• Save
Prof.Giardina
Upcoming SlideShare
Loading in...5
×
 

Prof.Giardina

on

  • 345 views

Biomedicina e prevenzione

Biomedicina e prevenzione

Statistics

Views

Total Views
345
Views on SlideShare
221
Embed Views
124

Actions

Likes
0
Downloads
0
Comments
0

1 Embed 124

http://biomedicinaeprevenzione.uniroma2.it 124

Accessibility

Categories

Upload Details

Uploaded via as Microsoft PowerPoint

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

Prof.Giardina Prof.Giardina Presentation Transcript

  • Lo studio dei biomarcatori genomici:applicazioni diagnostiche nellamedicina personalizzata e forenseEmiliano GiardinaI GIORNATA SCIENTIFICA DEL DIPARTIMENTOdi BIOMEDICINA E PREVENZIONE
  • • Nome Cognome, qualifica: Emiliano Giardina, Ricercatore• SSD di afferenza: MED/03 (Genetica Medica)• Patologie di maggior interesse: Psoriasi, Psoriasi Artropatica, Eczema Atopico,Degenerazione Maculare Senile•Argomenti generali di interesse: Genetica Predittiva, Farmacogenetica, DiagnosiPrenatale, Genetica Forense• Metodiche di laboratorio: PCR, RT-PCR, Sequenziamento, Next generationsequencing• Collaborazioni : Oculistica PTV (prof. Ricci- Prof. Cusumano)Reumatologia PTV (Prof. Perricone)Dermatologia PTV (Prof. Chimenti)Pediatria: dott.sse Moschese/ChiniOspedale Sacco di Milano: prof. StaurenghiUniv. Torino: dott.ssa Chiara EandiFatebenefratelli San Pietro: dott.ssa Elena GalliIDI: dott.ssa Paola Fortugno / Giovanna ZambrunoPAGE Consortium
  • I giornata ricerca scientifica Dipartimento di Biomedicina e Prevenzione20/05/2013
  •  modelli di eredità alleli di suscettibilità patogenesi familiarità fattori ambientali capacità predittivaI giornata ricerca scientifica Dipartimento di Biomedicina e Prevenzione20/05/2013
  • Infiltrazione di celluleinfiammatorie nel dermaIperproliferazione deicheratinocitiIl normale ciclo dimaturazione dei cheratinocitiè di circa 28-30 giorniNelle lesionipsoriasiche è acceleratoa 3-4 giorniEpidermide normale2-4% della popolazione rapporto maschi/femmine 1:1
  • FAMILIARITA’Primi studi 1963 G.Lomholt: Isole Faroe Il 90% dei pazienti conpsoriasi ha almeno unparente di I grado affettodalla malattia Una persona che ha unfratello affetto il rischio diammalarsi a sua volta è circadel 12% Se oltre al fratello è affettoanche un genitore,il rischio arriva al 35%.I giornata ricerca scientifica Dipartimento di Biomedicina e Prevenzione20/05/2013
  • I giornata ricerca scientifica Dipartimento di Biomedicina e Prevenzione20/05/2013
  • I giornata ricerca scientifica Dipartimento di Biomedicina e Prevenzione20/05/2013
  • I giornata ricerca scientifica Dipartimento di Biomedicina e Prevenzione20/05/2013
  • De Cid et al.,2009I giornata ricerca scientifica Dipartimento di Biomedicina e Prevenzione20/05/2013
  • I giornata ricerca scientifica Dipartimento di Biomedicina e Prevenzione20/05/2013
  • I giornata ricerca scientifica Dipartimento di Biomedicina e Prevenzione20/05/2013
  • I giornata ricerca scientifica Dipartimento di Biomedicina e Prevenzione20/05/2013
  • 20/05/2013I giornata ricerca scientifica Dipartimento di Biomedicina e Prevenzione
  • Genetic profiles different between cases and controlsDiscrimination between at risk and protective individualsI giornata ricerca scientifica Dipartimento di Biomedicina e Prevenzione20/05/2013
  • I giornata ricerca scientifica Dipartimento di Biomedicina e Prevenzione20/05/2013
  • I giornata ricerca scientifica Dipartimento di Biomedicina e Prevenzione20/05/2013
  • DEGENERAZIONE MACULARE LEGATA ALL’ETA’La DMLE è dovuta all’accentuazione ed accelerazione dei fisiologiciprocessi di invecchiamento della retina, in particolare a caricodell’epitelio pigmentato retinico e della membrana di Bruch.I giornata ricerca scientifica Dipartimento di Biomedicina e Prevenzione20/05/2013
  • E’ la principale causa di perdita irreversibile della funzionevisiva centrale nei soggetti di età superiore a 65 anni chevivono nei paesi industrializzati.Incidenza annua: 600mila-1milione e 100 mila in USA.150.000 –275.000 in Italia.Fattori esogeni (alimentazione,radiazioni UV,fumo, ecc.)I giornata ricerca scientifica Dipartimento di Biomedicina e Prevenzione20/05/2013
  • 00.511.522.533.5412.810.911.93.91 1.11.5I giornata ricerca scientifica Dipartimento di Biomedicina e Prevenzione20/05/2013
  • -41611162126TTCTCCTTCTCCGGGTTTGGCG/CCCCCT/TT1 1.83.51 1.63.713.125.410.310.3I giornata ricerca scientifica Dipartimento di Biomedicina e Prevenzione20/05/2013
  • AMDARMS2CFHC2IL8UnknownPsoriasiPSORS1PSORS2PSORS3PSORS4PSORS5PSORS6PSORS7PSORS8PSORS9UnknownI giornata ricerca scientifica Dipartimento di Biomedicina e Prevenzione20/05/2013
  • Giardina and Ricci, submittedI giornata ricerca scientifica Dipartimento di Biomedicina e Prevenzione20/05/2013
  • • Key regulatory glycoprotein in the complement-mediated immune systemVariations in in the CFH geneaffect a region of the CFHprotein that is important forbinding to CRP. The CFH(Y402H) protein that has areduced ability to bind to CRP.Excess levels of CRP mightlead to an overactivecomplement system thatdamages eye tissue.I giornata ricerca scientifica Dipartimento di Biomedicina e Prevenzione20/05/2013
  • I giornata ricerca scientifica Dipartimento di Biomedicina e Prevenzione20/05/2013
  • I giornata ricerca scientifica Dipartimento di Biomedicina e Prevenzione20/05/2013
  • carbamazepine (CBZ), lamotrigine (LTG), phenobarbital (PHB),phenytoin (PHT), or valproic acid (VPA)I giornata ricerca scientifica Dipartimento di Biomedicina e Prevenzione20/05/2013
  • I giornata ricerca scientifica Dipartimento di Biomedicina e Prevenzione20/05/2013
  • ProportionofSPT-PosandSPT-NegSubjectsNumber of Days between start of ABC and onset of ABC HSR4%8%12%16%20%0 7 14 21 28 35 42 >42SPT-Pos(n=47)SPT-Neg(n=148)I giornata ricerca scientifica Dipartimento di Biomedicina e Prevenzione20/05/2013
  • Adhesive surface1% abacavir10% abacavirPetrolatum controlExcipient controlSchematic top view of skin patch• Immune cell-mediated reaction• Research tool used to identifypatients with immune-mediatedabacavir HSRPhillips et al. AIDS 2002 and 2005Phillips et al. IAS 2007 Abstract MOPEB00124 Hour 48 HourI giornata ricerca scientifica Dipartimento di Biomedicina e Prevenzione20/05/2013
  • ProportionofSPT-PosandSPT-NegSubjectsNumber of Days between start of ABC and onset of ABC HSR4%8%12%16%20%0 7 14 21 28 35 42 >42SPT-Pos(n=47)SPT-Neg(n=148)I giornata ricerca scientifica Dipartimento di Biomedicina e Prevenzione20/05/2013
  • ProportionofSPT-PosSubjectsNumber of Days between start of ABC and onset of ABC HSR4%8%12%16%20%0 7 14 21 28 35 42 >42SPT-Pos(n=47)I giornata ricerca scientifica Dipartimento di Biomedicina e Prevenzione20/05/2013
  • Giardina et al.,2010I giornata ricerca scientifica Dipartimento di Biomedicina e Prevenzione20/05/2013
  • I giornata ricerca scientifica Dipartimento di Biomedicina e Prevenzione20/05/2013
  • I giornata ricerca scientifica Dipartimento di Biomedicina e Prevenzione20/05/2013
  • I giornata ricerca scientifica Dipartimento di Biomedicina e Prevenzione20/05/2013
  • I giornata ricerca scientifica Dipartimento di Biomedicina e Prevenzione20/05/2013
  • Giardina et al.,2007; 2009; 2010I giornata ricerca scientifica Dipartimento di Biomedicina e Prevenzione20/05/2013
  • Dott.ssa Raffaella CascellaDott.ssa Beatrice De MatteoDott.ssa Laura ManzoDott.ssa Cristina PeconiDott.ssa Ilenia PietrangeliDott. Michele RagazzoDott.ssa Stefania ZampattiI giornata ricerca scientifica Dipartimento di Biomedicina e Prevenzione20/05/2013