La LOMCE encuatro puntosPágina 5PERIÓDICO DE ASAMBLEAS DEL 15M Nº 15 – JUNIO 2013EJEMPLAR GRATUITOhttp://madrid.tomalosbar...
2 madrid15m Junio de 2013 | Nº 15ESPECIAL 12M MAYO GLOBAL12M15M:La ciudadaníacontinúa tomandolas plazas dosaños despuésTex...
3madrid15m Junio de 2013 | Nº 15ESPECIAL 12M MAYO GLOBALtencia de las ágoras. Después del gritomudo en Sol tomamos las pla...
4 madrid15m Junio de 2013 | Nº 15ESPECIAL 12M MAYO GLOBALSan Isidro el indignadoDespués de 2 meses preparan-do sin cesar, ...
5madrid15m Junio de 2013 | Nº 15ESPECIAL 12M MAYO GLOBAL // TEMAS9M. Toque a Bankia:cansinismo contra el capitalLa acción ...
6 madrid15m Junio de 2013 | Nº 15VIVIENDAUna nueva forma de movilización:en junio huelga de hipotecas¿Por qué una huelgade...
7madrid15m Junio de 2013 | Nº 15VIVIENDAÚltimos días para pedir la suspensión de lasejecuciones hipotecarias por cláusulas...
15M MADRID COMUNIDAD8 madrid15m Junio de 2013 | Nº 15Éxito de la Consultapor la Sanidad986.476 personas votaron en 104 mun...
915M MADRID COMUNIDADmadrid15m Junio de 2013 | Nº 15Si los de abajo nos movemos,los de arriba se caenVíctima de un tumor c...
1015M MADRID COMUNIDADmadrid15m Junio de 2013 | Nº 15No te quedes en casa,podrían quitártelaAcción social en GetafeContra ...
1115M MADRID COMUNIDADmadrid15m Junio de 2013 | Nº 15Soy un ni-ni: Ni me callo,ni me aguantoLa PAH de la Sierra Nortehace ...
1215M MADRID COMUNIDADmadrid15m Junio de 2013 | Nº 15Si creéis que la educación escara, probad con la ignoranciaNace Agita...
1315M MADRID COMUNIDADmadrid15m Junio de 2013 | Nº 15Ninis, ni ignorantes,ni indiferentesMEDIOAMBIENTE SOLLa Comunidad de ...
Periódico de las asambleas de Madrid, Madrid15M  nº15 junio 2013
Periódico de las asambleas de Madrid, Madrid15M  nº15 junio 2013
Periódico de las asambleas de Madrid, Madrid15M  nº15 junio 2013
Periódico de las asambleas de Madrid, Madrid15M  nº15 junio 2013
Periódico de las asambleas de Madrid, Madrid15M  nº15 junio 2013
Periódico de las asambleas de Madrid, Madrid15M  nº15 junio 2013
Periódico de las asambleas de Madrid, Madrid15M  nº15 junio 2013
Periódico de las asambleas de Madrid, Madrid15M  nº15 junio 2013
Periódico de las asambleas de Madrid, Madrid15M  nº15 junio 2013
Periódico de las asambleas de Madrid, Madrid15M  nº15 junio 2013
Periódico de las asambleas de Madrid, Madrid15M  nº15 junio 2013
Upcoming SlideShare
Loading in …5
×

Periódico de las asambleas de Madrid, Madrid15M nº15 junio 2013

367 views

Published on

Periódico de las asambleas de Madrid, Madrid15M nº15 junio 2013

Published in: News & Politics
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
367
On SlideShare
0
From Embeds
0
Number of Embeds
3
Actions
Shares
0
Downloads
1
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Periódico de las asambleas de Madrid, Madrid15M nº15 junio 2013

  1. 1. La LOMCE encuatro puntosPágina 5PERIÓDICO DE ASAMBLEAS DEL 15M Nº 15 – JUNIO 2013EJEMPLAR GRATUITOhttp://madrid.tomalosbarrios.net www.madrid15m.org http://madrid.tomalaplaza.netredaccion@madrid15m.org administracion@madrid15m.org@madrid15mmadrid15mmadrid15mDerechos HumanosDetenidos en sus domicilios dosfotógrafos que cubren convocatoriasde movimientos sociales Página 15MayoGlobal:éxito de la marchay asistencia masivaa las ágorasPáginas 2 y 3AcciónsocialenGetafe:contralosabusosbancarios,sísepuedePágina 10LibertadespolíticasenrealidadvirtualPágina 17Llamamiento:BlockupyFrankfurt!Página 18José Mª Fernández SeijoLegislar deespaldas a la gentePágina 23Stéphane M. GruesoEl 15M: primero fueun enamoramiento,ahora toca una vida encomún Página 23CONSULTASANIDAD4ojos.comUnmillónderazonesparalasanidadpúblicaPágina 816 de junio: últimodía para pedir lasuspensión delas ejecucioneshipotecariaspor cláusulasabusivasPágina 716666 dddddddddeeeeeeeee jjjjjjjjjuuuuuuunnnio
  2. 2. 2 madrid15m Junio de 2013 | Nº 15ESPECIAL 12M MAYO GLOBAL12M15M:La ciudadaníacontinúa tomandolas plazas dosaños despuésTexto: Grupo de Comunicación de la asamblea de coor-dinación de Mayo Global 2013Una manifestación ha reunido a decenas demiles de personas en Madrid cuando se cum-plen dos años de la explosión de política en lasplazas que comenzó el 15 de mayo de 2011. Lamarcha ha transcurrido, como viene siendohabitual, en forma de varias columnas desdedistintos barrios. Éstas han confluido entre Al-caláyCibeles,dondesehainiciadolamanifes-tación conjunta hasta la Puerta del Sol. La di-versidad, tanto en edades como procedencias,así como un ambiente de hartazgo y potencia,ha marcado la jornada, donde el grito más re-petido ha sido «¡sí se puede!».La movilización ha contado con la parti-cipación de personas vinculadas a las asam-bleas populares de barrios y pueblos, a lasMareas Verde y Blanca, a la Plataforma deAfectados por la Hipoteca (PAH) y gente atítulo individual. No había sido comunicadapor cauces administrativos entendiendo quecon la comunicación pública es suficiente pa-ra que la Delegación del Gobierno pueda pro-teger el derecho de manifestación de la ciu-dadanía.Al llegar a Sol, se han presentado los re-sultados de la Consulta por la Sanidad, cele-brada en la Comunidad de Madrid entre el 5y el 10 de mayo, en la que 929.903 personas(el 99,4% de las participantes) han mostra-do su respaldo a la sanidad de gestión públi-ca, universal y de calidad. Después, más de30 asambleas de barrios y pueblos han orga-nizado asambleas simultáneas en las plazascercanas a Sol con el lema «Toma tu Ágora».Además del éxito de participación en laconsulta sanitaria, la manifestación se ha ins-crito en una semana marcada por diferentesacciones promovidas desde la sociedad civil,en las que se ha logrado, entre otras cosas, re-trasar la aprobación de la LOMCE o bloquearde manera simbólica y creativa más de cua-renta sucursales de Bankia. Igualmente, es-ta semana las PAH han seguido paralizandodesahucios y se han logrado varias victoriasjudiciales: la imputación por el escrache aSoraya Sáenz de Santamaría ha sido archiva-da por el juez sin ver indicio de delito o falta,otra jueza ha rechazado el desalojo de un edi-ficio del SAREB ocupado por la PAH de Sa-badell alegando el artículo 33.2 de la Cons-titución, y, finalmente, la Fiscalía de Madridinvestigará las identificaciones aleatoriasefectuadas por la Policía durante la concen-tración del 25S.Al margen de la movilización de Madrid,ha habido una treintena de manifestacionesmás en distintas ciudades. De nuevo, las deBarcelona, Valencia y Sevilla han sido las másnumerosas. ■El 12M llenamosSol y desbordamoslas plazasTexto: Toma TuÁgoraEl 12 de mayo se incorporó a lamanifestación del aniversariodel 15M la propuesta Toma TuÁgora, consensuada en la Asam-blea de Barrios y Pueblos de Ma-drid (APM) después de variasrondas de reformulación y deba-te. Participaron también los gru-pos de trabajo de Política a Cor-to Plazo y Tribunal Ciudadanode Justicia.Así, Toma Tu Ágora se con-solidó como una idea colectivaque el 15M de Madrid saca a lascalles por primera vez y, con to-do lo mejorable, pensamos queha sido un éxito en muchos sen-tidos.La idea fundamental consis-tía en llevar las asambleas a lagente, aprovechando la oportu-nidad de la manifestación paraocupar las plazas y generar espa-cios donde las personas compro-metidas con la lucha social y laspersonas indignadas no organi-zadas pudieran compartir y pro-fundizar en cuatro aspectos bási-cos: los logros de estos dos años,lo que no nos gusta, lo que que-remos y los cauces de participa-ción y lucha.Desde los barrios y pueblosdel sur se organizó una comidapopular y la marcha fue inau-gurada por la Batucaña, que hi-zo una labor magistral en la di-rección de la manifestación y lareconducción al ágora del sur,donde se colocó frente al palaciounaguillotina.Almismotiempo,a lo largo de la manifestación ydurante la hora de permanenciaen Sol, las Brigadas Informativaspasaban con los megáfonos y lospanfletosparacomunicarlaexis-La Puerta del Sol, repleta de nuevo. DAVID FERNÁNDEZMayo 2011. JAVIER BAULUZ / PERIODISMO HUMANO
  3. 3. 3madrid15m Junio de 2013 | Nº 15ESPECIAL 12M MAYO GLOBALtencia de las ágoras. Después del gritomudo en Sol tomamos las plazas pa-ra generar espacios abiertos donde ca-da voz se convirtiera en la voz de todas.Los grupos participantes se estima-banenunos30ysecontabilizaronunoscincuenta. Los grupos de dinamizaciónnodabancréditoalverllegarmásgentedelaquesehabíanimaginado.Lagenteacudióareunirseytomólasplazasparahablar a pesar del cansancio, de ser do-mingo y de ser ya la hora de la cena...la gente expresó así su deseo de orga-nizarse colectivamente más allá de laqueja.Endosañosaprendiendoenlaspla-zas, hemos descubierto que unidas y or-ganizadas multiplicamos nuestras fuer-zas. Tanto el periódico Madrid15M,como Ágora Sol Radio, los grupos decomunicación de las asambleas del15M, el grupo de coordinación de Ma-yo Global y las personas individualesque difundieron la acción fueron fun-damentales para el éxito de las Ágoras.Se tomaron seis plazas y la partici-pación rebasó todas las expectativas. Seocuparon las plazas de Callao, Las Des-calzas, El Carmen, Santa Ana, Ópera yPalacio de Oriente. En el caso de algu-nas de las ágoras la participación depersonas no organizadas fue escasa, enunoscasospordificultadesdelasperso-nasindividualesalahoradeatreverseahablar en público, en otras por dificul-tades de dinamización y en otras por lacantidad de logros volcados que traíanlas asambleas, o por la cantidad de gen-te que había. En la reunión de evalua-ción del pasado día 20 se comentó, porejemplo, la intervención de una jovende 15 años que decía temer las pers-pectivas de futuro de su generación yllamaba a la unidad y la autogestión.El ágora de Palacio de Oriente se cerrócon un enorme abrazo colectivo que re-lanzó el entusiasmo de los participan-tes. Éste fue quizá el mayor logro de laságoras: revitalizar el motor de la lucha,el entusiasmo y la alegría de compartiren las plazas.Las ágoras probaron que las herra-mientas creadas por el 15M funcionan,que la APM funciona, que el 15M pue-de lograr objetivos concretos, reunirsees el primero, y que tiene un gran po-der de convocatoria y de unión. Esto esposible porque lo creamos las personasy no una organización o un movimien-to externo.Herramientas de comunicaciónpara trabajar la propuesta que si-guen operativas: Twitter @Toma-TuAgora15M, email agorasenlaspla-zas15m@gmail.com y usuario deFacebook Ágoras en las Plazas. Os in-vitamos a la próxima reunión que seráel 20 de junio en Pontejos, a las siete ymedia de la tarde, para revisar el tra-bajo reflejado en las actas, la continui-dad y los objetivos concretos de Tomatu Ágora, de modo que pueda ser re-formulada y relanzada por las asam-bleas de Madrid. ■Ágora en Callao. ÁLVARO MINGUITOLas ágoras probaron que las herramientas creadas por el 15M funcionan. ALDOLFO LUJÁNEl 15M sigue teniendo gran poder de convocatoria. SANTI OCHOA«Sí se puede», el grito más repetido. PATRICIO REALPELa lucha contra los desahucios ha estado muy presente. ADOLFO LUJÁN
  4. 4. 4 madrid15m Junio de 2013 | Nº 15ESPECIAL 12M MAYO GLOBALSan Isidro el indignadoDespués de 2 meses preparan-do sin cesar, por fin llegó el 15de mayo. El día estaba lleno deincertidumbres (climatología,participación, reacción guber-namental y policial, etc.), asíque a las diez de la mañana elequipo motor estaba a pie deMadrid Río preparándose conun buen desayuno e improvi-sando qué hacer en caso de lllu-via permanente.A las 11 empezaron a llegar,sobre todo, medios de comuni-cación, radio, prensa escrita yhasta televisión, al mismo tiem-po que la zona de actividadesempezaba a vestirse de fiesta yreivindicación.Y por fin, a las 12:15 comen-zó la actividad estrella de la ma-ñana. El ya conocido Pasaca-lles de Gatoflautas y Chulapos ychulapas Indignadas. Nos cogiópor sorpresa la gran cantidad degente que allí iba congregándo-se. Charangas, batukadas y lasqueridísimas chulapas con suschotis indignados agrupabancada minuto a más y más gente.Hasta las televisiones retransmi-tían en directo para sus canalesestatales. Amor, humor y su-rrealismo en estado puro, así escomoentendemoslacelebraciónde San Isidro Indignado, ¡Toma elRío!MadridRíosellenódenotasmusicales que hablan de quiénessomos, qué defendemos y cómohacemos las cosas. Y al finalizarel recorrido del pasacalles, en lazona de actividades ya estabanpreparados los Ayuntañecos,grandes defensores del derechoalacríticayalarisacomoinstru-mento de reflexión. Allí nos es-perabanEsperanzaTelita,RoucoFranela, Narciso de Trapo, San-chezGordHiloy,cómono,Agen-te Velcro, para contarnos, con lamás exquisita acidez, la realidadde esta sociedad.Después de tanta actividad,encuentros, abrazos y risas nosentró hambre e hicimos de la co-mida de traje un momento paracompartir experiencias, celebrarreencuentros y conocer a nuevaspersonas al ritmo de música endirecto tan variopinta como clá-sicos del rock, jazz, etc. Y sobrelas 16:00 llegó la segunda activi-dad estrella del día: el concierta-zo de nuestra querida Sólfónica.Una vez más elevaron nuestrasvoces, lágrimas, aplausos y gri-tos de «¡Sí se puede!» al infinitode nuestros corazones. Qué granregalo para el alma simplementeobservar a peques y mayores dis-frutar y emocionarse con los queya son nuestros clásicos del 15Mcomo Los cuatro muleros, Cantoa la libertad, Rianxeira, Canciónde Pueblo y Bienvenido Mr. Mar-shall.Durante todo el día estuvie-ron presentes diversas exposi-ciones, como la pintoresca Casassin gente y gente sin casas de StopDesahucios y la versión del fa-moso cuadro de Picasso, el Guer-nica,alestiloMareaBlanca.Has-ta tendimos los Trapos sucios alSol, donde las pinzas sujetabanimágenes y textos que ponen demanifiesto el desmantelamien-to de nuestros derechos y, cómono, a los y las responsables deeste robo a la dignidad humana.Peques y mayores pudieron dis-frutardurantetodalajornadadediversos talleres como el de Se-millerosoeldePoesíaparatodosy todas. Con la participación deasambleas populares, colectivosy demás familia 15M, consegui-mos hacer de este segundo cum-pleaños un día que recordar conagradecimiento y felicidad.Una vez más, San Isidro In-dignado, ¡Toma el Río! se con-virtió en nuestra tarjeta de pre-sentación quincemayista, en unescenario diferente de participa-ciónydeacercamientoalasocie-dad en general. Fuimos ejemplode saber decir y hacer. Por todoello, una vez más escribimos uninmenso «Sí se puede» y un de-seo de volver a encontrarnos en2014. ¡No te lo puedes perder! ■Texto: Estrella G.A. San Isidro 15MSegundo aniversariodel 15M en CatalunyaBarcelona y Lérida fueron lasdos ciudades de la comunidadde Catalunya que, el pasado12 de mayo, participaron enla convocatoria de manifes-taciones de celebración delsegundo aniversario del na-cimiento del movimiento del15M. El lema que encabezó lamarcha en Barcelona no pu-do ser más claro: «Paremos elgenocidio financiero, junt@spodemos». Del mismo mo-do que, como era de esperartras su reciente experienciaen los escraches, el colectivoque más se hizo notar desdelas primeras filas de la mani-festación fue la Plataforma deAfectados por la Hipoteca. Sinembargo, el mayor contrasteestuvo en la discreta afluenciade manifestantes, sobre todosi se compara con la asisten-cia masiva que el año anteriorhabía caracterizado a la cele-bración del primer aniversa-rio del movimiento.Una de las interpretacio-nes que puede ayudar a darcuenta de ese aparente “ba-jón” es un hecho tan patentecomo que, a estas alturas de lacrisis, los sectores más afecta-dos cuentan ya con su propiacapacidad de organización yuna amplísima capacidad deconvocatoria. Cuestión éstaque es fácil de percibir día adía en las calles y que, sin irmás lejos, en Catalunya sepuede incluso cuantificar através de un informe recien-te del Departamento de Inte-rior que certifica la comuni-cación de una media de oncemanifestaciones diarias en losmeses transcurridos de 2013,frente a una media de 5,5 alo largo del año 2011. Cierta-mente, las convocatorias sesolapan y transcurren en for-ma de Mareas de múltiplescolores. Ninguna es más im-portante que otra, y todas enconjunto expresan el malestarsocial.Por eso bien puede decir-se también que, en realidad, el15M transcurre a lo largo detodo el año, en cualquier lugary en cualquier sector. Y quecelebrar su efeméride con-siste sobre todo en señalar elmodo en que este movimientoha pasado de ser un cataliza-dor inicial de las luchas socia-les a formar parte del imagi-nario colectivo cuya presenciaactual se aprecia en cuantosurge el más mínimo ápice dereivindicación. No en vano, el15M sigue haciendo de la te-nacidad su mejor distintivo, yno ha dudado por ello en ce-lebrar su segundo aniversarioponiendo, una vez más, pordelante los puntos en los quese basa su razón de ser:«No al rescate de los ban-cos»; «Educación, sanidady servicios sociales públicosy de calidad»; «Reparto jus-to del trabajo y de la rique-za»; «Derecho a una viviendadigna»; «Por una renta básicauniversal»; «Derechos y liber-tades ciudadanas garantiza-das». «Derecho al propio cuer-po». «No a la represión». ■Texto: Alfonso López RojoEl 15M sigue haciendo de la tenacidad su mejor distintivo. A.L.RChulapos y chulapas captaron la atención del público asistente. SAN ISIDRO 15MLa cita se vistió de fiesta y reivindicación. SAN ISIDRO 15MAyuntañecos
  5. 5. 5madrid15m Junio de 2013 | Nº 15ESPECIAL 12M MAYO GLOBAL // TEMAS9M. Toque a Bankia:cansinismo contra el capitalLa acción provoca el cierre de más de 40 sucursales de la entidadYa habíamos advertido de quecontábamos con las armas máspoderosasparalucharcontraelcapital: creatividad, humor ycansinismo. Y el 9M lo demos-tramos.Miles de cansineadorasanónimas, enamoradas de laacción Toque a Bankia que ha-bían parido GILA y Hacktivis-tas, salieron de sus cuevas dis-frazadas de clientas habitualespara bloquear las oficinas deBankia en toda España.El pistoletazo de salida lodio el grupo de activismo mu-sicalLaMamandurria,queblo-queó la primera oficina de La-vapiés cantándole las cuarentaa los bankieros, con coreogra-fía incluida. Pronto los relatosde los cansineadores comen-zaron a inundar las redes so-ciales. Guillotinas, clientes es-pecialmente cansinos, abuelasque se desmayaban, niños pre-guntando por préstamos e hi-potecas, escenas de desamoren la sucursal... y miles de ges-tos creativos y desobedientes.La amenaza por el empla-zamiento hizo el efecto espera-do, y muchas oficinas se auto-cerraron por circunstancias tanperegrinas como que en la filacoincidieran cuatro barbudos.Y las sucursales empeza-ron a verse saturadas no solopor la acción de clientes cansi-nos: pronto empezaron a reci-bir llamadas extrañas (graciasa la aplicación Toqueame de-sarrollada por Hacktivistas),cajeros amanecían bloquea-dos gracias a la generosa do-nación de algún admiradorde #OpLolaFlores, e inclusola web de Bankia estuvo inac-tiva durante más de una hora:Los Anonymous también sehabían apuntado a Toque aBankia.Había algo mágico en laacción: esa complicidad entredesconocidas. Gente que nose conocía previamente y seencontraba por azar en la ofi-cina, o porque habían queda-do previamente en los foros deToque a Bankia. Un enjambrecreativo y desobediente capazde unirse para una acción con-creta, indetectable y por tantoimposible de reprimir. Victo-ria asegurada.Una vez más, demostra-mos que tenemos claro quié-nes son los culpables de estacrisis-estafa, que somos más ycontamos con armas podero-sas para ir provocando grietasen el sistema.Venceremos, y nuestravenganza será ser felices. ■Texto: GILALa LOMCE en cuatro puntos¿Qué hay que saber sobre la nueva ley de educación?¿Por qué hay tanto revuelo?El pasado 17 de mayo seaprobó en el Consejo de Mi-nistros la nueva ley de educa-ción promovida por el Parti-do Popular. Ésta es una másde las conflictivas leyes queha sacado el Gobierno. Sunombre aboga por la calidadde la enseñanza (Ley Orgáni-ca para la Mejora de la Cali-dad Educativa), sin embargoen la calle no se ve de esa ma-nera y apenas cuenta con res-paldo social. Pero, ¿qué es loque ocurre con esta ley? ¿Porqué hay tanto revuelo?En primer lugar se plan-tean unos objetivos: «dismi-nuir las tasas de abandonoeducativo temprano y fraca-so escolar; mejorar las con-diciones para que los jóvenestengan mejor y más adecua-da formación que les permitaacceder a un empleo al térmi-no de sus estudios; disminuirel número de alumnos querepiten curso; contribuir aque no haya diferencias entreComunidades Autónomas;mejorar el nivel de conoci-mientos en áreas prioritariasy señalizar claramente losobjetivos de cada etapa; mo-dernizar la Formación Pro-fesional e incorporar y po-tenciar las Tecnologías de laInformación y la Comunica-ción». Analizando estos ob-jetivos se ve que en realidadlo que quieren hacer es un la-vado de imagen de la educa-ción: nuestros estudiantes,según los informes europeosy de la OCDE, no son buenosy hay que mejorar las cifras,pero solo buscan eso: núme-ros. Además se defiende quenuestra tasa de desempleojuvenil se debe a un siste-ma educativo poco eficienteen el que no se fomentan lasmaterias que llaman «priori-tarias». Es decir, en los cen-tros educativos hay materiasimpartidas innecesarias queno redundan en productivi-dad, de ahí el paro tan alto.Las medidas que adoptanpara reducir las tasas de des-empleo juvenil y alcanzar losniveles de conocimiento re-queridos (lo que no quieredecir que la gente detrás deesas cifras los haya adquiri-do) son el seguimiento indi-vidualizado de los alumnosy su distribución en distintositinerarios «en función de lasnecesidades y preferencias delas familias y los alumnos».El seguimiento individualiza-do parece una buena medi-da, aunque aumentar la ratiode alumnos por profesor (del10,1 según la ley) no es lo másrecomendable. En cuanto ala segregación de estudian-tes, ¿qué necesidades llevan auna familia a que su hijo hagaFP u opte por el Bachilleratoy la Universidad? Quizá me-ramente económicas, dado elaumento de las tasas univer-sitarias. Basándose en el sis-tema alemán se separará elalumnado según el itinerariodiseñado para cada caso sinmucha reversibilidad.Con el fin de «racionali-zar la oferta educativa», esdecir, de reducir las materiasque se consideran innecesa-rias, se dota a los centros demayor autonomía, para quesean ellos los que decidan suoferta de asignaturas no obli-gatorias teniendo en cuentala «flexibilidad del sistema»,lo que requieren los centrosde educación universitaria yla demanda de los alumnos.Así, aunque en el papel aúnsobreviven asignaturas comola Filosofía o el Griego, que-darán reducidas aún más ala marginalidad. La forma-ción, entonces, deja de ser unfin en sí misma para conver-tirse en una herramienta deun sistema empresarial. Abo-gando por la autonomía delos centros, se da cabida legala la segregación por sexos sise considera pertinente.Otro de los puntos conflic-tivos es la evaluación de losconocimientos del alumna-do al final de cada etapa: entercero de Primaria, al acabarPrimaria, al acabar Secunda-ria y con el Bachillerato. Es-tas pruebas no evalúan a losalumnos únicamente, sinotambién a los centros. No setrata de ver si se tienen unosconocimientos, sino de alcan-zar cifras, de nuevo cifras, eneste caso de aprobados.En resumen se puede de-cir que se trata de una leymercantilista, finalista, quebusca rentabilizar la inver-sión hecha en educaciónpara que se traduzca en be-neficios económicos y enunos datos más positivos dedesempleo y de índices deconocimientos, pero que enabsoluto busca humanizary formar personas para quecrezcan y desarrollen unasociedad más justa. ■Texto: Berta GonzálezGuillotinas, clientes especialmente cansinos, abuelas que se desmayaban... JUAN MARTÍN ZARZA Miles de gestos creativos y desobedientes saturaron las oficinas bankieras. J.M.Z.La Ley Wert ha cosechado una gran oposición en la calle. JUAN MARTÍN ZARZA
  6. 6. 6 madrid15m Junio de 2013 | Nº 15VIVIENDAUna nueva forma de movilización:en junio huelga de hipotecas¿Por qué una huelgade hipotecas?A la falta de control ellos lollaman "desregularización", yes lo que nos ha conducido ala actual situación que llaman"crisis", pero que es una esta-fa. Esta situación debe ser re-suelta estableciendo nuevasvías de control por parte de lapoblación.Dado que los políticos nodefienden nuestros intereses,a la vez que el Banco de Espa-ña y la CNMV amparan y de-jan impunes a los culpables,debemos actuar contra la in-acción de las instituciones yseñalar a las entidades banca-rias para que paguen por suscrímenes sociales. No acep-tes este sistema corrupto y sú-mate a la huelga de hipotecasconvocada en junio. Es másbarato que una huelga laboraly más efectiva en un país en-focado al sector servicios.Iniciamos así una nuevaguerra contra la banca. Des-de el 15M comienza la revuel-ta de los hipotecados. Retrasael pago de tu hipoteca en ju-nio entre 10 y 90 días. Mostre-mos nuestro poder deudor to-dos juntos.¿Actuará la justicia?Solo si ejercemos la sufi-ciente presión desde la socie-dad alejando a los banquerosdel poder podremos terminarcon la inacción de los partidospolíticos que bloquean la de-mocracia y corrompen el co-rrecto funcionamiento de lajusticia, por eso la negocia-ción debe ser entre el puebloy las entidades financieras, sinintermediarios.El procesoespeculativoinmobiliario(1992-2006)Activando la burbuja hi-potecariaEl inicio del proceso de es-peculación inmobiliaria de losúltimos 30 años se remontaa la Transición y los Pactos dela Moncloa, de los que formóparte la Ley del Mercado Hi-potecario, que convertirían lashipotecas en uno de los gran-des negocios de bancos y cajasde ahorros, paralelo a la caí-da de los tipos de interés (caí-da ficticia, pues un piso repre-senta para un trabajador todauna vida de pago). El esfuerzode compra pasó a un 60% de larenta familiar. En segundo lu-gar, el Decreto Boyer y las res-pectivas leyes de arrendamien-to urbano, que propiciaron elacoso al inquilino. Los pisos dealquiler, que representaban un45% en los años 70, bajaron al6% en el 2005.La explosión de la estafahipotecariaDesde 1994 a 2006 el nú-mero de hipotecas no paró decrecer. ¿De dónde sacaban losbancos españoles el dinero?De los bancos extranjeros, po-niendo como garantía de pa-go el derecho de cobro de lashipotecas. Pero las hipotecas,que servían como aval parasolicitar más dinero a la ban-ca internacional, no cumplíanlos requisitos legales y de ries-gos para ser convertidos en tí-tulos.Frutodeestaestafahipo-tecaria,en2007elpreciodelasviviendas había aumentado un288%, arrojando cifras escalo-friantes: más de 6 millones deparados y 400.000 desahucios.Quiero ir a la huelgade hipotecas en junio.¿Cómo lo hago?Al cobrar la nómina, sacael dinero de la cuenta dondetengas domiciliado el cobro dela hipoteca y no ingreses el di-nero hasta el momento en quedecidas. Aconsejamos no ex-tender la acción durante másde 90 días.¿Qué consecuenciastiene esta huelga dehipotecas?El cobro de las hipotecas esesencial para el funcionamien-to de los bancos, ya que éstos asu vez están obligados a pagarotras con unos ingresos queesperaban y no van a recibir.Además su flujo de caja se veafectado directamente, tenien-do la obligación de acumularmás dinero en sus reservas.Precedentes, huelgade alquileres (1930)En el año 1930 el precio delos alquileres subió abusiva-mente, y en el barrio de la Bar-celoneta se inició una huelgade alquileres. La huelga, así co-mo todas las acciones, se deci-dieron entre los vecinos en unproceso asambleario de demo-craciadirectaquereforzólaex-pansión de la movilización.Los precios de laviviendaEntre 1997 y 2007 los pre-cios de la vivienda aumenta-ron un 197%, al tiempo que elparque inmobiliario crecía al5% y pasábamos de un exce-so de demanda (1993 a 1997)a un exceso de oferta (2002 a2007). La liberación del suelode 1996 consiguió aumentar—como se quería— la cons-trucción de viviendas, pero demanera descompensada y conun perverso impacto en losprecios.La burbuja de ladeudaLa burbuja de la deuda, ladesregulación financiera y laespeculación inmobiliaria tra-jeron el descontrol más san-grante: la asunción de riesgospor parte de las entidades fi-nancieras, que concedieronhasta el 230% del precio de lasviviendas. Había una sobreta-sación de las casas sistemáti-ca. El gestor tenía por costum-bre prestar más de lo necesarioy más de lo que legalmente po-día. En su aritmética, las vi-viendas no harían más quesubir. En 2007, de forma im-perceptible para la población,los bancos y cajas entraron enpánico y trataron de desinver-tir en el ladrillo. Sus númerosrojos se convirtieron en aguje-rosnegrosquedeglutíanycon-tinúanhoyendíaabsorbiéndo-lo todo.El rescate financiero(2012)El 9 de junio de 2012, elministro de Economía anun-cia que España ha obtenidode la Unión Europea un res-cate de 100.000 millones deeuros para “sanear” lo incura-ble, el sistema financiero espa-ñol, a través del FROB, y éste através de la SAREB, el "bancomalo". Es decir, la irresponsa-bilidad de los bancos que noshan estafado, el fraude y la es-tafa que determinados gesto-res financieros han cometidono solo están quedando impu-nes, sino que además son pre-miados con inyecciones millo-narias.¿Tienes hipoteca?Revisa tu hipoteca tanto sivas a secundar la huelga comosi no, porque si tu hipoteca fuefirmada entre el año 1993 y el2013 es probable que conten-ga cláusulas abusivas ilegalesque hacen que la cuota que pa-gas al banco sea más elevadade lo que debería ser. En otraspalabras: tu banco te está ro-bando.Por todo ello convocamosa la huelga a todos los hipote-cados y exigimos:— Dación en pago y alqui-ler social.— Investigación efectivadel fraude hipotecario.— Auditar la deuda públi-ca y no pagar la parte ilegíti-ma.— Supresión de las SICA-Vs y los beneficios fiscales a in-versiones especulativas.— Derogación de la últi-ma reforma del art. 135 de laConstitución Española.No debemos, no paga-mos. En junio, huelga de hi-potecados ■Texto: hazte-valer.tumblr.comOcupación de las oficinas del SAREB en Madrid. MADRILONIA
  7. 7. 7madrid15m Junio de 2013 | Nº 15VIVIENDAÚltimos días para pedir la suspensión de lasejecuciones hipotecarias por cláusulas abusivasLa Plataforma de Afectados por la Hipoteca prepara ‘kits’ de emergencia condocumentación y consejos para realizar el trámite, disponibles en su página webPAH MADRIDLa movilización creciente ante a laconducta antisocial de las entida-des financieras en materia de vi-vienda, así como la reciente sen-tencia del Tribunal de Justicia dela UE, de 14 de marzo de 2013,asunto C-415/11, han obligado alGobierno a modificar la legisla-ción española en materia hipo-tecaria. Dicha modificación se hamaterializado en la Ley 1/2013 de«medidas para reforzar la protec-ción a los deudores hipotecarios,reestructuración de la deuda y al-quiler social».Esta norma establece un plazosumarísimo de apenas un mes alos afectados que se encuentreninmersos en un procedimiento deejecución hipotecaria para poderejercer su defensa en el proceso.El plazo comenzó a correr elpasado 16 de mayo, y termina-rá el 16 de junio. Una vez más, elGobierno somete a las personasafectadas a una carrera de obstá-culos para poder defenderse mí-nimamente frente a las entidadesfinancieras.Para facilitar los trámites, des-de la Plataforma de Afectados porla Hipoteca hemos preparado dos“kitsdeemergencia”coninstruc-ciones para todos los afectados yconsejos para los abogados parala alegación de cláusulas abusi-vas tanto en el proceso judicialcomo en el extrajudicial (ante no-tario). Estos "kits" se encuentrandisponibles para su descarga enla web de la PAH de Madrid.La movilización creciente ante a laconducta antisocial de las entida-des financierararasss en materia de vi-vienda, asassíííí cococomomomomomoo llllllaa rerereeciente sen-tet nccia delel TTTTriririrribubububububbub nananananananan l deeee Justicia delaa UE,E, de 14141411 dddddeeeeee mam rzzr o de 2013,asunnto CC-4-4444441515/1/1/11,1,, hhan obligado alGoooooobiierrnoo aa mmododificar la lelegigig slla-a-acióóón esppppañañaña olola en materriaia hhhhhhipipipipppo-o-o-o-o-o-oteeeeecarirr a. DDDDDDichah modificacióiónnn sesesesesess hhhhaaammmamamaateteteeeeerializadddoooooo en llaaa Leyy 1////2013 de««mememeemeedidddddddddddddddd daaassss papapapap rarar refefororrrrrzazazazazazazazazaaaaaazaaaaaaar laaaa pppppppppppppppppppppppppprororororr teeeec-c-c-cciónónóónónónóónnnnnnnnnnnn a losss dddeueueuuuuudodoodododooorerer ss hhhihihihihhhhhhhhhhhhhhhh popopopopoooooooopopoopopopppoooopp tetettttetettetetetetetetetetttteeecacacacacacaacaaacacaccaaacaccacacaaaaacacaaacaccaacaaacaaacaacaaaririrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrr osooooososoooosoooosoososoooooooosooooooooooooooooooossosossossssssssssss,,,,,,,,,,,,,,,,,,,,,reeeeeesesesesessssssesesesesessesessesesesssessessseesesseeestttrttttttttttttttttttttttttttttttttttt uctuuuuuuuuuuuuuuuuuurarararararararararaaraaraaaarararaaraararararrrrrrrrr ciicccciiiciiciciccciciciciciiciiciciciccccciciciiiiciciccccicicccicccicic ónónónónónnónónónónnnónónnónónónnónnónónónónóónónónónónóóóóóónóóó dddddddddddddddddddddddddddddddddeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee la dddddddddddddddddddddddddddeueueueueeueueueueueuueueuuueueueuuuueueuuuueueuuueueuuuuuuuuuuuuuuueeueeuueuuuuuuuueuuueeudadaddadadadddadadadadadadadadadadddadddadadadadadddaddddadadddadadadddaddadadadaddadaddadadaddadddadadadaadaddadadadaddddadaaaaaaddaaadadddddadadadadd yyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyy aaaaaaaaaaaaaaaaaaaaaaaaaaaaal-lll-lllllll-ll-l-l-l-lll-ll-ll-ll-l-l-ll-l-l-l-l-l-l-lll-llllllll-ll-ll-llllllll--lllllllllllllllllllquuuqq iliiiiilllilillliliiiiiiiiiiiiiiii eeeeeereeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee sococococococococococooooocooooo iaiaiaiaiaiaaallllllllll»»»»»»».....los afectadoss que se encuenttntrenninmersossssssss eeeeeennn unn procedimienentoto dddeeeeeejececucuccióióióóóónnnn hipotecaria paaraa ppododododddeeeererrererrrrejejerereercececeerr sususu defe ensa en ell pproroocececeessosososososo....ElElEll pppplallazozo commenzó a cororrerr elelellpapapaasasasaadododod 16 de mmayaya o, yy ttere miminana----ráá ellll 16166166 dde juniiio.o UnUnUnUnUnUnUUUUU aaaaaaaa vevevevevevevezzzzzzzzz mámámmámámámámámám s,s,s,s,s,s,s,s,s, eeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeelllllllllllllllllllllllllllllGoGooooooooobibibibbbbbbb erereeee no someteteee ee aaaa lalallalalalal ssssss pepepepeppepp rsrsrssrsrsrsrrr ononononononasasasassassssssssasssafaffaffaffa ececece tatattadaddd s a unaaa carrrrerererraaaaaaaaaaaaaa dededededededed oooooobsbsbsbsbsbsbsbsbsbssbsbsbsssbsbsbsbbsbsssssssbstátátátátátátáttátátáttttáttátáttátááttátátátttáttátáátáttátáááááááááááát ------culos papaapappp rararrraa ppppppppppppppppppododododododododododooooddddoo eeeeeeereeee defefenenee dededededededededededededededededededededeedededeeeeeeeeeeeeeddeddd rsrsrsrsrsrsrsrsrsrrsrsseeeee mímímímímímímímímí-----nininiiiiniiiiiin mamamaamamamamamaaamamaaaamamamamaammmmmmmm mememememememememememmmmmmmmmm ttntteee frfrfrenenenenennnnteteteteteteeteee aaa lasasasaaa eeeeeeeeeentntntntntntntntntntntnntntnntntntnntnnntnnntnnntntnntntnnnntnntnnntnnntnnnnnnntnnntttttttttttttttidiididiididiididdididididdddididddididdiddddididddddidiiiidddddddiiiiddidddddddddiididiiddddddddddddddddddddadadadadadadadadadadaddddadadadadadadddadddddaddadadaddadadadadddddadaddddddadddadadadaaddddddaadddddaddadaddddddddaaddddaaadddadadaadddadaaaaadaaaaaaaaaaaaaaaaaaaaaaaaaaaaa esfififififififififififififififinancieeerararararaararaas.s.s.ss.s.s.s.lalaaaa HHHHHHHHHHHHHHHHippotececccccccaaaaaaaa hehehehehhhehheh momomomoommos prepepppparararaaradadaa oo dos“k“kkkkititititittsdeeeeemememememem rgrgrgrgggenenene cic a”coonnninininininininii stsss ruc-ciciciciciiiiionononononononononononononnonnononononnnonnnnnnnnooononnnonnoonnononnnneses parararaaa totooooododododododododd ss loos afecececctatatataaaadodoos ycocococooocooooonsnsnsnsnsssnsnsnsnsnsnsnsnsnnssnsnssnnsssssssssssssnsejjoso parararararrrrraaaaaaaaa loloss abogadososoo ppparaalalalaaaaaaa aaaaaaaaaaaaaaaaaallelllllllllllellleellllelllllllllllll gagagagagagagagagagagagagaagaaaaagagggaaciiónnnnnnnnnnn dddddddde clclclclclcllllclclclclclclclclclclclclclclclclccccclclcccclclcccclccc áuáuáuáuáuuuáuuáuáuáuáuuuáuáuuuuáuáuuáuáuuáuáuáuáuuáuáuáuáááuáuáuááuáuáááááuááááusususususussussususususususussussusssuusususssssssssss lalalalalalalalallall s abaaaa usi----vavavavavavavvvvavavavvvavvavavavavavavvavaavavvvavvaavaavavvavvvvvvvvvvvvvvvvvvvv ssssssssss taatt nntnn o enenenenenenenennnenenennnennnnnenenee eeeeeeeeeeeeeeeeeeeeeeeeeeeeellllllllllllllllllllll prpppppppp ocesssssssoooooooooo jujujjj dicialalalalalllllcococococococcococococococoooccoocccooccoccccccoccoocccoooooccooooooooooooooccccooooooommmmommmmomommmmmmmmomomommmmmmomomommmmmmmmmmmmmmmmmmmmmomommmmmmmmmmmomommmmmmommmmmmmmmmmmmmmmmmmmoo eeeeeeeeeenn elelelll eeeeeeeextxxxxxxxxx rajujujujujujujuujuujuuuuj dididididididididdididididid ciciciciciciciciciciicic alaalalalalalalaa (((((((anananaanananananntettt no------tatatatatatatatatatatatatataaatatatataaatatataaaaataaaaattaaaatarirririrriririrrirrrirrirrririrr o)o)o)o)o))o)o)o)o)o)o))o)o)o)o))o)o)o)o)o)o)o)ooooooooooo)ooo)o)o)oo)oooo)......................... EsEsEEEsEsEsEsEsEsEsEsEsEsEEsEsEsEsEsEEEsEEssEsEEsEEsEEEsEEEEEsEsEEEsEEEEsEEEsEEEEEEEsssssEEsEEEstotototototttttttttttttttttttttttttttttttttttttttttttttttt sssssss "k" its"s"s"s"s"s"s"s"s"s""s""""s" ssssssssssssssseeeeeeeeeeeeeeeee eneneneneneneneneneneneeeeencucucucucucucucucucucuccuuuuenennenneneeeeeeeee tranannnnnnanndddddddidididddidiiididdddddddiididididdididididddididididdddiiiidddiiiddidddiiididddddddddddddddddddddddddddddidddiiiispspspspspspspsppspspspspssspspsspspspsppspspppspspppsppppppppppppononononoononononononnonononononononnononononononoonononooonnonnnnnnnononoonnonnnonoonnnonnoonnonoonnononnnibibibiibibibbibibibibibbibibibiiiibibiibiibbbbbibibbiiibiiibibbbbbibbbibbbiibbbbbbbbbleleeleeessssssssss papapapapapapapapapaaapppppppp rararararararararaarararaaaaa sssssssssssssssuuuuuuuuuuuuuuuuuuuuuuu dededededededdedededededededescscscscscscsscscscssss ararararararrrarrgagggggg ennnnnnnlalalalalaaaaaaaalaa wwwwwwwwwwwwwwwwwwebebebebebebebebeebebebbebebbbbebbbbebbbebebbbebbebebbeeeeeebebbeeebebebebebeeeeeeeee ddddddddde lalalalallala PPPPPPPPPPPPPAAHAHAHAHAHAHAHAHAHAHAHAHAHHAHAHAHAHHHHHHHHHHHH dddddddddddddddddddddddddddddddddddddddeeeeeeeeeeeeeeeeeeeeee MaMaMaMaMaMaMaMaMaMaMaMaMMMaMMMaMMMM drdrdrdrdrdrdrdrdrdrdrdrdd idididiidididididididi ..Descarga los “kits de emergencia” ymás información al respecto en:■ http://afectadosporlahipotecama-drid.net☛ IMPORTANTEALEJANDRO ALCOLEA
  8. 8. 15M MADRID COMUNIDAD8 madrid15m Junio de 2013 | Nº 15Éxito de la Consultapor la Sanidad986.476 personas votaron en 104 municipios de la CAM.El ‘sí’ a la sanidad pública obtuvo el 99,4% de los votosDel 5 al 10 de mayo se celebróla Consulta por la Sanidad enla Comunidad de Madrid, enlaquelaciudadaníaexpresósuvoluntad sobre el tipo de sani-dad que queremos. En las ca-lles de todas las localidades,voluntarios instalamos mesascon urnas para que todas laspersonas pudiesen votar. Di-cha participación de volunta-rios fue imprescindible parala celebración de la Consulta.Fue una fiesta del pueblo, enla que pudieron votar los niños(introduciendo un dibujo en laurna), los jóvenes de menos de18 años (con una frase por lasanidad) y los votantes, con lapapeleta, a partir de esa edad.Durante seis días, en laConsulta por la Sanidad he-mos votado 948.476 personasen 104 municipios de la de laComunidad de Madrid. A lapregunta «¿Está usted a favorde una sanidad de gestión pú-blica, de calidad y universal, yen contra de su privatización yde las leyes que lo permiten?»,942.472 personas (un 99,4%)han respondido «Sí»; 3.662personas (un 0,4%) han vota-do «No»; 1.463 personas (0,2%) han votado en blanco; y sehan producido 879 votos nu-los (0,1%).En esta consulta, los ciu-dadanos hemos sentido queformamos parte del pueblo,que tenemos voz. Estamos te-niendo numerosas emocio-nes positivas. Participandojuntos hemos visto que… ¡¡síse puede!! Muchas personasnos hemos estado conocien-do, haciendo nuevas amista-des, dejando de lado el indi-vidualismo y comprobandoque somos muchas más lasque somos solidarias. Esta-mos siendo testigos de nume-rosas historias de buena gen-te, de personas anónimas que,dejando a un lado sus intere-ses personales, contribuyendocon su tiempo, medios y grandisposición, piensan en los de-rechos de todos. Y así se siguecreando una gran red socialde muchas formas organiza-tivas que hoy lucha por la sa-nidad, pero mañana por otrascausas. ¡Gracias a todos losvoluntarios y participantespor hacer historia! ■Texto: www.consultaporlasanidad.orgA. P. LATINACampaña contra derivacionesmédicas a la sanidad privadaDesde hace tiempo, el Go-bierno de la Comunidad deMadrid ha venido aplicandoimportantes recortes presu-puestarios que afectan tantoalpersonalcomoalosmediosmateriales e infraestructurasde los centros sanitarios pú-blicosconelúnicoobjetivodedeteriorar su calidad asisten-cial (grandes listas de espera,falta de camas, colapsos enlas Urgencias, falta de equi-pos quirúrgicos y sanitarios,etc.), y así justificar la contra-tación de la asistencia sanita-ria a empresas privadas, pro-cedimiento que es más caroy además pone en serio peli-gro la supervivencia de nues-tro Sistema Público de SaludMadrileño.Queremos informarle deque se están derivando pa-cientes desde el sistema sa-nitario público al sistema pri-vado, con la excusa de queexisten listas de espera am-plias y que la atención serámejor y más barata.Cuando a usted se le so-liciten pruebas diagnósti-cas (ecografías, TAC, re-sonancias, endoscopias,electromiografías, etc.) o sele incluya en lista de esperaquirúrgica, es probable quereciba una llamada telefóni-ca diciéndole que se le puederealizar esa prueba o esa ope-ración en otro centro, que se-rá privado sin lugar a dudas,atribuyéndolo a la gran lis-ta de espera que existe en suhospital de referencia.Para garantizar la vera-cidad de esta afirmación, leaconsejamos que antes deaceptar cualquier derivacióna un centro privado consultecon su médico o pida las ex-plicaciones que crea oportu-nas a quien le llama, y pre-gúntele por qué lo hace. Estáen su derecho.Sepa que usted es un pa-ciente que pertenece al Sis-tema Sanitario Público de laComunidad de Madrid, y porlo tanto tiene todo el derechoa ser atendido en su hospitalde referencia.Desde la Plataforma La-tina en Defensa de la Sani-dad le animamos a formularreclamaciones si le derivana centros privados. Si asílo decide, puede presentaruna reclamación oficial enla Consejería de Sanidad enla que manifieste su deseode ser atendido en un cen-tro sanitario público y solici-tar la dimisión del Consejerode Sanidad por su incompe-tencia para gestionar la sani-dad pública. La reclamaciónse puede presentar de las si-guientes maneras:— Por correo electró-nico: https://servicioselec-tronicos.sanidadmadrid.org/CESTRACK/formulario.sapx— En su centro de salud,centro de especialidades uhospital.— Por correo postal: a laDirección General de Aten-ción al Paciente, Pza. CarlosTrías Bertrán, 7; 28020 Ma-dridLe agradeceremos que seinformeantesdehacerusodelos distintos servicios que sele ofrecen, y le damos las gra-cias por la atención prestada.¡La sanidad no se vende,se defiende! ■Texto: Latina en Defen-sa de la Sanidad PúblicaA. P. ALAMEDA-BARAJASSobre la Consulta Popularpor la Sanidad PúblicaLa Asamblea Popular Alame-da-Barajas, cuyo grupo desalud forma parte de la co-nocida Marea Blanca, parti-cipó en la consulta y aportó4.311 votos de los 6.586 re-copilados en todo el distritode Barajas.Con esta nota queremosagradecer a todos los veci-nos y vecinas que han pres-tado su tiempo de forma al-truista para colaborar ennuestras mesas y facilitar ala vecindad el derecho a opi-nar, y, cómo no, agradecer-nos y felicitarnos a todas laspersonas que hemos ejercidonuestro derecho a la partici-pación ciudadana votandopara defender nuestra sani-dad pública.Aprovechamos para re-cordar el trabajo desarrolla-do por la Asamblea PopularAlameda-Barajas, que des-de hace casi un año está lu-chando por la defensa delúnico servicio de Urgenciasde nuestro distrito recopilan-do 6.711 firmas (acción de-sarrollada junto con diver-sos colectivos del Distrito),enviando más de 800 cartasa la alcaldesa de Madrid concopia a la concejala de Bara-jas y concentrándose cadajueves a las 19:00 en Urgen-cias (¡te esperamos el próxi-mo jueves!).Cabe destacar que an-te estas firmas y cartas, nila concejala de distrito Pe-pa Aguado ni la alcaldesa deMadrid Ana Botella se handignado a contestar a los ve-cinos y vecinas.Para finalizar, nos gus-taría destacar que la Con-sulta Popular por la SanidadPública es, como su propionombre indica, popular, yque no nos gustaría que, co-mo ya ha sucedido con otrasacciones populares impulsa-das en el Distrito, terminensiendo fagocitadas por inte-reses partidistas y ganas de"hacerse la foto" de algunaspersonas. ■Texto: Asamblea Popular de Barajas■ Más información y resul-tados por pueblosy dis-tritos: www.consultapor-lasanidad.org☛ INFORMACIÓNLa Marea Blanca exigeser escuchadaUna vez más, y ya van diez, mi-les de personas salieron a la ca-lle para exigir que se paralicela privatización de la sanidadpública madrileña. Como ca-da tercer domingo del mes, laMareaBlancahaexigidoalGo-bierno regional que escuche alos ciudadanos y no convier-ta el derecho a la asistencia sa-nitaria en especulación y ne-gocio. Ésta ha sido la primeramanifestación respaldada porlos contundentes resultadosde la votación de la gestión pú-blica de la sanidad, donde ca-si un millón de personas vota-ron a favor.Profesionales y ciudada-nos han mostrado su determi-nación a seguir manifestán-dose hasta que el GobiernoGonzález dé marcha atrás enla privatización de la sani-dad pública, que consideranun «auténtico saqueo». Se-gún los convocantes, el PP nopuede seguir despreciando lavoluntad de la ciudadanía ygobernar a espaldas de los in-tereses generales valiéndosede su mayoría absoluta.Asimismo, en mayo se pre-sentó el segundo informe delObservatorio Madrileño deSalud. Según sus datos, los re-cortes supondrán realizar 5,7millones de consultas menos,reducir en 37.400 las interven-ciones quirúrgicas, 44.800 in-gresos hospitalarios menos yreducir en 123.000 las explo-raciones radiológicas, ademásdel aumento de las listas deespera y la reducción del nú-mero de profesionales. ■Texto: RedacciónCasi un millón de personas han votado en la consulta. CARLOS PEÑA15M Alameda-Barajas recogió 4.311 votos. A. P. ALAMEDA-BARAJAS
  9. 9. 915M MADRID COMUNIDADmadrid15m Junio de 2013 | Nº 15Si los de abajo nos movemos,los de arriba se caenVíctima de un tumor cerebral y de la injusticia socialLa niña de siete añosde Puerta de Hierro,Shakira, ha fallecidoShakira tenía siete años y unasganas inmensas de descubrirtodo con sus ojos maravilla-dos. Shakira era parte de unafría estadística de niños queempiezan a vivir y ya han si-do desahuciados por una so-ciedad indiferente y un podercriminal.Shakira tenía cáncer. Consiete años recién cumplidos, sele había diagnosticado un tu-mor cerebral... y era pobre.En enero de 2011, Shakiray su familia eran desalojadasviolentamente de su hogar, si-tuado en el poblado de Puer-ta de Hierro. No tuvo tiempode coger sus juguetes y sus co-sas. En julio vivía nuevamen-te la tragedia de perder el te-cho que la cobijaba. En esemomento derribaban la casade sus abuelos. Eran de los úl-timos en sucumbir ante la co-dicia especuladora y criminalde los malnacidos que go-biernan Madrid. A partir deaquel día Shakira tuvo que vi-vir en una furgoneta. Amnis-tía Internacional denuncia-ba la situación de esta niña,profundamente asustada yangustiada, malviviendo a laintemperie mientras recibíatratamiento contra su cáncer.Amnistía Internacional tratóde contactar con el ayunta-miento de Madrid. El silenciofue la respuesta.Su humilde casita entor-pecía los planes depredadorespara una zona de alto valor es-peculativoy,además,eranunamolestia para los “señores” y“señoras” de bien que a diariohacen su vida social y sus ne-gocios en el Club de Campo.La pobreza no queda bien tancercadelaZarzuela,AravacayMoncloa.Nada paró las máquinasexcavadoras,quellegaronpro-tegidas por esa policía defen-sora de los intereses de unospocos,yShakira,peseasugra-ve enfermedad y su absolutodesamparo, era expulsada desu mundo infantil.Shakira ha muerto víctimade muchas cosas: de una en-fermedad terrible, de pobre-za, de desamparo, de injusti-cia... y son varios los culpablesde esta vida truncada.Es culpable el ayunta-miento de Madrid, por no fa-cilitar su intervención quirúr-gica ni su convalecencia. Esculpable por la criminal des-trucción de su hogar y porunos desalojos brutales. Vidaspor dinero, terrible ecuaciónque se lleva por delante todo.Es culpable la empresaconstructora que se ha lucradocon el derribo de su hogar e hi-zo lo posible y lo imposible poracabar con su pequeño mundode niña pobre.Es culpable la Comunidadde Madrid y el Gobierno de lanación, por mirar hacia otro la-do, por desentenderse de todoen este caso, como se desen-tienden de todo lo que no seansus elevados objetivos en losque no caben las personas.Somos culpables todos losque en algún momento volve-mos la mirada, molestos, anteel sufrimiento ajeno.Son culpables los indife-rentes. Los que nada aportancon su paso por este mundo.Los que pasan por la vida pas-tando como bueyes castradosy en nada se mojan. Su culpa-bilidad es por omisión, porquesu silencio de borregos deja lasmanos libres a los malvados.En esta trágica historiano solo hay culpables. Tam-bién está la luz de las perso-nas maravillosas que hicierontodo lo que pudieron para de-tener esta barbaridad, quecompartieron su tiempo, ale-gría y penas con los habitan-tes de Puerta de Hierro. Per-sonas que aportaron dineroy calor a la familia de Shaki-ra para que pudiera ser inter-venida quirúrgicamente enNavarra. Está la actuación al-truista de la Asociación Espa-ñola de Oncología, que hizoposible el traslado de la niñaa Navarra, facilitándole unavivienda durante su larga en-fermedad. Causa bochorno yrabia que esta familia tuvieraque trasladarse a otra provin-cia para poder recibir asisten-cia médica.A todas estas personas,gracias. Sin ellas este mundosucumbiría de tristeza. ■Texto: Asamblea Popular de MóstolesDos añosdespués...Hace dos años comenzó nues-tra conquista de las plazas. Laacampada en Sol supuso unpunto de inflexión que pro-pició un pensamiento críti-co ahora diversificado en di-ferentes frentes de lucha. Eldesmantelamiento del Es-tado de Bienestar y el cues-tionamiento de estructurasopresivas y caducas que ca-da vez más personas sientencomo injustas, incomprensi-bles e inasumibles, se tradu-ce en una creciente protestaciudadana y una mayor movi-lización social; una respuestatotalmente legítima de la ciu-dadanía que no solo es igno-rada por el Gobierno actual,sino que es reprimida dura-mente a través de brutalesdetenciones, impunes agre-siones policiales, identifica-ciones masivas y sancioneseconómicas indiscriminadas.Durante este tiempo he-mos sido testigos de cómo laAdministración da la espalday vive ajena a la realidad delas ciudadanas a quienes debesu legitimidad, e instrumen-taliza su ejercicio, no en be-neficio de las mismas, sino afavor de otros poderes e inte-reses. Lo observamos día a díaen las actuaciones policiales,en las preocupantes reformasdel Código Penal o en el usoindiscriminado de las sancio-nes administrativas como ins-trumento represor y coactivode derechos fundamentales.Éstas son algunas de lasrazones para no bajar la guar-dia. Y no únicamente por nodejarnos vencer ante este des-alentador panorama y hacerlefrente con más ganas si cabe,sino porque tenemos numero-sos logros que celebrar. Preci-samente porque se nombranmenos, apenas se conocen ya veces hasta olvidamos quealguna vez existieron: desdelas pequeñas acciones cotidia-nas de desobediencia civil, lasasambleas de barrio, los cen-tros sociales, las iniciativas demercado social, los referen-dos ciudadanos o las mil mo-vilizaciones, hasta las pro-puestas más mediáticas comolas acciones de #YoNoPago ola paralización de desahucios.Así, es necesario reconocer ydisfrutar las luchas de nues-tras compañeras y compañe-ros, ya que gracias a ellas noscruzamos un día y dos añosdespués seguimos haciéndo-lo. En el esfuerzo comparti-do encontramos el motor queanima a seguir y a desterrarla idea de que somos una is-la, un resquicio social de locu-ra en medio de una masa in-diferente.Por la parte que nos to-ca, y entre los muchos efectosque el movimiento 15M hapodido tener desde el princi-pio de su actividad, tenemosque destacar el creciente inte-rés de los ciudadanos en có-mo el Derecho afecta a su díaa día. Sin embargo, este ma-yor interés ha de seguir evo-lucionando hasta concluir enuna mayor autonomía perso-nal en el ejercicio de los de-rechos ciudadanos. ComoComisión Legal tenemos, enesencia, dos labores: una mástécnica, la efectiva defensa delos participantes en moviliza-ciones del 15M frente a la Ad-ministración y los tribunales;otra más política, como es lacrítica, desde la óptica delDerecho, a las reformas nor-mativas y a su aplicación porAdministración y tribunales.Pero no debemos olvidar unaactividad transversal, que esla de construir conjuntamen-te una sociedad más informa-da y crítica que, a la hora deenfrentarse con el sistema ysus perversiones, sepa cuálesson sus derechos reconocidosy cuáles son los que les han si-do injustamente arrebatados.Y es en este aspecto don-de, aún, tenemos mucho ca-mino por recorrer. Deseamosuna sociedad autosuficien-te, conocedora y defensorade sus derechos, por lo queseguimos elaborando docu-mentos y manuales, desde lafirme creencia de que el De-recho debe ser entendido ymanejado por la propia per-sona a la que afecta. De igualforma, pensamos y trabaja-mos en el estudio de la re-presión vivida, colaborandoactivamente con espacios co-mo Amnistía Internacionalo la Plataforma de Desobe-diencia Civil, entre otras, pa-ra generar y difundir estadís-ticas e informes veraces sobreesta realidad o, sencillamen-te, crear espacios de pensa-miento y discusión colectiva.También hemos programadoconferencias y sesiones for-mativas para acercarnos deun modo colectivo, horizon-tal, cercano y comprensibleal deshumanizado y enreve-sado mundo del Derecho y elejercicio de las libertades pú-blicas. Seguimos realizandotalleres para activistas, escri-biendo artículos... en un in-tento por que los frentes co-tidianos de trabajo no agotenlas líneas profundas por lasque apostamos. Queda cami-no, en ello estamos.Nuestra actual sociedadestá sujeta a una legalidadque interfiere, una veces posi-tiva y otras negativamente, ensu día a día. Sin embargo, esteelemento de nuestra cotidia-nidad se nos escapa, es lejanoe incomprensible, ajeno. Des-de esta comisión intentamosdía a día superar la distanciaexistente entre la legalidad yla ciudadanía, haciendo delDerecho un espacio comúndonde todas podamos pen-sar y trabajar de forma colec-tiva, haciendo nuestra socie-dad más activa, crítica y justa;definiendo constantemente elderecho que queremos tener.Esperamos estar a la alturadel reto. ■Texto: Comisión Legal SolASAMBLEA POPULARDE MADRID DEL #25MEl 15M habladel 15MCon motivo del 2º aniversa-rio de la constitución de lasAsambleas Populares de Ba-rrios y Pueblos de Madrid, laAPM ha celebrado, en la Puer-ta del Sol, una Asamblea deAsambleas.El evento ha conseguidoreunir a portavoces de unastreinta asambleas, que hanefectuado:— La puesta en comúnde las trayectorias y logros delas mismas en estos dos años,desde su fundación el 25 demayo de 2011.— El apoyo unánime aldocumento de síntesis del de-bate Balance y Perspectivas del15M celebrado en la APM, yen el que por primera vez... el15M habla del 15M. ■Texto: APMDetención de un fotógrafo en los "bicipiquetes" de la huelga general del 14N de 2012. JUAN MARTÍN ZARZA
  10. 10. 1015M MADRID COMUNIDADmadrid15m Junio de 2013 | Nº 15No te quedes en casa,podrían quitártelaAcción social en GetafeContra los abusosbancarios, sí sepuedeLa mayoría de contratos de hi-poteca contiene cláusulas abu-sivas ilegales. Esta afirmaciónes ya de conocimiento públicoy notorio, mientras los poderespúblicos miran hacia otro lado.El 18 de mayo, la Plataformade Afectados por la Hipoteca yel Grupo de Vivienda del 15Mde Getafe planteamos una revi-sión gratuita de de hipotecas enla plaza del Ayuntamiento. Dis-pusimos un total de siete pues-tosdeatención,conotrostantosequipos formados por afecta-dos, activistas y abogados de laPAH, divididos por entidades fi-nancieras.En las mesas colocamos lo-gotipos bancarios seguidos dealusiones a su conducta anti-social. Bankia: estafa; Banes-to: desahucia; BBVA: roba; etc.A cada vecino se le explicaronlas cláusulas abusivas de su hi-poteca y se le facilitó un mode-lo de reclamación para presen-tar ante su sucursal y ante elBanco de España. Se tomó notade sus correos electrónicos pa-ra próximas convocatorias e in-formaciones. En el otro extre-mo de la plaza colocamos unalámina con un esquema de unaescritura de préstamo y realiza-mos un taller sobre conceptosbásicos: prestamista, prestata-rio, cláusula suelo, ejecuciónextrajudicial, intereses de de-mora, avalista, etc. Mientras,un equipo de informadores re-partía entre los transeúntes oc-tavillas sobre próximos des-ahucios y actividades de la PAHy el Grupo de Vivienda, y des-de el puesto de venta de cami-setas y chapas se hacía caja pa-ra el pago de multas y materialactivista en general.Los resultados fueron 33hipotecas revisadas, 117 cláu-sulas abusivas encontradas ymás de un centenar de nuevoscontactos con vecinos y veci-nas.En sí misma, la actividadcontiene una gran fuerza comodenuncia popular. En primerlugar, con casi 30 personas rea-lizando tareas diversas duran-te toda la mañana en una plazade gran afluencia, con cartelesalusivos a la estafa hipotecaria,trabajamos en equipo de formaeficaz y la gente percibe un gra-do alto de coordinación. En se-gundo lugar, abrimos la comu-nicación a sectores sociales quesufren una precariedad cre-ciente pero que aún siguen aldía con su hipoteca, esos sec-tores que perciben la degrada-ción generalizada de las condi-ciones de vida pero no tienenvínculos con los movimientossociales. En tercer lugar, cons-tatamos la verdadera dimen-sión de la estafa hipotecaria.La realidad de los abusos ban-carios supera en gravedad lamayoría de los análisis reali-zados hasta la fecha. Con estasacciones fundamentamos en lapráctica, más allá de los mani-fiestos, la exigencia del fin dela impunidad, haciendo partí-cipes al común de los hipote-cados.Tenemos que comunicarcon la mayoría de la poblaciónpara conformar una fuerza so-cial capaz de poner fin a la dic-tadura de los mercados. No po-demos limitarnos a nuestrosgrupos de afinidad y a accionesautorreferentes para nuestrapropia afirmación. Es necesa-rio un diálogo permanente conpersonas no movilizadas sinpretender que desde el primerdía se incorporen a las asam-bleas. Las personas tenemosritmos de aprendizaje distintose ideas preconcebidas que nose derriban en un día. La movi-lización real es un proceso vivo,no un resultado inmediato. En-tender esto es fundamental pa-ra no frustrarnos y para no in-fravalorar los apoyos efectivosque no coinciden con nuestraidea de activismo.El movimiento por el de-recho a la vivienda es hoy unvector de fuerza social cons-tituyente gracias a su plurali-dad y a su capacidad para re-solver problemas cotidianos dela gente. El lema «Sí se puede»describe el estado de ánimo demillones de personas que des-cubren o vuelven a creer en lamovilización como el mediomás efectivo para la defensa ypromoción de los Derechos Hu-manos. Esa movilización tomaformas muy diversas, desde laocupación de sucursales a larecogida de firmas o la reali-zación de talleres ciudadanosfrente a abusos bancarios. ¿Có-mo se produce la acumulaciónde fuerzas que transforma, a lolargo del tiempo, la indigna-ción en acción con capacidadde cambio social? La respuesta,en parte, está en acciones comola que realizamos en Getafe. ■Texto: Javier Rubio (abogado de la Pla-taforma deAfectados por la Hipoteca)PAHAbril y mayo:28 desahuciosparadosDesde la última crónicaque se publicó en este dia-rio, la PAH, junto con otroscolectivos como la PAVPS ola Asamblea de Vivienda,ha participado en la para-lización de 28 desahucios.Estos 28 stopdesahucioscomenzaron en la segundasemana de abril, en la queteníamos ocho desahuciosplanificados. Fue la sema-na con más desahucios deestos dos meses. El lunes8 comenzamos con tres:uno en Móstoles, de Gene-ral Electric; y dos en Valle-cas, uno de Bankia y otrode la EMVS. Los tres fue-ron suspendidos previa-mente sin que tuviéramosque acudir a impedirlos. Elmartes tuvimos otros dos,en Aranjuez y Alcobendas,del IVIMA y la EMVS res-pectivamente, otra vez sus-pendidos. Para el resto dela semana, teníamos otrostres desahucios planifica-dos: dos el jueves, en Valle-cas y Villaverde, ambos dela EMVS; y uno el viernesen Getafe, de Bankia. So-lo el de Villaverde tuvo queser paralizado, el resto fue-ron suspendidos.Pasamos a la siguientesemana, en la que teníamoscuatro, y todos fueron sus-pendidos previamente: dosel lunes, en Vallecas y Cara-banchel, ambos de Bankia;el miércoles, uno en Alcor-cón, de Caja Vital; y para fi-nalizar, el viernes la Kutxatuvo que suspender el des-ahucio que quería llevar acabo en Humanes.Tras estas semanas detriunfo, encaramos un fi-nal de mes en el que so-lamente teníamos tresdesahucios planificados:martes 23, en Móstoles, deBankia; viernes 26, en elAlto de Extremadura, dela EMVS; y el martes 30,en Parla, Bankia queríavolver a desahuciar. To-dos fueron suspendidos,menos el de la EMVS en elAlto de Extremadura, quetuvo que ser paralizado.Tras un final de abrilcon una cifra reducida dedesahucios, comenzamosmayo con seis desahuciosen la misma semana. El lu-nes 6 de este mes se sus-pendieron los desahuciosque teníamos planificadosen Lavapiés y Arganzuela,de La Kutxa y Banco Gui-puzcoano respectivamen-te. El martes corrió la mis-ma suerte el desahucio deBankia en San Blas. Pasa-mos al miércoles, día enque tuvimos que paralizarel desahucio que Bankiaquería llevar a cabo en Use-ra, sin embargo el de UCIen Parla fue suspendido,al igual que el que Banes-to quería llevar a cabo enHortaleza al día siguiente.Quedaban tres sema-nas de mes, con siete des-ahucios por delante. El lu-nes 13, ING suspendió elque tenía planificado enPuente de Vallecas, sin em-bargo al día siguiente le tu-vimos que parar los pies aCetelem en Las Águilas. Pa-samos a la siguiente sema-na (penúltima del mes), enla que teníamos tres des-ahucios planificados: dosfueron suspendidos enUsera y paseo de la Caste-llana, pero un tercero tuvoque ser paralizado en la ca-lle Olmo: la EMVS no pudodesahuciar. Para finalizarestos dos meses, Catalun-ya Caixa y Bankia queríandesahuciar el lunes 27 ymartes 28, pero una vezmás conseguimos hacerque los bancos suspendie-ran los lanzamientos.Han sido dos mesescon pocos desahuciados,comparados con mesesanteriores, pero la bancae incluso empresas públi-cas como el IVIMA siguenobligándonos a estar orga-nizados y seguir parandolanzamientos. Dentro deesta pugna, la próxima pa-rada es la lucha contra lascláusulas abusivas. ■Texto: Carlos HuergaMiembro de la PAH MadridHan sido dos mesescon pocos desahu-ciados, comparadoscon meses anterio-res, pero la banca eincluso empresas pú-blicas como el IVIMAsiguen obligándonosa estar organizadosy seguir parandolanzamientos.Continúa la lucha en defensa del derecho a la vivenda. JUAN MARTÍN ZARZALas hipotecas de los vecinos, a revisión. JUANVI
  11. 11. 1115M MADRID COMUNIDADmadrid15m Junio de 2013 | Nº 15Soy un ni-ni: Ni me callo,ni me aguantoLa PAH de la Sierra Nortehace un llamamientourgente a todos los alcaldesLa Plataforma de Afectadospor la Hipoteca de la SierraNorte hace un llamamientourgente a todos los ayunta-mientos para que, de formamancomunada o en solita-rio, coordinen la llegada dealimentos a familias que ca-recen de recursos, a padresy madres que no tienen conqué alimentar a sus hijos, ajóvenes que malviven solos yavergonzados de su situacióny no se atreven a decir que yano tienen agua ni luz eléctri-ca en sus casas.Al mismo tiempo, estaplataforma aplaude la tra-yectoria e incansable actitudde toda la población volun-taria que colabora en Cári-tas, Cruz Roja y otras ONG,pero atención, muchas desus delegaciones están des-bordadas y las personas quevencen el pudor para acudira ellas porque consideran —como la PAH— que «mejorjusticia social que caridad»,se encuentran además con laimpotencia de quienes se venobligadas a negarles esa pri-mera atención, simplementeporque sus nombres no estánen una lista.Activistas de la PAH de laSierra y compañeras y com-pañeros de las asambleas15M en plazas, también de laSierra, han comprobado estasituación dramática, y que,a estas alturas de la gran es-tafa, la caridad no redime aquien da ni a quien recibe.Puestas a realizar una tareade campo, también se hanencontrado con la voz que-brada de una voluntaria enCruz Roja que les ha teni-do que decir que no puedenayudar a una familia porqueno está en su lista. Solo a tí-tulo de ejemplo, Luis, un chi-co con cierta discapacidadque espera o desespera poruna ayuda de Servicios So-ciales de la Comunidad deMadrid y que acudió por pri-mera vez al local de la CruzRoja en Colmenar Viejo la se-mana pasada, recibió comorespuesta que hasta el próxi-mo mes de septiembre no po-dría ser atendido. Es decir,que Luis, como otros nuevosafectados o afectadas de estagran estafa, tendrá que bus-car otra alternativa para co-mer mientras llega un em-pleo o la caída de las hojas.En pueblos como Colme-nar Viejo existe un comedorsocial que gestiona la Parro-quia de San José, un dispen-sario de ayuda a cargo de Cá-ritas, una delegación de CruzRoja y la residencia para adul-tos Jesús Caminante, quepronto verá ampliada sus ins-talaciones con un nuevo edi-ficio. Sin embargo, para seratendidos en cualquier pun-to de ayuda para recoger ali-mentos, es necesario disponerde un informe elaborado porServicios Sociales del Ayunta-miento. Conseguir la primeracita en las dependencias mu-nicipales puede alargarse has-ta un mes y medio. Después,tras presentar todo un abani-co de documentos y papeles,a quienes tienen hambre lesvuelve a tocar esperar.El colectivo de la PAHSierra Norte, con motivo dela inoperancia de los ayun-tamientos, servicios socialesy organizaciones caritativasde esta comarca, ha atendi-do ya a numerosas personasno solo en sus casos de des-ahucio, sino que hemos teni-do que montar un banco dealimentos de urgencia parasuplir la ineficacia de dichasinstituciones.La PAH de la Sierra Nortepersiste en defender los viejoscasos de desahucios como losnuevos que no cesan en llegar.Aunque también hay solidari-dad entre nosotros, somos in-capaces de paliar el hambreen la sierra y exigimos a ayun-tamientos y concejalías deServicios Sociales que aúnenesfuerzos por una... ¡Soluciónurgente ya! ■Texto: PAH Sierra Norte MadridA. P. ALUCHELa deuda y los barriosDesde que empezamos a reu-nirnos en el barrio de Aluchelas diferentes comisiones enel año 2011, uno de los temasque tratamos desde el princi-pio fue la deuda. En las pri-meras asambleas Interbarriosya expusimos nuestra argu-mentación sobre el grave pro-blema de endeudamiento ysu poder de manipulación ala sociedad. Seguimos traba-jando y difundiendo en nues-tro barrio y organizamos unacharla en el mismo a finalesde 2011 para explicar a la gen-te todo lo relacionado con ladeuda: pública, privada, fa-miliar... También hemos par-ticipado muy activamente enlas concentraciones sobre esteasunto, así como en las jorna-das estatales sobre la deuda.También nos mantenemos encontacto con el grupo de Au-ditoria de la Deuda.Este año mucha gente dela asamblea, después de asis-tir a la Interbarrios sobre ladeuda, nos preocupamos enformarnos en los talleres deformador de formadores quenos ofreció Auditoria de laDeuda.Pero en los barrios asis-timos de modo muy directoa problemas que son urgen-tes: desahucios, desempleo,perdida de derechos labora-les, reducción drástica de ser-vicios públicos... a los cualesintentamos dar una solucióna través de acciones, manifes-taciones, creaciones de redesde apoyo, recogidas de fir-mas...¿Están estos problemasrelacionados con la deuda?Si hiciéramos una auditoríade la deuda, ¿empezaríamosa tener el control de la situa-ción? ¿Podría ser ésta una delas soluciones a esta gran es-tafa que nos venden comocrisis? ¿Por qué no somos ca-paces de enlazar los proble-mas que sufren nuestros ve-cinos con el endeudamientoilegitimo?Parece que el concepto dedeuda es algo abstracto, y enmuchas ocasiones es difícilconectar con la sociedad paraque comprenda que muchosde los problemas que les azo-tan diariamente son conse-cuencia de un endeudamien-to ocasionado por la banca ysectores privados que han re-partido sus pérdidas con losciudadanos y que debemospagarlo entre todos aunqueno seamos los responsables.En lugar de darle las res-puestas habría que ofrecerleslas preguntas:¿Sabe usted cuántospuestos de trabajo se podríancrear con la deuda ilegitima,los intereses de la deuda, lasayuda a los bancos, fraudefiscal y el dinero de la corrup-ción?¿Sabe usted que es vícti-ma de una gran estafa orga-nizada por los poderes finan-cieros y políticos, los cualescrearon una "burbuja" inmo-biliaria?¿Sabe usted que se de-be empezar a exigir audito-rias locales a ayuntamientosy empresas públicas (EMVS,IVIMA...) para que se descu-bran los casos de corrupciónque están ocurriendo en susbarrios y pueblos?Y a lo mejor, y solo a lomejor, descubrían que sepuede generar empleo paratodos, que se puede denun-ciar a los estafadores me-tiéndoles en la cárcel y quepaguen daños y perjuicios alos estafados, descubrir to-dos los casos de corrupcióny que devuelvan el dinero ro-bado...Todo esto lo pueden des-cubrir en el momento que to-dos y todas asumamos que ladeuda es el corazón de la es-tafa y que dicha deuda no esde los vecinos de los pueblosy barrios del mundo… ■Texto: Asamblea Popular deAlucheA. P. PUENTE DE VALLECASY no pararán...Y no pararán de decir que el15M ha perdido poder de con-vocatoria, que las manifestacio-nes de celebración de los dosaños del movimiento son me-nos numerosas que las ante-riores, que estamos perdiendofuerza.Y no pararán de ignorar loque hacemos en los medios decomunicación poderosos, losque cobran de los lobbies, queno dedicarán ni un minuto desus informativos a las miles ymiles de personas que se unenpara luchar por lo que nos afec-ta a todos: la sanidad, la edu-cación, la vivienda, el trabajo,el medio ambiente, la justicia,la libertad.Y no pararán de criminali-zar lo que hacemos, de llamar-nos terroristas, radicales, anti-sistema, descontrolados.Y no pararán de insultar-nos, llamándonos vagos, pe-rroflautas, gentuza de izquier-das, nazis.Y no pararán de intentartapar el sol con su enorme ypoderoso dedo.Pero nosotros tampoco pa-raremos.No pararemos de defendera los que echan de sus casaspara lucrarse con su miseria,de manifestarnos para gritarnuestra indignación a los cua-tro vientos, de protestar antelos corruptos y decirles en sucara que sabemos que son unosladrones, estafadores, chori-zos, o exigirles que hagan po-lítica para el pueblo y no parasu bolsillo.No pararemos de reunir-nos en calles, plazas y barrios,aunque nos intimiden con co-ches patrulla de la policía, aun-que nos pidan la documenta-ción, aunque nos empujen onos cierren el paso.Porque el movimiento 15Mno son solo las personas que loiniciaron, no lo son las que con-tinúan en la lucha un año o dosaños después, no lo son las quehoy en día siguen en las asam-bleas. No lo son las que a travésde talleres y exposiciones pro-ponen modelos de sociedadmás justos e igualitarios. No loson solo las que ponen una sá-bana blanca en su balcón, lasque leen un ejemplar gratuitodel periódico del 15M, las quellevan ropa usada o libros a laasamblea de su barrio, las quese ponen una camiseta verde onegra, o una bata blanca.El 15M son todas ellas yademás todas las personas queacuden a una manifestación pa-ra luchar y protestar, todas lasque simpatizan con las reivin-dicaciones, las que firman unahoja para pedir un instituto ensu barrio o protestar por la pri-vatización de la sanidad. Lasque protestan por los recortes,las que despiertan y ven la in-justicia de esta crisis, las perso-nas que están indignadas. Mi-llones de personas despiertas.El 15M no parará, no des-aparecerá, no morirá, mien-tras haya personas, hombresy mujeres que sigamos indig-nados e indignadas y estemosdispuestos a demostrarlo demil y una formas.No pararemos a pesar delcansancio, de las presiones, delas difamaciones y las injusti-cias. Seguiremos luchando pa-ra lograr un mundo más justo.Si no nos ves, es que estásdormido. Despierta: ¡Nos ve-mos en las calles! ■Escrito por Susana (Compañera de laAsamblea Popular 15MVilla deVallecas)Y dicen que el 15M está perdiendo fuerza... A. P. VILLA DE VALLECASA.P. ALUCHE
  12. 12. 1215M MADRID COMUNIDADmadrid15m Junio de 2013 | Nº 15Si creéis que la educación escara, probad con la ignoranciaNace AgitaMadrid, la agendadel otro MadridDespués de muchos meses tra-bajando, estamos a punto depoder celebrar el nacimiento deAgitaMadrid. Y estamos a pun-to porque AgitaMadrid es unaherramienta que funciona a tra-vés de todos esos colectivos queestán "agitando" Madrid, sien-do tan solo una forma de cata-lizar lo que ya está sucediendo.AgitaMadrid es una agen-da digital que pretende agluti-nar en una misma plataformatodas aquellas actividades yconvocatorias que brotan des-de los colectivos y movimien-tos en lucha, pudiendo vi-sualizar de manera sencilla ydirecta dónde y cuándo tienelugar la acción. La plataformaweb se basa en un calendario,ordenado a través de «even-tos», con todas las activida-des del movimiento en nues-tra ciudad. La informaciónestá clasificada por «lugares»,«espacios» y «temática». Y, có-mo no, AgitaMadrid permiti-rá seguir las convocatorias delas distintas Mareas, las cualestienen sus propios apartados.Para que esta herramien-ta tenga el sentido que se pre-tende, tenéis que comenzar ahacerla propia. Para ello osqueremos proporcionar unacuenta desde la que podréispublicar vuestros eventos. Ne-cesitáis para ello sencillamen-te que nos paséis vuestro co-rreo electrónico, y este sábado8 de junio, en la presenta-ción pública de la herramien-ta que haremos en el Patio Ma-ravillas, os mostraremos cómoutilizarla, podremos inter-cambiar y debatir ideas y lo ce-lebraremos con música, teatroy... ¡cócteles!¡Toma la agenda y agitaMadrid!Para seguir leyendo y vercómo van las pruebas: http://www.agitamadrid.org ■Texto: AgitaMadridFinaliza el encierro21 días en el RectoradoLos estudiantes de la Complutense desconvocamosel encierro tras 21 días de lucha, 21 días de trabajocontinuado dirigido a la consecución de las siguien-tes exigencias: la prórroga del pago de matrículasa los 3.500 estudiantes en riesgo de expulsión y lacreación de un fondo de becas de emergencia.La primera exigencia, con-seguida, deja paso a la coo-peración colectiva aunandoa distintos sectores internosy externos de la comunidadeducativa a lo largo de es-te encierro. Creación de losvínculos necesarios en la lu-cha por la educación. La su-bida de tasas, la bajada desalarios, la LOMCE o la es-trategia Universidad 2015,responden a una estrategiade desarticulación progresi-va del modelo universitarioactual. El ataque es trans-versal, tanto para los secto-res afectados directamente—estudiantes, profesorado,PAS y PDI—, como para elresto de la sociedad, para lacual la educación universita-ria y gratuita debe ser un re-ferente de lucha.La creación de un fon-do de becas de emergenciapara cubrir las posibles ba-jas de las personas afectadaspor impagos por parte de laComplutense es la segundaexigencia del encierro lleva-do a cabo en Rectorado. Unanecesidad coherente, comoel ejemplo de otras universi-dades demuestra, ya sea laUAM o la URJC. Becas con uncriterio económico, para to-das aquellas futuras expulsa-das de las aulas por la subidaabusiva de tasas.La necesidad de bibliote-cas de estudio en la Comuni-dad de Madrid se aúna a lossólidos lazos de confianza yayuda mutua que ha poten-ciado la creación de un es-pacio de estudio autogestio-nado.Tras las continuas tra-bas administrativas plantea-das desde el equipo rectoral ynuestra constante insistencia,se ha llegado a varios com-promisos verbales: la observa-ción de forma individualiza-da de los casos dentro de cadafacultad, una promesa de re-distribución de la miseria queno plantea de cara las conse-cuencias sociales directas dela neoliberalización salvaje.Aseguran además el compro-miso de fraccionar el pago delamatrículaparalospróximoscursos en 8 plazos y la futuracreacióndeunfondouniversi-tario de becas.La demostración de fuer-zashasidoexplicita,yloscon-tratos verbales establecidos,vinculantes a todos los secto-res universitarios afectados.Los sectores en lucha es-tán dispuestos a recordar quemediante la unión y el com-promiso podemos conseguirnuestros objetivos. ■Texto: Encerradas en RectoradoDe la represión a la exclusiónUniversidadespúblicas madrileñasEl pasado mes de mayo comenzó con una fuerte re-presión a la lucha universitaria por parte de las fuer-zas del orden. La noche del 24 de abril, 3 jóvenes fue-ron arrestados en Ciudad Universitaria, mientrasponían pegatinas en el cajero del Banco Santander.Fueron acusados de llevar material inflamable y depreparar la acción de Asedia el Congreso.El 25 de abril, los antidistur-bios entraron en el Campus deSomosaguas de la UniversidadComplutense de Madrid pororden del Rector, José Carrillo.En una acción desproporciona-da, volvimos a ver escenas quehacían recordar la represiónque se ejercía contra los estu-diantes durante el franquismo.La intervención del cuerpo deantidisturbios se salda con on-ce detenidos acusados de lle-var bates de béisbol y cóctelesmolotov, en un burdo intentode asociar la huelga estudian-til que se desarrollaba ese díaen Somosaguas con la acciónque había convocada esa mis-ma tarde, más conocida comoAsedia el Congreso.Esa misma tarde, se con-vocó una concentración en elRectorado de la UCM, en la queparticiparon alrededor de unos200 alumnos, para pedir la di-misióndelRector,JoséCarrillo,por ser el responsable de la in-tervención de antidisturbios.El 9 de mayo, se convocó laprimera huelga general en to-dos los niveles educativos de lahistoria de España. En Univer-sidad la huelga solo fue convo-cadaporlosestudiantes,yaqueel resto de actores sociales deci-dieron apoyar, aunque no con-vocar. La huelga, efecto de losrecortesenpolíticaseducativas,del tasazo universitario y de laimplantacióndelaLeyLOMCE,sedesarrollósinincidentes,conun seguimiento amplio pero nocontundente en las universida-des públicas madrileñas. Hayque recordar que esta huelgacoincidió de pleno con los exá-menes finales de varias univer-sidades. Sin embargo, la mani-festación que se convocó por latarde sí fue calificada de éxitoen cuanto a su seguimiento.El mes de mayo continua-ba, y 7.000*estudiantes de laComunidad de Madrid se veíanabocados a la exclusión univer-sitaria al no poder pagarse lasencarecidas matrículas de launiversidad pública, debido alaumento de un 38% en las ta-sas universitarias. La anulaciónde matrícula supone la pérdidade todas las calificaciones obte-nidas en el año, y la imposibili-dad de presentarse tanto a losexámenes de junio como a losde julio o septiembre. Por estemotivo, el pasado 16 de mayotantoestudiantescomotrabaja-dores decidieron encerrarse enel Rectorado de la UCM (uni-versidad con mayoría de estu-diantes en exclusión universi-taria, 3.139 alumnas/os) hastaque el Rectorado diera una so-lución. Tras más de veinte díasencerrados, se consiguió pre-sionar al Rectorado de la UCMpara que fraccionara los pagosde las matrículas.Las reivindicaciones noacaban aquí. Piden la crea-ción de «un fondo de emergen-cias para becas», como ya exis-teenlaUniversidadAutónoma,que ha aumentado su fondode emergencias de 89.000 eu-ros en el curso 2011/2012 a500.000 euros en este curso.El resto de universidadespúblicas madrileñas tambiéncuentan con desahucios edu-cativos. Así, la Universidad Po-litécnica de Madrid cuenta con1.592 estudiantes que no pue-den costearse la matrícula. Launiversidad Rey Juan Carlos,cuenta con 815 afectados/as,y la Universidad de Alcalá con600 estudiantes en riesgo deexclusión universitaria.*Datos extraídos de laAgencia EFE. ■Texto: Álvaro PiélagoLa demostración de fuerza ha sido explícita. ENCERRADAS EN RECTORADO
  13. 13. 1315M MADRID COMUNIDADmadrid15m Junio de 2013 | Nº 15Ninis, ni ignorantes,ni indiferentesMEDIOAMBIENTE SOLLa Comunidad de Madridacepta incinerar residuos en laCementera de Morata de TajuñaLa Comunidad de Madridha emitido un informe favo-rable para que la cementeraPortland-Valderrivas (FCC),sita en Morata de Tajuña, in-cinere en sus hornos comocombustible lodos proceden-tes de depuradoras, neumá-ticos fuera de uso, vehículosal final de su vida útil, plásti-cos, restos de origen animaly rechazos de residuos muni-cipales.Todos estos productosemitirán sustancias peligro-sas a la atmósfera que afecta-rán tanto al medio ambientecomo a las personas que vi-ven en un radio de 20 km.La Comunidad de Ma-drid ha emitido este informefavorable sin tener en cuentalas más de 3.000 firmas quelos ciudadanos de Madridpresentaron ante el FiscalGeneral del Estado apoyan-do la denuncia de la Asocia-ción de Vecinos de Moratacontra la propia Comunidady la cementera Portland-Val-derrivas.Tampoco ha querido te-ner en cuenta los diferentesinformes emitidos por el Ins-tituto de Salud Carlos III so-bre la relación entre cáncere instalaciones industriales,entre los que se encuentra eltitulado Mortalidad por cán-cer en ciudades situadas en lasproximidades de incinerado-ras y de instalaciones para larecuperación o eliminación deresiduos peligrosos.Al tomar esta decisión,la Comunidad de Madrid in-cumple la jerarquía de resi-duos, que indica que la “va-lorización” es la última delas alternativas para la ges-tión de los mismos, sobre to-do porque todos los produc-tos que se incinerarán en lacementera son reciclables yreutilizables. ■Texto: Medioambiente Sol 15MA. P. PROSPERIDAD¿Qué tal un pocode formación 15Men economía?En 2012, las comisiones deEconomía de las asambleas15M de Chamartín Norte yProsperidad organizamos yrealizamos tres jornadas deeconomía sobre la crisis, conla finalidad de incrementar,a través del debate y la par-ticipación ciudadana, la for-mación en este campo de losy las indignadas. Necesitamossaber algo más de economíapara defendernos de los eco-nomistas y políticos neolibe-rales.La primera jornada fueen primavera, y centró en eldebate en las causas de la cri-sis. En verano, aprovechan-do el buen tiempo, salimosal parque de Berlín y mantu-vimos durante la tarde de unsábado un animado debatesobre las consecuencias de lacrisis. Y en otoño cerramos elciclo con la tercera jornada,que planteó debatir las alter-nativas y salidas de la crisis.Los organizadores y losparticipantes quedamos bas-tante contentos de lo conse-guido en las jornadas, y acor-damos repetir la iniciativa en2013. Así, tras unos meses depreparación convocamos aprimeros de marzo la cuartajornada, primera de este año,proponiendo esta vez un de-bate sobre nuestra amena-zada sanidad pública. Hubomayor participación y algu-nas novedades, como invitara otras asambleas 15M comoTetuán y Guindalera.Pues bien, cuando esteperiódico llegue a sus manosya habrá tenido lugar la quin-ta jornada de economía 15Men el parque de Berlín el 8 dejunio, y se habrán desarrolla-do los temas trabajo, desem-pleo y alternativas. Esta vez,además de las cuatro asam-bleas 15M promotoras de lasanteriores, invitamos tam-bién a las de Chamberí, Da-lí, Retiro y Hortaleza a par-ticipar y apoyar una jornadacon un formato siempre pa-recido, esto es, un primerplenario que encuadra paratoda la asistencia la proble-mática a debate, en esta oca-sión la incapacidad del sis-tema capitalista actual paraofrecer empleo digno a quie-nes lo buscan; unos talleres acontinuación para descenderal detalle en el debate, previadivisión de los asistentes enpequeños grupos, para facili-tar la participación; y al finalun nuevo plenario en el quese resumen las conclusionesa las que se ha llegado en ca-da grupo y se da paso al de-bate general de la jornada.Como ha sucedido en lasjornadas anteriores, se ela-borará un documento que re-sumirá lo debatido y las con-clusiones, similar al que yaexiste de la cuarta jornada,para ser publicado tambiénen los blogs de las asambleas.Y ya hemos empezado a pre-parar la sexta jornada... ■Texto: Asamblea Popu-lar de ProsperidadDespido masivo demaestros en la enseñanzapública madrileñaMiles de profesores de Prima-ria no volverán a las aulas enseptiembre dejando atrás añosde experiencia y varias oposi-ciones aprobadas sin plaza. LaConsejería manipuló datos so-bre aspirantes a profesor sus-pensos para desprestigiar a uncolectivo cuyas movilizacio-nes despertaron una corrien-te de solidaridad de padres yalumnos un año atrás.Finales de junio. Miles deprofesores interinos compa-tibilizan el trabajo corrigien-do controles y las evaluacio-nes con interminables tardesde estudio y preparación desus propios exámenes de opo-sición. Muchos no volverán atrabajar jamás. Un cambio enla baremación de las listas deinterinos decidido de formaunilateral por la Comunidadde Madrid ha rebajado casi to-da la puntuación que obteníanpor su experiencia docenteacumulada. Este cambio, uni-do a que el sistema de oposi-ción se basa en la valoraciónsubjetiva de un conjunto depruebas por parte de un tribu-nal, a diferencia de otras opo-siciones basadas en tests, haráque un mal día en el examensea el punto y final a miles dedilatadas carreras docentes.Estudiar no siempre garanti-za aprobar.La pretendida apuesta dela consejera de Educación Lu-cía Figar por elegir a «los me-jores» es la excusa de una nue-va rebaja salarial. Se trata dereemplazar al profesorado in-terino más experimentadopor otro inexperto que no co-bre complementos de anti-güedad. Una burla en toda re-gla al EBEP. Para neutralizarcualquier tipo de oposición aésta y otras medidas última-mente se han utilizado me-dios diversos que han ido enla dirección de romper la soli-daridad y confianza entre pa-dres, profesores y alumnos.Destacamos la difamación alprofesorado mediante el co-nocido anecdotario (sic.) querecogía respuestas disparata-das de opositores suspensos,la contratación de profesoresa dedo mediante anuncios porpalabras en internet o las con-tinuas represalias a docentes yequipos directivos que alzaronla voz contra tanto despropó-sito. Desde la Plataforma deInterinos de la Comunidad deMadrid queremos aclarar antela opinión pública las siguien-tes cuestiones:Si consideramos la elabo-ración del anecdotario, ele-vado por Lucía Figar a la másrespetable categoría de "in-forme", nos encontramos conque el método de recogidade datos es claramente sesga-do y bajo ningún concepto sumuestra puede ser tomada co-mo representativa de los co-nocimientos medios del profe-sorado de Madrid. No se avisóa los tribunales de oposicio-nes para que agrupasen el ti-po o porcentaje de errores porcada pregunta. A falta de másexplicaciones, parece claroque la Comunidad de Madridincluyó deliberadamente enel estudio aquellos tribunalescon notas muy bajas para pro-piciar el linchamiento y el des-prestigio de la enseñanza pú-blica y sus profesores frente ala concertada.Respecto al programa debilingüismo escolar, se tratade una verdadera estafa pe-dagógica que ha dilapidadomillones de euros y acabadocon cualquier rastro de cono-cimiento científico profundoen los alumnos allá donde fueaplicada. Socava la calidad dela enseñanza sin conseguiruna mínima competencia co-municativa en inglés de losescolares debido a su pésimoplanteamiento. Mientras serechaza cualquier tipo de eva-luación externa del programasiguen las supresiones y "fu-siones" (eufemismo de nuevocuño) de centros escolares a lolargo de toda la Comunidad.Por último, respecto a lasrepresalias, tras los trasladosforzosos y los expedientes aequipos directivos al inicio delcurso pasado, hoy la MareaVerde debe afrontar el expe-diente a dos profesoras del IESVallecas a las que se les fabri-có una acusación por mobbingpor cuestionar en una conver-sación informal la política decontrataciones a dedo de laConsejería.Para terminar, en el episo-dio más reciente de desprecioal profesorado de la enseñan-za pública madrileña Lucía Fi-gar ha rechazado la recomen-dación de su compañera departido y Defensora del Pue-blo para que negocie el cam-bio en el baremo de interinos.Desde la Plataforma hacemosun llamamiento a padres, pro-fesores y alumnos para res-ponder conjuntamente antetodas y cada una de las agre-siones que la enseñanza pú-blica madrileña está sufriendoen los últimos tiempos. ■Más información y movi-lizaciones en: http://consoli-dacionmadrid.blogspot.comTexto: PICAM

×