão salmão cotonosa lisa elevado Uva - salmão salmão cotonosa irregular elevado
  • Tabela 3. Média do diâmetro da colônia (expressa em mm) dos isolados de Colletotrichum spp. avaliados em sete dias após a inoculação, valores de área abaixo da curva de progresso do crescimento micelial (AACPCM), e taxa de crescimento (Tx. Cresc.). Dias de Incubação Ordem Isolados AACPCM Tx Cresc 1 Abacate 271,6 11,6 2 Amora 147,4 4,6 3 Antúrio 181,0 5,4 4 Árvore da Fortuna 184,9 6,6 5 Banana 149,2 5,4 6 Banana (folha) 154,1 5,2 7 Cana 148,5 4,8 8 Caqui 155,8 5,7 9 Chuchu 233,4 8,4 10 Coco 158,7 5,4 11 Conde 197,6 7,0 12 Dracena 124,9 3,1 13 Falso Massambará 152,2 5,3 14 Goiaba 157,4 5,6 15 Goiaba (folha) 150,2 5,0 16 Iuca 197,4 6,0 17 Mamão 146,4 4,3 18 Mandioca 175,3 4,6 19 Manga 151,8 5,3 20 Mangaba 121,8 2,9 21 Negramina 158,0 5,5 22 Soja 183,2 6,2 23 Tomate 224,4 7,5 24 Uva 188,2 5,2
  • Os conídios, oriundos de cada isolado, quando observados ao microscópio ótico,apresentaram-se hialinos, unicelulares, retos e gutulados. Com exceção dos isolados de cana-de-açúcar e cevadilha, todos os isolados mostraram praticamente o mesmo comprimento, nãodiferindo entre si (Tabela 4). Quanto à largura, não houve variação (Tabela 4), com o tamanhodos conídios dentro dos limites estabelecidos para C. gloeosporioides, e nem para o C.falcatum e C. dematium (SUTTON, 1980). Pela relação comprimento e largura (C/L), pode-seobservar que os isolados produziram conídios relativamente semelhante. A avaliação dotamanho dos conídios pela relação C/L parece ser uma boa medida, indicando que quantomaior o quociente dessa relação, os conídios são mais longos e delgados e vice-versa(VERAS, 1997). Um fato relatado por Menezes & Hanlin (1996) ao trabalharem com C.gloeosporioides. Essa segregação pode estar relacionada à condição nuclear dos conídios.Estudos realizados por Tebeest et al., (1989), em três espécies de Colletotrichum, mostraram aexistência de conídios uninucleados (97%), binucleados (2,2%) e trinucleados (1%). Segundoesses autores, o número de núcleos variou com o meio de cultura (líquido ou sólido) e que, emgeral, os conídios com mais de um núcleo eram maiores em relação àqueles típicos da espéciede C. gloeosporioides. Todos os isolados produziram apressórios de formato, circular, lobado e fracamentelobado, sendo possível a utilização dessas estruturas para diferenciá-los. A pigmentação dosapressórios do gênero Colletotrichum está relacionada com a capacidade de penetração notecido do hospedeiro. Deising et al., (2000), citaram que isolados de Colletotrichum spp.tratados com inibidores da biossíntese de melanina são incapazes de penetrar no tecidohospedeiro. Do mesmo modo, Kubo et al. (1982) trabalhando com isolados de C. lagenariumobservaram uma relação entre a falta de capacidade para penetrar numa membrana de
  • nitrocelulose com a pigmentação dos apressórios. Em alguns isolados foi visível a produçãode massas de conídios na superfície da colônia, de cor laranja. As colônias variaram, também,quanto à formação de micélio aéreo, desde flocoso sem conídios aparentes, até micélioescasso, submerso e bem esporulado, sete dias após à incubação. Ferraz (1977) classificouisolado de espécies do gênero Colletotrichum em grupos e subgrupos, em função da variaçãoobservada nas características culturais. Mesmo os isolados pertencentes à mesma espécieapresentaram entre si grande variabilidade no mesmo substrato, admitindo estar este fatorelacionado com a presença de raças fisiológicas. Considerando que uma espécie fúngica érepresentada por populações de biótipos, e tendo em vista que estes não tenham a mesmaconstituição genética, ou seja, encontre-se em condição heterozigótica para um dado caráter,possivelmente ocorrerá a segregação de biótipos de comportamento variável, de acordo com oambiente de cultivo da espécie.
  • Tabela 4. Média de crescimento micelial (cm), morfologia e morfometria de conídios e identificação de isolados de C. gloeosporioides, C. dematium e C. falcatum em meio BDA. Crescimento Mice lial (cm) Dime ns õe s de Formato de Isolados Forma de conídios Dimensões de conídios (µm) Táxon 7dias apress órios (µm) apre ssório1 Abacate 79,2 Cilíndrico 17,5-(15)-12,5x2,5-(4,75)-5 12-(8)-7,2x7,2-(4)-9,6 circular/liso C. gloeosporioides2 Amora 41,2 Cilíndrico 17,5-(13,3)-7,5x5-(5)-7,5 6-(4,1)2x4-(2,1)-4 lobado C. gloeosporioides3 Antúrio 45,5 Cilíndrico 15-(13,4)-10x5-(5)-7,3 10-(6,6)-4x2-(3,5)-5 lobado C. gloeosporioides4 Árvore da Fortuna 52,3 Cilíndrico 20-(14,7)-10x5-(5)-7,5 6-(4,4)-3x2-(3,6)-4 frac. Lobado C. gloeosporioides5 Banana 40,5 Cilíndrico 25-(16,3)-10x2,5-(5)-7,5 5-(3)-3x4-(3)-3 circular C. gloeosporioides6 Banana (folha) 41,7 Cilíndrico 22,5-(13,0)-5x0-(5)-7,5 5-(3)-3x4-(3)-3 lobado C. gloeosporioides7 Cana 38,7 Fusiforme 50-(31,1)-17,5x5-(5)-5 6-(4,2)-3x4-(4)-4 lobado C. facaltum8 Caqui 45,2 Cilíndrico 17,5-(10,5)-2,5x2,5-(4)-5 10-(6)-4x2-(3)-5 frac. Lobado C. gloeosporioides9 Chuchu 64,0 Cilíndrico 25-(17,0)-7,5x5-(5)-7,5 7-(4,5)-2x2-(2,1)-4 circular/liso C. gloeosporioides10 Coco 43,3 Cilíndrico 25-(9,5)-5x2,5-(2,9)-5 6-(4,2)-3x4-(4)-4 frac. Lobado C. gloeosporioides11 Conde 53,0 Cilíndrico 20-(12,1)-5x2,5-(4,4)-5 6-(4,4)-3x2-(3,6)-4 frac. Lobado C. gloeosporioides12 Dracena 31,2 Cilíndrico 22,5-(9,5)-2,5x2,5-(3,4)-5 3-(2,5)-2x2-(2)-2 lobado C. gloeosporioides13 Falso Massambará 41,7 Fusiforme 20-(9,1)-2,5x2,5-(3,4)-5 3-(2,5)-2x2-(2)-2 lobado C. dematium14 Goiaba 43,3 Cilíndrico 22,5-(6,7)-2,5x2,5-(3,3)-5 5-(3,8)-3x4-(3,4)-3 frac. Lobado C. gloeosporioides15 Goiaba (folha) 38,8 Cilíndrico 22,5-(17,0)-12,5x12,5-(5)-7,5 5-(3,8)-3x4-(3,4)-3 circular/liso C. gloeosporioides16 Iuca 49,2 Cilíndrico 22,5-(17,5)-7,5x5-(5)-5 7-(5,6)-4x2-(2,4)-2 circular C. gloeosporioides17 Mamão 36,5 Cilíndrico 22,5-(14,2)-5x5-(5)-5 7-(4,5)-2x2-(2,1)-4 lobado C. gloeosporioides18 Mandioca 41,3 Cilíndrico 22,5-(16)-5x5-(5)-5 6-(4,1)2x4-(2,1)-4 lobado C. gloeosporioides19 Manga 42,2 Cilíndrico 22,5-(16,7)-7,5x5-(5)-7,5 7-(5,6)-4x2-(2,4)-2 frac. Lobado C. gloeosporioides20 Mangaba 30,8 Cilíndrico 25-(16,4)-7,5x5-(5)-5 3-(2,5)-2x2-(2)-2 lobado C. gloeosporioides21 Negramina 44,7 Cilíndrico 22,5-(13,2)-2,5x2,5-(4,8)-5 6-(4)-3x3-(4)-4 lobado C. gloeosporioides22 Soja 47,3 Cilíndrico 22,5-(15,3)-2,5x5-(5)-5 5-(4)-3x2-(3)-4 frac. Lobado C. gloeosporioides23 Tomate 57,2 Cilíndrico 25-(15,4)-2,5x5-(5)-5 9-(6)-4x3-(4)-5 circular/liso C. gloeosporioides24 Uva 46,3 Cilíndrico 22,5-(13,1)-2,5x2,5-(4,8)-5 7-(4,5)-2x2-(2,1)-4 circular/liso C. gloeosporioides*média das dimensões de 50 conídios, produzidos em BDA, após 7 dias de cultivo (25 ºC, 12 h fotoperíodo); média dasdimensões de 50 apressórios; formato dos conídios: cilíndrico; fusiforme; formato dos apressórios: frac. lobado= fracamentelobado. Com base em caracteres morfológicos e morfométricos, observou-se a prevalência deisolados de C. gloeosporioides [22/24; retos, cilíndricos, obtusos no ápice, dimensões de 9-24
  • x 2-5 µm], contudo foi observado C. dematium [1/24; conídios fusiformes, dimensões de 19-24x2-2,5 µm] e C. falcatum [1/24; fusiforme, dimensões de 15-26x4-5 µm]. Os isolados maispredominantes (C. gloeosporioides), (sensu Sutton 1992), apresentaram conídios hialinos,gutulados e/ou obclavados, sendo o isolado de cana-de-açúcar identificado como sendo C.falcatum, e o isolado oriundo de cevadilha como C. dematium (Tabela4). As características que melhor distinguiram os isolados foram o formato dos conídios ea produção de apressórios lobados ou fracamente lobados. A diferenciação entre espécies combase nas dimensões de conídios e apressórios foi dificultada pela sobreposição dos valoresdescritos por Sutton (1992), pois a maioria dos isolados apresentou dimensões dentro da faixade variação descrita para as duas espécies, C. gloeosporioides e C. acutatum. O telemorfo étambém um critério usado para a definição de espécie Jerger (1992). No entanto, no presenteestudo, dos 24 isolados, apenas um (isolado antúrio) apresentou a fase teleomórfica(Glomerella cingulata). O isolado 24 apresentou características intermediárias, com apressórios de margenslisas e conídios elipsóides, e foi identificado como C. gloeosporioides por possuir tamanhodos conídios e apressórios que se enquadram na descrição desta espécie (além da coloração decolônia branca). Apesar dos isolados terem os apressórios circulares e lisos, apresentaramconídios predominantemente cilíndricos, típicos de C. gloeosporioides (Tabela 4). A predominância do formato reto e/ou cilíndricos (SUTTON, 1980) foi a característicamais útil para a identificação dos isolados como C. gloeosporioides. Baseado principalmentenesse critério e levando em consideração o crescimento micelial a 28 ºC e o comprimento deconídios, os 22 isolados foram identificados como da espécie C. gloeosporioides. Os demaisforam identificados com C. falcatum e C. dematium (Tabela 4).
  • 90,0 Amora Antúrio Árvore da Fortuna80,0 Banana Banana (folha) Cana70,0 Caqui Chuchu60,0 Coco Conde Dracena50,0 Falso Massambará Goiaba Goiaba (folha)40,0 Iuca Mamão Mandioca30,0 Manga Mangaba20,0 Negramina Soja Tomate10,0 Uva Abacate 0,0 1 2 3 4 5 6 7 Figura 2. Curvas de progresso do crescimento micelial dos isolados de Colletotrichum spp. oriundos de diferentes hospedeiros.
  • 300,0 250,0 200,0 150,0MCAP 100,0 50,0 0,0 Figura 3. Área abaixo da curva de crescimento progresso micelial (AACPM) de diferentes isolados do Colletotrichum sp. analisados (sete dias de incubação).
  • 20,0 A 18,0 16,0 14,0 12,0 10,0 8,0 6,0 m m D n d ô a o â 4,0 c r e e t ) ( l i 2,0 0,0 30,0 B 25,0 20,0 15,0 10,0 m m D n d ô a o â c r e e t ) ( l i 5,0 0,0.
  • Figura 4. Diâmetro médio da colônia dos isolados de Colletotrichum spp. oriundos de diferentes hospedeiros ao primeiro (A) e segundo (B) dia após a inoculação (dap) .
  • 35,0 A 30,0 25,0 20,0 15,0mmD 10,0ndôaoâcreet)(li 5,0 0,0 60,0 50,0 B 40,0 30,0 20,0mmDndôaoâcreet)(li 10,0 0,0
  • Figura 5. Diâmetro médio da colônia dos isolados de Colletotrichum spp. oriundos de diferentes hospedeiros ao terceiro (A) e quarto (B) dia após a inoculação (dap) .
  • 70,0 A 60,0 50,0 40,0 30,0 20,0mmDndôaoâcreet)(li 10,0 0,0 80,0 B 70,0 60,0 50,0 40,0 30,0mm 20,0Dndôaoâcreet)(li 10,0 0,0
  • Figura 6. Diâmetro médio da colônia dos isolados de Colletotrichum spp. oriundos de diferentes hospedeiros ao quinto (A) e sexto (B) dia após a inoculação (dap) ..
  • 90,0 A 80,0 70,0 60,0 50,0 m 40,0 30,0mDndôaoâcretli 20,0 10,0 0,0Figura7. Diâmetro médio da colônia dos isolados de Colletotrichum spp. oriundos de diferentes hospedeiros ao sétimo (A) dia após a inoculação (dap) .
  • A B C DE F G HI J K LM N O PQQ R S TU V W X
  • Figura 8. Aspecto micelial de colônias fúngicas de Colletotrichum spp. A. amora verso B. amora reverso, C. antúrio (inflorescência) verso D. antúrio (inflorescência) reverso, E. árvore da fortuna (folha) verso F. árvore da fortuna (folha) reverso, G. banana (fruto) verso H. banana (fruto) reverso, I. banana (folha) verso J. banana (folha) reverso K. cana (folha) verso L. cana (folha) reverso, M. caqui (folha) verso N. caqui (folha) reverso, O. chuchu (folha) verso P. chuchu (folha) reverso, Q. coco (fruto) verso R. coco (fruto) reverso, S. conde (fruto) verso T. conde (fruto) reverso U. dracena (folha) verso V. dracena (folha)reverso, W. falso massambará (folha) verso X. falso massambará (folha) reverso.
  • A B C DE F G HI J K LM N O PQ R S T U V
  • Figura 9. Aspecto micelial de colônias fúngicas de Colletotrichum spp. A. goiaba (fruto) verso B. goiaba (fruto) reverso, C. goiaba (folha) verso D. goiaba (folha) reverso, E. iuca (folha) verso F. iuca (folha) reverso G. mamão (fruto) verso H. mamão (fruto) reverso I. mandioca (folha) verso J. mandioca (folha)reverso, K. manga (folha) verso L. manga (folha) reverso M. mangaba (inflorescência) verso N. mangaba (inflorescência) reverso O. negramina (inflorescência) verso P. negramina (inflorescência)reverso Q. soja (folha) verso R. soja (folha)reverso S. tomate (fruto) verso e T. tomate (fruto) reverso U. uva (folha) verso V. uva (folha)reverso.
  • 5.2. Caracterização biológica (Teste de patogenicidade cruzada) Para o teste de patogenicidade, aos sete dias após a inoculação, todas as plantasapresentavam sintomas da infecção pelo patógeno. O teste de patogenicidade cruzada revelou a suscetibilidade dos frutos e das folhastestadas. Todos os isolados foram patogênicos em seus hospedeiros de origem (exceção semferimento abacate, caqui, dracena e iuca, Tabela 6). No tratamento com ferimento as folhas dafruta do conde apresentaram maior porcentagem de infecção dos isolados inoculados (95,8 %;Tabela 5). No tratamento sem ferimento as folhas de abacate apresentaram maior porcentagemde infecção pelos isolados testados (45,8 %; Tabela 6.). O isolado oriundo de conde apresentou maior gama de hospedeiras (total de 22hospedeiros sintomáticos) nos tratamentos com ferimento; e nos tratamentos sem ferimento osisolados de abacate, cana e mamão mostraram-se mais agressivos. Peres et al., (2003) relatamque isolados de C. gloeosporioides possuem o potencial de afetar diversas frutas tropicais pormeio de infecções cruzadas, sendo o mesmo potencial não verificado para outras espécies deColletotrichum spp. Os isolados com menor gama de hospedeiros e consequente maiorespecificidade destacam-se os isolados de goiaba e falso-massambará com ferimento e osisolados de goiaba e soja sem ferimento. Os resultados deste trabalho, aliados aos resultados de Tozze-Júnior et al. (2006)apontam para uma certa especificidade por hospedeiro por parte dos isolados deColletotrichum. Estudos envolvendo inoculação cruzada, com vários isolados e diferenteshospedeiras são necessários para determinar reações diferenciais (Tabela 5 e 6).
  • Tabela 5. Patogenicidade cruzada dos 24 isolados inoculados nos 24 hospedeiros de origem e porcentagem de patogenicidade cruzada (%) nos experimentos onde procedeu-se ferimento (CF). Isolados de acordo com sua procedência (hospedeiros) Hospedeiros 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 % 1 Abacate + + + + + + + - - - + - + + + + + + + + + + - - 75,0 2 Amora + - + + + + - - + - + - + + + + + + + + - + - - 66,7 3 Antúrio + - - + + + + - - - + - + - + - - + + + - + - - 50,0 4 Árvore da Fortuna + + - + - + + + + + - + - + + - + + + + + + + + 79,2 5 Banana + + - + + + - + + - + - + - + - + + + + - + - - 62,5 6 Banana (folha) + + - + - + - + - + + - + - + - - + + + + + + - 62,5 7 Cana + + - + + + + - + - + - + - - - + + + + - + - - 58,3 8 Caqui + + - + + + + + - - - - - + + - + - + + - + - - 54,2 9 Chuchu + + - + + + + - + + - + - + + - - + + + + - + + 70,8 10 Coco + + - - + + + - + - - - + + - - + + + + - + - + 58,3 11 Conde + + + + + + + + + + + - + + - + + + + + + + + - 87,5 12 Dracena + + - + + + + + + + + - + + - - - + + + + - + - 70,8 13 Falso Massambará + - - + + + - + - - - - + + + - - + + + - + - - 50,0 14 Goiaba + - - + - + + - - - - - + - + - + + + + + + - - 50,0 15 Goiaba (folha) + - + + + + + + + + - - + + - + + + + + + + + - 79,2 16 Iuca + + - + + + + - + + + - - + + - + + - + + + + + 75,0 17 Mamão + - - + + + + + + - + - - + + - - + + + - + - - 58,3 18 Mandioca - + + + - + + + + - - - + - + + + + + + - + - - 62,5 19 Manga + - + + + - - - + - - - - + + + + + + + - + - - 54,2 20 Mangaba + - - + + + - + + + + + + + - - - + + + + + + - 70,8 21 Negramina + + - + + - - + + - + - + + - - + + + + - + - + 62,5 22 Soja + - + + - + + + - - - - - + + + + + + + - + - - 58,3 23 Tomate + - - + - + + - + + + - - - - - + + + + + + + - 58,3 24 Uva + - + + + + + + + + + - - + + + - + + + + + + - 79,2*Os números ordenados no cabeçalho representam os isolados fúngicos e seus hospedeiros de origem indicadosna primeira coluna vertical
  • Tabela 6. Patogenicidade cruzada dos 24 isolados inoculados nos 24 hospedeiros de origem e porcentagem de patogenicidade cruzada (%) nos experimentos onde não procedeu-se ferimento (SF). Isolados de acordo com sua procedência (hospedeiros) Hospedeiros 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 19 20 22 23 24 % 1 Abacate - - - + - - + - + - + - + + - - - + + + + + - - 45,8 2 Amora - - - - - - - - - - + - - + + - - - - + - + - + 25,0 3 Antúrio - - - - - + - - - - - - - - + - - + - - + + - - 20,8 4 Árvore da Fortuna - - - - - - + - + - - - - + - - - - + + + + - + 33,3 5 Banana - - - - + - - - + - - - + - + - - - - + + + - - 29,2 6 Banana (folha) - - - - - - - - - - - - - - + - - + - + - + - - 16,7 7 Cana - - - - - + + - - - - - + - - - - + + + + + - - 33,3 8 Caqui - - - - + - - - - - - - - + - - - - - + + + - + 25,0 9 Chuchu - - - + - - - - + - - - - + + - - - - - + - - + 25,0 10 Coco - - - - - - - - + - - - - + - - + + - + + + - + 33,3 11 Conde - - - - - - - - - - - - + + - - - + + - + + - + 29,2 12 Dracena - - - - - - - - - + + - - + - - + + - - + - + - 25,0 13 Falso Massambará - + - - - - - - - - - - + - + - - - - - + + - - 20,8 14 Goiaba - + - - - - - - - - - - + - + - - - - - - + - - 16,7 15 Goiaba (folha) - - - - - - - - - - - - - + + - - + - - + + - - 20,8 16 Iuca - - - - - - - - - - - - - + + - - - + + + + - - 25,0 17 Mamão - - - - + - + - + - - - - + + - + + - - + + - - 37,5 18 Mandioca - - - - - - - - + - - - + - + - + + - + + + - - 33,3 19 Manga - - - - - - - - + - - - - + + - - + + - + + - - 29,2 20 Mangaba - - - - - - - - + - - - + + - - - + - - + + - - 25,0 21 Negramina - - - - + - - - + - - - - - + - - - - - + + - - 20,8 22 Soja - - - - - + - - - - - - - + + - - + - - + + - - 25,0 23 Tomate - - - - - - - - - + - - - - - + - - - + + + - 20,8 24 Uva - - - - - - - - - + + - - + - - - + + - + + + - 33,3*Os números ordenados no cabeçalho representam os isolados fúngicos e seus hospedeiros de origem indicadosna primeira coluna vertical. Características culturais são bastante difundidas para distinguir isolados deColletotrichum sp. mas esses fatores são muitas vezes insuficientes e contraditórios, emdecorrência da elevada diversidade genética e molecular do gênero.
  • As características que melhor distinguiram os isolados foram às dimensões do conídio,formato dos conídios e a produção de apressórios lobados ou fracamente lobados. Adiferenciação entre espécies com base nas dimensões de conídios e apressórios foi dificultadapela sobreposição dos valores descritos por Sutton (1992), pois a maioria dos isoladosapresentaram dimensões dentro da faixa de variação descrita para as duas espécies, C.gloeosporioides e C. acutatum. O isolado 24 apresentou características intermediárias, com apressórios de margens lisase conídios elipsóides, e foi identificado como C. gloeosporioides por possuir tamanho dosconídios e apressórios que se enquadram na descrição desta espécie (além da coloração decolônia branca). Apesar dos isolados terem os apressórios circulares e lisos, apresentaramconídios predominantemente cilíndricos, típicos de C. gloeosporioides (Tabela 4).5.3. Caracterização bioquímica É o efeito da relação carbono/nitrogênio no crescimento micelial, esporulação e pesoseco de Colletotrichum spp. Em geral, as médias do crescimento micelial dos isolados nascombinações das fontes de carbono (dextrose, sacarose, sorbitol) e como fontes de nitrogênio(asparagina, peptona e nitrato de potássio). Esta diferença também foi observada por Tandon& Chandra (1962), para C. gloeosporioides. As combinações dextrose/ peptona e sacarose/peptona foram as que induziram maioresmédias de peso seco da massa micelial, 5,3 e 5,4 mg, respectivamente, destacando-sesignificativamente das médias das demais fontes C/N. Na combinação sacarose/peptona, nãoocorreram diferenças significativas entre os isolados, o mesmo acontecendo nas combinaçõesde dextrose/asparagina(T1) e sorbitol/peptona(T8). (Tabela 7, 8 e 9). Analisando-se os dadosdo crescimento micelial, esporulação e peso seco do micélio, constatou-se uma correlaçãopositiva entre o crescimento micelial e o peso seco do micélio, r(Pearson) = 0,5121, ou seja,os isolados que demonstraram maior habilidade de crescimento no meio sólido, tiveramtambém maior peso seco da massa micelial no meio líquido. Segundo Tandon & Chandra (1962), um bom crescimento micelial está associado auma boa esporulação. No presente estudo foi verificado que alguns isolados apresentaram boaprodução de conídios, aliada a elevado crescimento em meio sólido e líquido, confirmando osdados dos autores mencionados. Às vezes, um meio ótimo para o crescimento rápido resultana exaustão dos nutrientes e os metabólitos secundários liberados pelo fungo nesse meio,inibem a produção de esporos (GRIFFIN,1994). Por outro lado, o crescimento micelialreduzido pode estimular a esporulação naquele substrato. As principais fontes de carbono para
  • os isolados testados continham em suas combinações dextrose e sorbitol, pois os maioresvalores de AACPCM e TC foram para tratamentos que continham essas fontes de Carbono. Asacarose não demonstrou uma fonte de C eficiente para a morfofisiologia dos isolados.50 %dos isolados (árvore-da-fortuna, banana fruto, caqui e conde) apresentaram maiores valores deAACPCM para a combinação dextrose e nitrato de potássio. Trinta e oito % dos isolados(banana folha, banana fruto e caqui (folha), tiveram maiores taxas de crescimento paraisolados também submetidos a combinação de dextrose e nitrato de potássio. Os isolados deconde, chuchu e árvore da fortuna apresentaram os menores valores médios de AACPCM eTC.Tabela 7. Valores F da analise de variância dos fatores hospedeiros de origem e tratamentos e os valores dos parâmetros das variáveis dependentes peso seco de micélio e área abaixo da curva de progresso do crescimento micelial (AACPCM). Valor F Fatores Peso Seco AACPCMHospedeiro de origem 1,48ns 8,35**Tratamentos (C/N) 7,52** 3,23**Interação 0,000002ns 3,27 ns A análise de variância para o arranjo fatorial para os fatores (variáveis independentes)hospedeiros de origem, tratamentos com carbono e nitrogênio e a interação das variáveisindependentes analisou-se as medias e os desvios padrões das variáveis dependentes pesoseco de micélio e dos valores de área abaixo da curva de progresso do crescimento micelial(AACPCM), sendo que rejeitou-se a hipótese de nulidade (~0,01) para a variávelindependentes apenas para o fator tratamento C/N (F=7,52**), não rejeitando para diferençasentre hospedeiros de origem (F= 1,48ns) e interação (F=0,000002ns). Para a variáveldependente AACPCM rejeitou-se a hipótese de nulidade para as variáveis hospedeiros deorigem (F=8,35**) e tratamentos C/N (F=3,23**), não rejeitando-se a hipótese de nulidadepara interação entre os dois fatores (Tabela 7)
  • Tabela 8. Médias dos pesos secos de micélio (PS) e dos calores de área abaixo da curva de progresso do crescimento micelial (AACPCM) dos isolados submetidos a diferentes concentrações de carbono e nitrogênio (C/N). Or. Hospedeiros de origem PS (g)* Hospedeiros de origem AACPCM* 1 Mangaba 3,16 a Iuca 16,4 a 2 Negramina 3,16 ab Mandioca 15,89 a 3 Conde 3,16 ab Antúrio 15,7 ab 4 Abacate 3,16 ab Tomate 15,6 bc 5 Banana 3,16 ab Uva 15,6 bc 6 Manga 3,16 ab Chuchu 15,5 bc 7 Goiaba (folha) 3,16 ab Soja 15,3 bc 8 Falso massambará 3,16 ab Árvore da fortuna 16,3 cd 9 Caqui 3,16 ab Abacate 15,1 de 10 Antúrio 3,16 ab Coco 14,8 ef 11 Árvore da Fortuna 3,16 ab Manga 14,6 fg 12 Uva 3,16 ab Cana 14,3 fg 13 Cana 3,16 ab Dracena 14,3 gh 14 Mandioca 3,16 ab Negramina 14,1 gh 15 Goiaba (Fruto) 3,16 ab Conde 13,4 gh 16 Amora 3,16 ab Mangaba 13,4 gh 17 Banana (fruto) 3,16 ab Amora 13,1 gh 18 Iuca 3,16 ab Goiaba (fruto) 12,8 gh 19 Chuchu 3,16 ab Falso massambará 12,8 gh 20 Soja 3,16 ab Goiaba 12,7 gh 21 Tomate 3,16 ab Mamão 12,5 gh 22 Coco 3,16 ab Banana (fruta) 12,2 gh 23 Mamão 3,16 ab Banana 12,2 gh 24 Dracena 3,16 ab Caqui 11,9 h*Médias seguidas de mesma letra na vertical na diferem entre si ao teste Tukey (P~0,05) medias transformadaspor √ x+ 10
  • Tabela 9. Médias dos pesos secos do micélio (PS) e área abaixo da curva de progresso do crescimento micelial (AACPCM).Trat. Descrição PS(g)* Trat. Descrição AACPCM T3 Dextrose-nitrato de potássio 3,16 a T2 Dextrose-triptona 15 a T2 Dextrose-triptona 3,16 ab T1 Dextrose-asparagina 14,5 ab T6 Sacarose-Nitrato de potássio 3,16 ab T9 Sorbitol-Nitrato de potássio 14,4 ab T5 Sacarose-Triptona 3,16 ab T3 Dextrose-nitrato de potássio 14,4 ab T1 Dextrose-asparagina 3,16 ab T8 Sorbitol-Triptona 14,3 ab T4 Sacarose-Asparagina 3,16 bc T7 Sorbitol-Asparagina 13,9 ab T8 Sorbitol-Triptona 3,16 bc T5 Sacarose-Triptona 13,8 b T7 Sorbitol-Asparagina 3,16 c T4 Sacarose-Asparagina 13,5 b T9 Sorbitol-Nitrato de potássio 3,16 c T6 Sacarose-Nitrato de potássio 13,4 b*Médias seguidas de mesma letra na vertical na diferem entre si ao teste Tukey (P~0,05); medias transformadaspor √ x+ 105.4. Identificação de oligonucleotídeos para caracterização molecular A amplificação utilizando-se os oligonucleotídeos ITS 4, ITS 5,ACT 512F,ACT 783R,CL1, CL2, T1 e BT2b obteve reações positiva para a amplificação de DNA de 20 dos 24isolados em estudo. Quando se utilizou CL BT2b, não detectou-se amplificação dos isoladosde caqui, mamão e mandioca (isolados nº7,16e 17). (Tabela10)Com o isolado de cana (nº 6)não foi obtida amplificação com nenhum dos oligonucleotídeos testados, mesmo após seremtestadas variações nas condições da reação de PCR (temperaturas de anelamento de 55 e 60°C) e diferentes concentrações de DNA. Com o oligonucleotídeos CL, a reação deamplificação foi negativa com os isolados de chuchu e conde (nº 9 e 11). (Tabela 10) Diferentes regiões do genoma e a região ITS do rDNA, foram amplificadas com osoligonucleotídeos universais ITS 4, ITS 5,ACT 512F,ACT 783R, CL1, CL2, T1 e BT 2b,geraram um fragmentos de diferentes tamanho (~ 600 pb) região (ITS) para todos os 24isolados (Figura 1). Observado a presença de DNA na amostra após a extração, o isolado de cana-de-açúcarnão mostrou resultados positivos para nenhum do quatro pares de oligonucleotídeosutilizados. As PCRs com os oligonucleotídeos ITS4/ITS5, ACT512F/ACT783R, CL1/CL2 eT1/Bt2b apresentaram reações positiva para a amplificação de DNA de 20 dos 24 isolados emestudo.
  • ACTITS CL1 BT2B M1 2 3 4 5 B 1 2 3 4 5 B 1 2 3 4 5 B 1 2 3 4 5 B ITS ACT ACT CL1 BT2BM 6 7 9 10 11 14 15 16 6 7 9 10 11 14 15 16 6 7 9 10 11 14 15 16 6 7 9 11 14 15 16 ITS ACT CL1 BT2BM 17 18 19 20 21 22 23 24 17 18 19 20 21 22 23 24 17 18 19 20 21 22 23 24 17 18 19 20 21 22 23 24
  • Figura 10. Gel de agarose do produto de PCR dos isolados de Colletotrichum spp., utilizando os oligonucleotídeos universais ITS 4, ITS 5,ACT 512F,ACT 783R, CL1, CL2, T1 e BT2b. Os isolados que apresentaram bandas com a utilização de oligonucleotídeos especificopara Colletotrichum spp., apresentaram características culturais, morfológicas ou patogênicascomuns entre si, todos os isolados são oriundos de sua hospedeira de origem. Da mesmaforma, os isolados não apresentaram reação positiva com oligonucleotídeos CAL e BT2B,apresentaram características comuns entre si, que não pudessem explicar os resultados obtidos(Tabela10). No processo de extração de DNA os isolados oriundo de antúrio, chuchu, conde,mangaba e soja tiveram os melhores rendimentos na produção de micélio (matéria prima paraextração (Tabela 10). Os amplicons gerados a partir do ITS e ACT amplificaram 87,5% dosisolados, já 75% dos isolados foram amplificados com oligonucleotídeos gerados a partir dogene BT, e por fim, 62,5% dos isolados produziram amplicons a partir dos genes CAL.Tabela 10. Resultados da amplificação do DNA utilizando primer universais para Colletotrichum spp.
  • ProduçãoOrdem Hospedeiro de Micélio PCR ITS ACT CAL BT 1 Amora ++ + + + + 2 Antúrio +++ + + + + 3 Árvore da Fortuna + + + + + 4 Banana + + + + + 5 Banana (folha) + + + + + 6 Cana ++ - - - - 7 Caqui ++ + + - - 8 Cevadilha (F.M) - - - - 9 Chuchu +++ + + - + 10 Coco + + + + + 11 Conde +++ + + - + 12 Dracena - - - - 13 Goiaba + + + + + 14 Goiaba (folha) + + + + + 15 Iuca ++ + + + + 16 Mamão ++ + + - - 17 Mandioca + + + - - 18 Manga + + + + + 19 Mangaba +++ + + + + 20 Negramina + + + + + 21 Soja + + + + + 22 Abacate +++ + + - + 23 Tomate + + + + + 24 Uva ++ + + + +
  • 6. CONCLUSÕES Foi observado através dos isolados uma grande variabilidade fenotípica molecular. Aespécie tipo C. gloeosporioides, foi a mais freqüentemente identificada perante os isoladosanalisados Contudo, esta espécie apresenta grande variabilidade de acordo com os critériosaplicados. Os isolados apresentam comportamentos fisiológicos diferenciais ligados aparticularidades dos isolados Os comportamentos diferenciados e a agressividade promovidapelo isolados de Colletotrichum permitiram verificar o amplo e restrito espectro de virulêncialigado aos isolados estudados. As características fenotípicas dos isolados de Colletotrichum permitiram desenvolveruma análise comparativa para identificação do complexo grupo. As espécies deColletotrichum spp. oriundas de diversas hospedeiras foram identificadas considerandocaracterísticas morfológicas e morfométricas, sendo o fungo C. gloeosporioides a espéciepredominante. Foi verificado uma variabilidade quanto ao uso de fontes de C e N, evidenciando acombinação dextrose e nitrato de potássio, excluindo o uso de sacarose. Os melhores pares deoligonucleotídeos importantes para amplificação de sequencias de isolados de Colletotrichumforam ITS e Actina.7. ASPECTOS FORMATIVOS Dentre as atividades curriculares de publicação as atividades desenvolvidas foram:Participação do XXXIII Congresso Paulista de Fitopatologia 2010 de 02 a 04 de fevereiro de2010 em Ituverava-SP, apresentado os trabalhos i) Anamorfo e teleomorfo da mancha foliarde antúrio (Anthurium andraeanum - araceae), ii) Patogenicidade do Colletotrichumgloesporioides em folhas de uva, Iii) Cercospora ipomoeae incidente em campainha(Ipomoea nil.), vi) Pseudocercospora sp. Incidente em folha de mutambo (Guanxumaulmifolia - sterculiaceae) no Rio de Janeiro, v) Fase sexual e assexual de ferrugem de erva-de-santa-luzia (Chamaesyce hirta-Euphorbiae), vi) Incidência manchas foliares na cultura da uvarecebidas na clínica fitopatológica do IFG, vii) Ferrugem branca (Albugo spp.) incidentes emplantas invasoras no centro-oeste, viii) Doenças incidentes em plantas daninhas, ix)Levantamento de doenças em plantas no campus do IFG, x) Ocorrência de Phoma spincidente em folha de Buva (Coryza bonariensis - Asteraceae), xi) Incidência de Uromyces sp.em folhas de Guanxuma (Sida cordifolia- Malvaceae) na cidade de Urutaí, (CD-Room GrupoPaulista de Fitopatologia), Resumo publicado no XXXIII Congresso Paulista de
  • Fitopatologia). xi) Participei do mini curso Doenças causadas por vírus bactérias e fungos eplantas ornamentais. No período de 15 a 19 de agosto de 2010 participou do 43º CongressoBrasileiro de Fitopatologia. Neste Congresso houve apresentação dos trabalhos científicos: i)Diversidade de fungos associados a sementes e frutos de plantas do Cerrado. Tropical PlantPathology35(suplemento):176, 2010; ii) Sanidade, fisiologia e verificação datransmissibilidade de fungos associados a sementes, frutos e inflorescências de plantas doCerrado. Tropical Plant Pathology 35(suplemento):s176, 2010; iii) Estudos fisiológicos emorfo-culturais de isolados de Colletotrichum spp. Tropical Plant Pathology35(suplemento):s175, 2010; iv) Morfometria e patogenicidade de isolados de Colletotrichumspp. Tropical Plant Pathology 35(suplemento):s175, 2010; Participação VI Congresso Brasileiro de Micologia de 29 de novembro a 02 dedezembro de 2010 em Brasília-DF, apresentando o trabalho “Análise da aerobiota micológicada biblioteca do Instituto Federal Goiano Campus Urutaí”, resultado de estudos realizados noInstituto Federal Goiano, Campus Urutaí (29/11/2010 a 02/12/2010). Participou no ano de 2011 da I Semana de Ciências Agrárias, Ambientais, Alimentos eAdministração (I SICAAAA) e III Semana de Ciências Agrárias (III SECIAGRI) dos mini-cursos Recuperação de matas ciliares e áreas degradadas e Diagnose de Viroses de Plantas eministrei o mini-curso Práticas em Microbiologia de solo. No período de 14 a 19 de agosto de 2010 participou do 44º Congresso Brasileiro deFitopatologia neste, Congresso houve apresentação dos trabalhos científicos: i) Aspectosmorfológicos de isolados de Colletotrichum spp.; ii) Patogenicidade cruzada de isoladosColletotrichum gloeosporioides, C. falcatum e C. dematium, iii) Cercosporiose (Cercosporabidenticola) em picão preto (bidens pilosa) incidente na cidade de Urutaí, Go, iv) Uso defontes de carbono e nitrogênio no crescimento de isolados de Colletotrichum sppParticipei da II Jornada de Iniciação do Instituto Federal Goiano campus Urutaí, nos dias 19 e20 de outubro de 2011, com a apresentação de trabalhos i) Identificação molecular dediferentes pares de oligonucleotídeos para amplificação e reconhecimento de isolados deColletotrichum sp. ii) Patogenicidade cruzada de isolados Colletotrichum gloeosporioides, C.falcatum e C. dematium. iii) Cercosporiose (Cercospora bidenticola) em picão preto (Bidenspilosa) incidente na cidade de Urutaí, Go. iv)Uso de fontes de carbono e nitrogênio nocrescimento de isolados de Colletotrichum spp. As temáticas destes trabalhos refletem ostemas abordados pelo projeto de PIBIC e atividades desenvolvidas com colegas dolaboratório.
  • 8. REFERÊNCIAS BIBLIOGRÁFICASADASKAVEG, J. E. & HARTIN, R. J. Characterization of Colletotrichum acutatum isolatescausing anthracnose of almond and peach in California. Phytopathology 87:979-987. 1997.AGRIANUAL. São Paulo: FNP Consultoria & Agroinformativos, 2004 .324p.AGRIOS, G. N. Plant Pathology. California: Elsevier Academic Press. 5º ed, 2005. 907p.AINSWORTH, G. C. Ainsworth and Bisby’s dictionary of the fungi. 6º ed. Surrey: Kew,1971. 663p.ALAHANKOON, P. D.; BROWN, A. E.; SREENIVASAPRASAD, S. Cross-infectionpotential of genetic groups of Colletotrichum gloeosporioides on tropical fruits.Physiologicaland Molecular Plant Pathology, v.44, n.2, p. 93-103, 1994.ALVAREZ, A. M. & NISHIJIMA, W. T. Post harvest diseases of papaya. Plant Disease 71:68-686. 1987.ALZATE-MARIN, A. L.; BAÍA, G. S.; FALEIRO, F. G.; CARVALHO, G. A.; PAULAJUNIOR, T. J.; MOREIRA M. A.; BARROS E. G.; Análise da diversidade genética de raçasde Colletotrichum lindemuthianum que ocorrem em algumas regiões do Brasil pormarcadores RAPD. Fitopatologia Brasileira, v.22, n.1,p.85-88, 1997.ARMSTRONG-CHO, C.L. e BANNIZA, S. Glomerella truncate sp. nov., the teleomorph ofColletotrichum truncatum. Mycological Research, 110: 951-956, 2006.ARX, J. A. VON. Die Arten der Gattung Colletotrichum Cda. Phytopathologische Zeitschrift29: 414-468, 1957.BAILEY, J. A.; JEGER, J. M. Colletotrichum: biology, pathology control.Oxford: BritishSociety for Plant Pathology, 1992. 388p.BARBIERI, R. L.HEIDEN, H, CASTRO, C. M., DORNELLES, J. E. F., SINIGAGLIA C, S,MEDEIROS, A. R. M. resgate e conservação de variedades crioulas de cucurbitáceas do suldo brasil. Revista Brasileira. Agroecologia, v.2, n.1, fev. 2007.BAXTER, A. P., VAN DER WESTHUIZEN, G. C. A. AND EICKER, A. Morphology andtaxonomy of South African isolates of Colletotrichum. South African Journal of Botany 2:259-289, 1983.BEDENDO, I. P. Podridão de órgãos de reserva. in: BERGAMIN FILHO, A.; KIMATI, H.;AMORIM, L. (Ed.) Manual de Fitopatologia: Princípios e conceitos. 3 ed., v.1. São Paulo:Agronômica Ceres, 1995, 919p.BERGAMIN FILHO, A.; KIMATI, H. & AMORIM, L. eds. Manual de Fitopatologia. Volume1 - Princípios e Conceitos. 3ª Edição Editora Agronômica Ceres Ltda. São Paulo.920 p. 1995.BERNSTEIN B, ZEHR E. I, DEAN R. A, SHABI E. Characteristics of Colletotrichum frompeach, apple, pecan, and other hosts. Plant Disease 79:478–482, 1995.BLACK, R. J. Complexo soja: fundamentos, situação atual e perspectivas. In: Escola Superiorde Agricultura “Luiz de Queiroz”. Soja: Tecnologia de produção ll. Piracicaba: FEALQ,2000. p.1–17.BRAITHWAITE, K. S.; IRWIN, J. A. G.; MANNERS, J. M. Restriction fragment lengthpolymorphism in Colletotrichum gloeosporioides infecting Stylosanthes spp. in Austrália.Mycological Research, v.94, n. 8, p. 1129-1137,1990.
  • BROWN, A. E., SREENIVASAPRASAD, S. & TIMMER, W. L. Molecular characterizationof slow-orange key lime anthracnose strains of Colletotrichum from citrus as C. acutatum.Phytopathology 86:523-527. 1996.BROWNING, M.; ROWLEY, L. V.; ZENG, P.; CHANDLEE, J. M.; JACKSON, N.Morphological, pathogenic, and genetic comparisons of Colletotrichum graminicola isolatesfrom Poaceae. Plant Disease, V. 83, N. 3, P. 286-292, 1999.CAI, L., HYDE, K. D., TAYLOR, P. W. J., WEIR, B., WALLER, J., ABANG, M. M.,ZHANG, J. Z., YANG, Y. L., PHOULIVONG, S., LIU, Z. Y., PRIHASTUTI, H., SHIVAS, R.G., MCKENZIE, E. H. C. e JOHNSTON, P. R. A Polyphasic approach for studyingColletotrichum. Fungal Diversity 39: 183-204, 2009.CANNON, P. F., BRIDGE, P. D. e MONTE, E. Linking the past, present and future ofColletotrichum systematics. In: Colletotrichum. Host specificity, pathology and host-pathogen interaction (eds. D. Prusky, S. Freeman and M.B. Dickman). APS Press, St Paul,Minnesota: 1-20, 2000.CARRARO, I. M. Novos Desafios da Soja Brasileira: Encontro Técnico 7. Cascavel:COODETEC/BAYER CropScience, 2003. 114p.CNPH: Embrapa hortaliças: Centro Nacional de Pesquisas em Hortaliças.http://www.cnph.embrapa.br/paginas/hortalicas_em_numeros/hortalicas_em_numeros.htm.In: 22/09/2011.COCHRANE, V.W. Physiology of fungi. New York. John Wiley & Sons Inc. 1958.CORRELL, J. C.; RHOADS, D. D.; GEUBER, J. C. Examination of mitochondrial DNAfingerprints and randomly amplified polymorfhic DNA of Colletotrichum orbiculare.Phytopathology v.83, n.11, p1199-1204. 1993.CROUCH, J. A., CLARKE, B. B. e HILLMAN, B. I. Unraveling evolutionary relationshipsamong the divergent lineages of Colletotrichum causing anthracnose disease in turfgrass andcorn. Phytopathology 96: 46-60, 2006.CROUCH, J.A., TREDWAY, L.P., CLARKE, B.B. e HILLMAN, B.I. Phylogenetic andpopulation genetic divergence correspond with habitat for the pathogen Colletotrichumcereale and allied taxa across diverse grass communities. Molecular Ecology 18: 123-135,2009a.CROUCH, J. A., WHITE, J. F. JR., CLARKE, B. B. e HILLMAN, B. I. Systematic analysisof the falcate-spored graminicolous Colletotrichum and a description of six new species fromwarm season grasses. Mycologia 101: 717-732, 2009b.CROUS, P. W. Taxonomy and phylogeny of the genus Mycosphaerella and its anamorphs.Fungal Diversity 38: 1-24. 2009.CUNHA, M. M., SANTOS FILHO, H. P. & NASCIMENTO, A. S. Manga. Fitossanidade.Brasília: EMBRAPA Mandioca e Fruticultura, Cruz das Almas-BA. Brasília – EMBRAPAComunicação para Transferência de Tecnologia, Frutas do Brasil, 6, 2000.DAMM, U., WOUDENBERG, J. H. C., CANNON, P. F. e CROUS, P. W. Colletotrichumspecies with curved conidia from herbaceous hosts. Fungal Diversity 39: 45-87. (2009).DANTAS, S. A. F.; OLIVEIRA, S. M. A.; BEZERRA N. E.; PEIXOTO, C. A. & LIRA, F. C.M. L. Lignificação como um mecanismo de resistência de doença pós-colheita. Fitopatologia(Suplemento), vol. 27, palestras e resumos: XXX Congresso Brasileiro de Fitopatologia. p. S101 . 2002.
  • DARWIN, S. C.; KNAPP, S.; PERALTA, I. E. Tomatoes in the Galápagos Islands:morphology of native and introduced species of Solanum section Lycopersicon (Solanaceae).Systematics and Biodiversity 1:29-54. 2003.DEISING, H. B., WERNER, S. & WERNITZ, M. The role of fungal appressoria in plantinfection.Microbes and infection 2:1631-1641. 2000.DU, M. Z., SCHARDL, C. L., NUCKLES, E. M. e VAILLANCOURT, L. Using mating-typegene sequences for improved phylogenetic resolution of Colletotrichum species complexes.Mycologia 97: 641-58, 2005.EMBRAPA Banco de Dados Brasileiro de Micologia. Disponível em: Acessado em: 18 deoutubro de 2010.ESQUINAS-ALCÁZAR ,J.; NUEZ, F. Situación taxonómica, domesticación y difusión deltomate. In: Nuez F, (ed). El cultivo del tomate. Ediciones Mundiprensa, Madrid. 1995.FA0. A folder available on the Internet ,Disponível em: <http://apps.fao.org)>, acessado em22 december 2000.FAGUNDES, A. F.; DABUL, A. N. G.; AYUB, R. A. Aminoethoxivinilglicina no controle doamadurecimento de frutos de caqui cv. Fuyu. Revista Brasileira de Fruticultura, 28 (1): 73-75p. 2006.FARR & ROSSMAN, SBML Systematic Botany of Mycological Resources. Disponívelem:<https:// nt.ars-grin.gov>Acessado em: 18 de outubro de 2010.FARR, D. F., AIME, M. C., ROSSMAN, A. Y. e PALM, M. E. Species of Colletotrichum onAgavaceae. Mycological Research 110: 1395-1480, 2006.FEAKIN, S. D. Bananas: pest control. 3.ed. London, s.n., 1977. 126p.FERRAZ, J. F. P. Morfologia, comportamento cultural e patogenicidade de espécies deColletotrichum e Gloeosporium. Agronomia Lusitana 38:163-179. 1977.FERREIRA, E. G.; LEMOS, E. E. P.; SOUZA, F. X.; LOURENÇO, I. P.; LEDERMAN, I. E.;BEZERRA, J. E. F.; SILVA JUNIOR, J. F. da; BARROS, L. M.; RUFINO, M. S. M.;OLIVEIRA, M. E. B. Frutíferas. In: SAMPAIO, E. V. S. B.; PAREYN, F. G. C.;FIGUEIRÔA, J. M.; SANTOS JUNIOR, A. G. (Orgs.). Espécies da flora nordestina deimportância econômica potencial. Recife: Associação Plantas do Nordeste, 2005. p. 49-100.FILGUEIRA, F. A. R. Novo manual de olericultura: agrotecnologia moderna na produção ecomercialização de hortaliças. 2.ed. Viçosa : Editora UFV, 2005. 412p.FONTES, P. C. R.; SILVA, D. J. H. Produção de tomate de mesa. Viçosa: Aprenda fácil. pp.196. 2002.FORSTER, H. & ADASKAVEG, J. E. Identification of subpopulations of Colletotrichumacutatum and epidemiology of almond anthracnose in California. Phytopathology 89:1056-1065. 1999.FREEMAN, S., KATAN, T. & SHABI, E. Characterization of Colletotrichum speciesresponsible for anthracnose diseases of various fruits.Plant Disease 82:596-605. 1998.FRUPEX. Goiaba para Exportação: Procedimentos de Colheita e Pós-Colheita. Ministério daAgricultura, Abastecimento e Reforma Agrária/ Secretaria De Desenvolvimento Rural – SDR.Programa de Apoio à Produção e Exportação de Frutas, Hortaliças, Flores e PlantasOrnamentais – FRUPEX. Embrapa – SPI. Brasília, DF - 1996.GALLI, F. Manual de Fitopatologia Princípios e Conceitos vol.1 pp. 353 e 354: 1978.
  • GAYET, J. P., BLEINROTH, E. W., MATALLO, M., GARCIA, E. E. C., GARCIA, A. E.,ARDITO, E.F.G. & BORDIN, M.R. Mamão para exportação: Procedimentos de colheita epós-colheita. Ministério da Agricultura, do Abastecimento e da Reforma Agrária, Secretariade Desenvolvimento Rural, Programa de Apoio à Produção e Exportação de Frutas, Hortaliçase Plantas Ornamentais. EMBRAPA-SPI. 1995.GENÚ, P. J. C. & PINTO, A. C. Q. (Org.) A cultura da mangueira. Embrapa InformaçãoTecnológica, Brasília, 2002. 454GRIFFIN, D. H. Fungal Physiology. 2ed. New York: Willey-Liss, 1994.GUERBER, J. C., CORRELL, J. C. Characterization of Glomerella acutata, the teleomorphof Colletotrichum acutatum. Mycologia 93: 216-229. 2001.GUNNEL, P. & GUBLER, W. D. Taxonomy and morphology of Colletotrichum speciespathogenic to strawberry. Mycologia 84:157-165. 1992.GUTHRIE, P. A. I., MAGILL, C. W., FREDERICKSEN, R. A. ODVODY, G. N. Randomamplified polymorphic DNA markers: A system for identifying and differentiating isolates ofColletotrichum graminicola. Phytopathology v.82, n.8, p.832-835, 1992.HAYDEN, H. L.; PEGG, K. G.; AITKEN, E. A. B.; IRWIN, J. A. G. Genetic relationships asassessed by molecular markers and cross-infection amongstrains of Colletotrichumgloeosporioides. Australian Journal of Botany, v. 42, n. 1, p. 9-18, 1994.HENNING, A. A. manejo de doenças da soja (Glycine max Merril) Pesquisador da embrapaSoja, Londrina, PR. Informativo Abrates, vol. 19, n°3, 2009.HINDORF, H. Colletotrichum species causing anthracnose of tropical crops. Plant Pathology,Oxford, v. 39, n. 1, p. 343-366, 2000.HYDE, K. D.; CAI, L.; CANNON, P. F.; CROUCH, J. A.; CROUS, P. W.; DAMM, U.;GOODWIN, P. H.; CHEN, H. L.; JOHNSTON, P. R.; JONES, E. B. G.; LIU, Z. Y.;MCKENZIE, E. H. C.; MORIWAKI, J.; NOIREUNG, P.; PENNYCOOK, S. R.; PFENNING,L. H.; PRIHASTUTI, H.; SATO, T.; SHIVAS, R, G.; TAN, Y. P.;TAYLOR, P. W. J.; WEIR, B.S.; YANG, Y. L.; ZHANG, J. Z. Colletotrichum - names in current use. Fungal Diversity,Indonesia, v. 39, n. 1, p. 147–183, 2009.INDEX FUNGORUM Disponível em: http://www.indexfungorum.org/Names/Names.asp,acessado em 17 de julho de 2011.IRRIGAR Disponível em :<http://www.irrigar.org.br/pademb/?fr=goi&tipo=fr&new=2>,acessado em 23/07/2009.ITO, M.F.; TANAKA, M. A. S. Soja: principais doenças causadas por fungos, bactérias enematóides. Campinas: Fundação Cargill, 1993. 234p.JEFFRIES, P.; DODD, J. C.; JEGER, M. J.; & PLUMBEY, R. A. The biology and control ofColletotrichum species on tropical fruits crops. Plant Pathology 39:343-366. 1990.JEFFRIES, P.; DODD, J. C.; JEGER, M. J.; PLUMBLEY, R. A. The biology and control ofColletotrichum sp. on tropical fruit crops.Plant Pathology, v.39, p.343366, 1990.JOHNSON, D. A., CARRIS, L. M. e ROGERS, J. D. Morphological and molecularcharacterization of Colletotrichum nymphaeae and C. nupharicola sp. nov. on water-lilies(Nymphaea and Nuphar). Mycological Research 101: 641-849, 1997.JOHNSTON, P. R. e JONES D. Relationship among Colletotrichum isolates from fruit rotsassessed using rDNA sequences. Mycologia 89: 420-430, 1997.
  • JOLY, A. B. Botânica: Introdução à taxonomia vegetal. 13ª ed. São Paulo: Companhia EditoraNacional, 2002.JUNQUEIRA, N. T. V. Doenças e pragas. Cap. 9. In: Fruticultura Tropical: 6. Goiaba. PortoAlegre: Cinco Continentes, 2000.KELEMU, S.; SKINNER, D. Z.; BADEL, J. L.; MORENO, C. X., ROFDRIGUEZ, M. X.;FERNANDES, C. D.; CHARCHAR, M. J.; CHAKRABORTY, S. Genetic diversity in SouthAmerican Colletotrichum gloeosporioides isolates from Stylosanthes guianensis, a tropicalforage legume. European Journal of Plant Pathology, v.105, n.3, p. 261-272, 1999.KIMATI, H.; AMORIM, L.; REZENDE, J. A. M.; Manual de Fitopatologia.Volume 2. –Doenças Agronômica Ceres Ltda. São Paulo. 665p. 2005.KIMATI, H.; AMORIN, L.; BERGAMIN FILHO, A.; CAMARGO, L. E. A.; REZENDE, J.A. M. Manual de fitopatologia. v. 2: Doenças das Plantas Cultivadas. 3ed., São Paulo:Agronômica Ceres, 1997. 774p.KIRK, P.; CANNON, P. F.; MINTER, D. W.; STALPERS, J. A. AINSWORTH & BISBY’SDictionary of the Fungi.10th ed. CAB International, Wallingford, UK, 2008.KIRK, P. M., CANNON, P. F., DAVID, J. C., STALPERS, J. A. Dictionary of the Fungi. 9 thEd. CABI Publishing, Wallingford, UK, 2001.KOLLER, O. C. Cultura da goiabeira. Porto Alegre: Agropecuária, 1979. 44p. In: GONZAGANETO, L. Cultura da goiabeira. Petrolina, PE: EMBRAPA-CPATSA, 1990. p. 8 (EMBRAPA-CPATSA, Circular Técnica, 23).KUBO, Y., SUZUKI, K., FURUSAWA, I., ISHIDA, N. & YAMAMOTO, M. Relation ofappressorium pigmentation and penetration on nitrocellulose membranes by Colletotrichumlagenarium. Phytopathology 72:498-501. 1982.LEDERMAN, I. E.; FERREIRA JÚNIOR, J. da S.; BEZERRA, J. E. F.; ESPÍNDOLA, A. C.de M. E. Mangaba (Hancornia speciosa Gomes). Jaboticabal: Funep, 2000. 35 p.LILLY, V. G. & BARNETT, H. C. Physiology of fungi.New York. McGraw-Hill, 1951.LIU, X.Y., DUAN, J.X. AND XIE, X.M. Colletotrichum yunnanense sp. nov., a newendophytic species from Buxus sp. Mycotaxon 100: 137-144, 2007.LOPEZ, A. M. Q. Doenças das anonáceas e do urucuzeiro (Annona sp. e Bixa orellana). In:KIMATI, H.; AMORIM, L.; BERGAMIN FILHO, A.; CAMARGO, L.E.A.; REZENDE,J.A.M. (Eds.) Manual de fitopatologia: doenças das plantas cultivadas. 4. ed. São Paulo:Agronômica Ceres, 2005. v.2, p. 74.LOPEZ, A. M. Q. Taxonomia, patogênese e controle de espécies do gênero Colletotrichum.Revisão Anual de Patologia de Plantas - RAPP, [S.l.], v. 9, p. 291-338, 2001.LORENZI, H. & SOUZA, H. M. Plantas ornamentais no Brasil, Arbustivas, herbáceas etrepadeiras. 3ª Ed. Nova Odessa- SP, Instituto Plantarum, 2001.LORENZI, H. Plantas daninhas do Brasil: terrestres, aquáticas, parasitas, tóxicas emedicinais. 2.ed. Nova Odessa, SP: Plantarum. 440p. 1991.MASIA, A.; VENTURA, M.; GEMMA, H.; SANSAVINI, S. Effect of some plant growthregulator tretments on apple fruit ripening. Plant Growth Regulation, 25 (2): 127-134p. 1998.MASSOLA JUNIOR, N. S.; BEDENDO, I. P. Doenças da mandioca. p. 449. In: Edição deKIMATI, H.; AMORIM, L.; REZENDE, J. A. M.; BERGAMIN FILHO, A.; CAMARGO,
  • L.E.A. Manual de fitopatologia - Volume 2 - Doenças das plantas cultivadas. 4. ed. São Paulo:Agronômica Ceres, 2005. p.663.MENDES, M. A. S.; SILVA, V. L.; DIANESE, J. C; FERREIRA, M. A. S. V; SANTOS, C. E.N.; GOMES NETO, E., URBEN, A. F.; CASTRO, C. Fungos em plantas no brasil, Brasília;Cernargen, 1998. 555p.MENEZES, M. & HANLIN, R. T. Morphological variability of Colletotrichumgloeosporioides isolates from avocado trees from northeast Brazil. Revista de Microbiologia27:228-236. 1996.MENEZES, M. Aspectos biológicos e taxonômicos de espécies do gênero Colletotrichum.Fitopatologia Brasileira, v.27 (supl.), p.23-24, 2002.MESQUITA, A. G. G.; FALEIRO, F. G.; PAULA Júnior, T. J.; RAGAGNIN, V. A.;MOREIRA, M. A.; BARROS, E. G. Use of molecular markers to differentiate Colletotrichumlindemuthianum races 89 and 69. Fitopatologia Brasileira, v. 23, n.1, p.58-61, 1998.MICHEREFF, S. J. Fungos como agentes de doença de plantas. Universidade Federal deRural de Pernambuco, Departamento de Agronomia – Área de Fitossanidade Fitopatologia I,1997.MICHEREFF, S. J, Etiologia e Classificação de patógenos. Documento didático. Disponívelem:<http://74.125.93.132/search?q=cache%3A7VcvzYiWWM4J%3Awww.fag.edu.br%2Fprofessores%2Fsmtrento%2FT03.pdf+acidentais%3A+s%C3%A3o+aqueles+organismos+sapr%C3%B3fitas+que+em+determinadas+condi%C3%A7%C3%B5es+podem+exercer+o+parasitismo+michereff&hl=pt-BR&gl=br >,acessado em julho de 2009.MIRANDA , M. A.; DEL-VECHIO VIEIRA, G; ALVES, M. S.; YAMAMOTO, C. H.;PINHO, J. J. R. G.; SOUSA, O. V.; Uso etnomedicinal do chá de Morus nigra L. notratamento dos sintomas do climatério de mulheres de Muriaé, Minas Gerais, Brasil. HURevista, , v. 36, n. 1, p. 61-68, 2010.MITCHELL, J. D.; MORI, S. A. The cashew and its relatives (Anacardium: Anacardiaceae).Memories on the New York botanical garden, v.42, p.1-76, 1987.MORIWAKI, J., SATO, T. e TSUKIBOSHI, T. Morphological and molecular characterizationof Colletotrichum boninense sp. nov. from Japan. Mycoscience 44: 47-53, 2003.MOZAMBANI, A. E.; PINTO, A. S.; SEGATO, S. V.; MATTIUZ, C. F. M. Histórico emorfologia da cana-de-açúcar, p. 12. In: SEGATO, S. V.; PINTO, A. S.; JENDIROBA, E.;NÓBREGA, J. C. M. (Organizadores). Atualização em produção em cana-de-açúcar.Piracicaba: CP, 2006. 415 p.MOZAMBANI, A. E.; PINTO, A. S.; SEGATO, S. V.; MATTIUZ, C. F. M. Histórico emorfologia da cana-de-açúcar, p. 12. In: SEGATO, S. V.; PINTO, A. S.; JENDIROBA, E.;NÓBREGA, J. C. M. (Organizadores). Atualização em produção em cana-de-açúcar.Piracicaba: CP, 2006. 415 p.NAG RAG, T. R. Coelomycetous Anamorphs with Appendage-BearIng Conidia. MycologuePublications, Waterloo, Ontario, Canada, 1101p., 1993.NAKAMURA, M., OHZONO, M., IWAI, H. e ARAI, K. Anthracnose of Sansevieriatrifasciata caused by Colletotrichum sansevieriae sp. nov. Journal of General Plant Pathology72: 253-256, 2006.
  • NERY-SILVA, F. A, MACHADO, J. C, LIMA, L. C. O. RESENDE, M. L. V. Controlequímico da podridão peduncular de mamão causada por Colletotrichum gloeosporioides.Ciência Agrotécnica, Lavras, v.25, n.3, p.519-524, maio/jun., 2001.OLIVEIRA, A. A. R., BARBOSA, C. J., SANTOS FILHO, H. P. & MEISSNER FILHO, P. E.Mamão Produção: Aspectos Técnicos. Embrapa Mandioca Fruticultura. Cruz das Almas, BA.– Brasília: Embrapa Comunicação para Transferência de Tecnologia. Brasília. 2000.PARMAGNANI, R. M. Projeto de pesquisa financiado pelo CNPq (Projeto 478625/2004-9, Edital Universal Comunicado Exemplares desta edição podem ser adquiridos na: Técnico,35 Embrapa Hortaliças.2004.PERALTA, E. R.; KNAPP, S.; SPOONER, D. M.; New species of wild tomatoes (SolanumLycopersicon: Solanaceae) from Northern Peru. Systematic Botany 30:424-434. 2005.RICK, C.M., HOLLE, M. Andean Lycopersicon esculentum var. cerasiforme: Geneticvariation and its evolutionary significance Economic Botany 44:69-78. 1990.PERES, N. A. R., SOUZA, N. L., ZITKO, S. E., e TIMMER, L. W. Activity of Benomyl forcontrol of post bloom fruit drop of citrus caused by Colletotrichum acutatum. Plant Disease,v. 86,.620-624, 2002.PERES, N. A.; TIMMER, L. W.; ADASKAVEG, J. E.; CORREL, J. C. Lifestyles ofColletotrichum acutatum. Plant Disease, v. 89, n° 8, p. 784-796, 2005.PFENNIG, D. W., HARPER, G. R., JR., BRUMO, A. F., HARCOMBE, W. R. & PFENNIG,K. S. Population differences in predation on Batesian mimics in allopatry with their model:selection against mimics is strongest when they are common. Behavioral Ecology andSociobiology 61, 505-511, 2007.PHOULIVONG, S.; C. A. I, L.; CHEN, H.; MCKENZIE E. H. C.; ABDELSALAM, K.;CHUKEATIROTE, E.; HYDE, K. D. Colletotrichum gloeosporioides is not a commonpathogen on tropical fruits. Fungal Diversity, Indonesia, v. 44, n.1, p. 33-43, 2010.PRIHASTUTI, H., CAI, L., CHEN, H., MCKENZIE, E. H. C, HYDE, K. D. Characterizationof Colletotrichum species associated with coffee berries in Chiang Mai, Thailand. FungalDiversity 39: 89-109. 2009.RAGO, A. & TOKESHI, H. Doenças da Cana-de-açúcar In: KIMATI, H.; AMORIM, L.;BERGAMIN FILHO, A.; CAMARGO, L. E. A.; REZENDE, J. A. M. (Eds.) Manual defitopatologia: doenças das plantas cultivadas. 4. ed. São Paulo: Agronômica Ceres, 2005. v.2,p. 185-196.RAIZER, A. J. Interações genótipos x ambientes e estabilidade fenotípica em novasvariedades de cana-de-açúcar (Saccharum spp.) para o Estado de São Paulo. Piracicaba:ESALQ, 1998. 104 p. Dissertação de Mestrado.REETZ, E. R. Anuário Brasileiro da Fruticultura. Ed. Gazeta Santa Cruz, Santa Cruz do Sul,Brasil, 136pp. 2007.REIS, A. Embrapa Hortaliças Brasília, DF; Principais doenças do Chuchuzeiro no Brasil:Brasília, DF Brasília, DF Junho, 2008.RENNER, S.S. Laurales. Complement, Post-C3 (Lytic) Pathway-Encyclopedia of LifeSciences. St. Louis US: Macmillan Reference Ltd, 1997. 5p.RENNER, S.S.; HAUSNER, G. Monograph of Siparunaceae: Flora Neotropica 95. NewYork: New York Botanical Garden, 2005. 256p.
  • REZENDE, J. A. M.; KIMATI, H.; AMORIM, L.; BERGAMIN FILHO, A.; CAMARGO, L.E. A.; Manual de fitopatologia: Doenças das plantas cultivadas. 4ª Ed. Vol. 2, pág. 542 – SãoPaulo: Agronômica Ceres, 2005.RUEHLE, G.D. E. l Cultivo de la guayaba em la Flórida. Agriculture Tropical. v.20, n.10,p.555-564, 1964. In: GONZAGA NETO, L. Cultura da goiabeira. Petrolina, PE:EMBRAPACPATSA, 1990. p. 8 (EMBRAPA-CPATSA, Circular Técnica, 23).SANTIAGO, A. D.; ROSSETTO, R. Disponível em http://www.agencia.cnptia.embrapa.br/gestor/cana-de-acucar Acessado em 30 de junho de 2010.SARRIA, S. D., 1998. Comportamento pós-colheita de caqui (Diospyros kaki): Avaliaçãofísica e química. Dissertação de Mestrado, Universidade Estadual de Campinas, Brasil, 72pp.SEAGRI., HTTP:// WWW.seagri.ba.gov.br/defaut.asp. Consultado em outubro de 2002.SERRA, I. M. R. S.; COELHO, R. S. B.; MENEZES, M. Caracterização fisiológica,patogênica e análise isoenzimática de isolados monospóricos e multispóricos deColletotrichum gloeosporioides. Summa Phytopathologica, Jaboticabal, v. 34, n. 2, 2008.SERRA, I. M. R. S., COELHO, R. S. B; MENEZES, M. M. Caracterização fisiológica,patogênica e análise isoenzimática de isolados monospóricos e multiespóricos deColletotrichum gloeosporioides. Universidade Federal Rural de Pernambuco, UFRPE,Departamento de Agronomia / Fitossanidade. Summaphytopathol. vol.34 no.2 Botucatu Apr./June 2008.SHENOY, B. D., JEEWON, R, HYDE, K. D. Impact of DNA sequence-data on the taxonomyof anamorphic fungi. Fungal Diversity, 26, 1–54. 2007c.SHENOY, B. D., JEEWON, R. AND HYDE, K. D. Impact of DNA sequence-data on thetaxonomy of anamorphic fungi. Fungal Diversity 26: 1-54, 2007a.SHENOY, B. D., JEEWON, R., LAM, W. H., BHAT, D. J., THAN, P. P., TAYLOR, P. W. J. eHYDE, K. D. Morphomolecular characterisation and epytypication of Colletotrichum capsici(Glomerellaceae, Sordariomycetes), the causative agent of anthracnose in chilli. FungalDiversity 27: 197-211, 2007b.SILVA JUNIOR, J. F. Recursos genéticos da mangabeira nos Tabuleiros Costeiros e BaixadaLitorânea do Nordeste do Brasil. In: SIMPÓSIO BRASILEIRO SOBRE A CULTURA DAMANGABA, 1., 2003, Aracaju, SE. Anais. Aracaju: Embrapa Tabuleiros Costeiros, 2003.CD-ROM.SILVA, D. B.; SILVA, J. A.; JUNQUEIRA, N. T. V.; ANDRADE, L. R. M. Frutas do cerrado.Brasília: Embrapa Informação Tecnológica, 2001. 179 p.SILVA, K. J. D. Distribuição e caracterização de isolados de Colletotrichum lindemuthianumno Brasil. Dissertação (Mestrado em Genética e melhoramento de Plantas) - UniversidadeFederal de Lavras, Lavras, MG, 2004. 86 p.SINGH, H. P.; GANAPATHY, K. M.; BHAT, D. N. Y. Studies on fixation of optimun maturitystandard for harvest of passion fruit (Passiflora edulis Sims.).The Indian Journal ofHorticulture, v.35, n.4, p.314-320, 1978.SIVANESAN, A, e HSIEH, W. H. A new ascomycete, Glomerella septospora sp. nov. and itscoelomycete anamorph, Colletotrichum taiwanense sp. nov. from Taiwan. MycologicalResearch 97: 1523-1529, 1993.
  • SIVANESAN, A. AND HSIEH, W. H. A new ascomycete, Glomerella septospora sp. nov. andits coelomycete anamorph, Colletotrichum taiwanense sp. nov. from Taiwan. MycologicalResearch 97: 1523-1529, 1993.SKIPP, R. A.; BEEVER, R. E.; SHARROCK, K. R.; RIKKERINK, E. H. A. &TEMPLETON, M. D. Colletotrichum. In: KOHMOTO, K.; SINGH, U. S. & SINGH, R. P.(Ed.) Phatogenesis and host specificity in plant diseases. Oxford, Pergamon/Elsevier Sci.Ltda. public. vol. II, 1995. p. 119-242.SOUSA, C. S.; SILVA, S. A.; COSTA, M. A. P. C.; DANTAS, A. C.V. L.; FONSECA, A. A.;COSTA, C. A. L. C.; ALMEIDA, W. A. B.; PEIXOTO, C. P. A. Mangaba: perspectivas epotencialidades, Bahia Agrícola, v.7, n.1, set. 2005 p. 29-31.SOUZA, J. C.; REIS, P. R. Principais pragas do tomate para mesa: bioecologia, dano econtrole. Informe Agropecuário 24:79-92. 2003.SREENIVASAPRASAD, S.; TALHINHAS, P. Genotypic and phenotypic diversity inColletotrichum acutatum, a cosmopolitan pathogen causing anthracnose on a wide range ofhosts.Molecular. Plant Pathology, Oxford, v. 6, n. 1, p. 361-378, 2005.STOVER, R. H. Banana, plantain and abaca diseases. CMI, Kew, Surrey, England, 1972.SUTTON, B. C. The Coelomycetes. Fungi imperfecti with pycnidia acervuli and stromata.Kew: Commonwealth Mycological Institute, 1980. 696p.SUTTON, B. C The genus Glomerella and its anamorph Colletotrichum. In BAILEY, J. A,JEGER, M. J. Colletotrichum: Biology pathology and control. British Society for PlantPathology, CAB International, 1992.TANDON, R. N. & CHANDRA, S. The nutrition of Colletotrichum gloeosporioidesPENZ.Mycopathology et. Mycology Applied 18:213-224. 1962.TATAGIBA, J. S., LIBERATO, JR., ZAMBOLIM, L, VENTURA J. A & COSTA H. Controlee condições climáticas favoráveis à antracnose do mamoeiro. Instituto Capixaba de Pesquisa,Assistência Técnica e Extensão Rural, Departamento de Fitopatologia, Universidade Federalde Viçosa, MG. Aceito para publicação em 31/01/2002.TEBEEST, D. O., SHILLING, C. W., HOPKINS, R. L. & WEIDEMANN, G. J. The numberof nuclei in spores of three species of Colletotrichum. Mycologia 81:147-149. 1989.THOMSEN, C.; ALVIZOURI, M. M. Differential effects of satured and monounsatured fattyacids on postprandial lipidemia and incretin responses in healthy subjects.American Journalof Clinical Nutrition, 69: 1135-1143, 1999.TODA FRUTA. Núcleo de Estudo-UFLA Minas Gerais, 2007. Disponívelem:http://www.todafruta.com.br/portalicNoticiaAberta.asp?diNoticia=1381Acesso em:29out2011.TOZZE JR., H. J., MELLO, M. B. A. & MASSOLA JR., N. S. Morphological andphysiological characterization of Colletotrichum sp. isolates from solanaceous crops. SummaPhytopathologica 32:71-79. 2006.VALE, F. X. R.; FERNANDES FILHO, E. I.; LIBERATO, J. R. A software plant diseaseseverity assessment. In: INTERNATIONAL CONGRESSOF PLANT PATHOLOGY,8., 2009,Christchurch. Proceedings. Christchurch: [International Society forPlant Pathology], 2009.p.105.VAZ P. C., Irrigação localizada por microaspersão em videira (Vitissp.) na região de Ipameri,Monografia de final de curso, Instituto Federal Goiano, Urutaí,GO 2008.
  • VERAS, S. M., GASPAROTTO, L. & MENEZES, M. Avaliação isoenzimática deColletotrichum guaranicola. Arquivos de Biologia e Tecnologia do Paraná 40:548-553. 1997.VIANA, F. M. P.; FREIRE, F. C. O.; CAL VIDAL, J. E. C. J. Principais Doenças doMaracujazeiro na Região Nordeste e seu Controle. Fortaleza, CE. 2007.VILARINHOS, A. D.; PAULA JÚNIOR, T. J. de; BARROS, E. G. de; MOREIRA, M. A.Characterization of races of Colletotrichum lindemuthianum by the randon amplifiedpolymorfhic DNA technique. Fitopatologia Brasileira, v.20, n. 2. p. 195 -198, 1995.WALLER, J. M. Colletotrichum diseases of perennial and other cash crops. In BAILEY, J.A;JEGER, M. J. Colletotrichum: biology, pathology and control Oxon: CAB Int., 1992, p. 167-185.YANG, Y. L., LIU, Z. Y., CAI, L., HYDE, K. D., YU, Z. N, MCKENZIE, E. H. C.Colletotrichum anthracnose of Amaryllidaceae. Fungal Diversity 39: 123-146. 2009.ZAMBOLIN, L., RIBEIRO DO VALE, F. X. Perdas ocasionadas pelas doenças de plantas.Informe Agropecuário. Belo Horizonte, v.11, n.131, p.56- 64, nov. 1985.