Your SlideShare is downloading. ×

These alain hehn

672

Published on

0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total Views
672
On Slideshare
0
From Embeds
0
Number of Embeds
0
Actions
Shares
0
Downloads
10
Comments
0
Likes
0
Embeds 0
No embeds

Report content
Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
No notes for slide

Transcript

  • 1. UNIVERSITE LOUIS PASTEUR STRASBOURG I 1995 THESE présentée à LUFR DES SCIENCES DE LA VIE ET DE LA TERRE pour obtenir le titre de DOCTEUR DE LUNIVERSITE LOUIS PASTEUR domaine : BIOLOGIE MOLECULAIRE par Alain HEHNLES GENES 3 PROXIMAUX DU RNA 2 DU VIRUS DES NERVURES JAUNES ET NECROTIQUES DE LA BETTERAVE (OU BNYVV) :LEUR ROLE DANS LA REPLICATION ET LA TRADUCTION DU GENOME VIRAL AINSI QUE DANS LE MOUVEMENT DU VIRUS DE CELLULE A CELLULE. Soutenue le 27 juin 1995 devant la Commission dExamen Dr. M. LEGRAND Rapporteur interne Pr. A. VAN KAMMEN Rapporteur externe Dr. T. CANDRESSE Rapporteur externe Dr. K. RICHARDS Examinateur Pr. G. JONARD Directeur de Thèse Institut de Biologie Moléculaire des Plantes (IBMP-CNRS) Strasbourg
  • 2. à mes parents,à Valérie, à Michel
  • 3. Je voudrais remercier ici, le professeur Jonard qui ma accordé sa confiance un matindavril 1991 en maccueillant au sein de son groupe, me donnant ainsi lopportunité deréaliser cette thèse.La recherche est un labyrinthe dans lequel on peut aisément ségarer. Merci àmessieurs Guilley et Richards, les 2 autres membres du TCB, davoir été disponiblepour mécouter, me conseiller et me diriger efficacement quand il le fallait.Jaimerai exprimer ma gratitude aux membres du jury : messieurs Candresse, Legrandet Van Kammen pour avoir accepté de juger ce travail.Mes remerciements vont tout particulièrement à Salah Bouzoubaa qui, armé debeaucoup de patience (si, si, beaucoup de patience ! ), a su minitier à la paillasse et àla recherche en général.Merci également à Mme Marbach pour avoir préparé chaque semaine, inlassablement,ces fameux protoplastes, source de joie et souvent de dépit.Je tiens a exprimer ma reconnaissance à Mme Fritsch qui, au cours de nos discussions,ma permis de mieux comprendre la maturation mais aussi le frame-shift...!Enfin, je voudrais remercier toutes les personnes qui, de près ou de loin, ont contribué àfaire de cette thèse ce quelle est et avec qui jai partagé tant de gâteaux, de chocolats etautre thé à la menthe.
  • 4. SOMMAIRESOMMAIRE.........................................................................................................................1INTRODUCTION ...............................................................................................................7 RESULTATSCHAPITRE 1 : LES PROTEINES EXPRIMEES A PARTIR DU "TRIPLE GENEBLOCK" (TGB) SONT DIRECTEMENT IMPLIQUEES DANS LEMOUVEMENT DU VIRUS DE CELLULE A CELLULE. ............................................17I-Etat des connaissances sur les mécanismes de transport des virus. ....................................19 1-Stratégie utilisée par les tobamovirus. ....................................................................20 2-Stratégie utilisée par les comovirus, les népovirus et les caulimovirus..................20 3-Stratégie utilisée par les hordeivirus, les potexvirus et les furovirus......................21II-Rôle du Triple Gene Block dans le mouvement de cellule à cellule du BNYVV. ............23 1-Le Triple Gene Block du BNYVV est impliqué dans le mouvement du virus de cellule à cellule...........................................................................................................23 2-Les protéines P42 et P13 du Triple Gene Block sont exprimées à partir de RNA subgénomiques. ................................................................................................27III-Conclusions et perspectives. .............................................................................................28Publication n°1 : EFFICIENT CELL TO CELL MOVEMENT OF BEET NECROTICYELLOW VEIN VIRUS REQUIRES 3 PROXIMAL GENES LOCATED ON RNA 2.....31
  • 5. Sommaire______________________________________________________________________CHAPITRE 2 : ETUDE DE LA PROTEINE P14 CODEE PARLORF 3 PROXIMALE DU RNA 2 DU BNYVV............................................................ 41I-Mise en évidence du rôle de la protéine P14 dans le cycle de multiplication duBNYVV. ................................................................................................................................ 41 1-Des mutations introduites dans le gène VI du RNA 2 engendrent une diminution du taux de réplication des RNA viraux. (publication n°1).....................41 2-La protéine P14 joue un rôle en cis dans la réplication du RNA 2 et active en trans la synthèse de la protéine de coque. (publication n°2) ..................................... 48 3-Mode daction de la protéine P14. .......................................................................... 54II-Mise en évidence de limportance des résidus cystéines 69, 72, 106 et 109 danslactivité de la protéine P14.................................................................................................... 60 1-Construction de mutants alanine (Giesman-Cookmeyer & Lommel, 1993). .........62 2-Propriétés biologiques des mutants alanine............................................................62III-Mise en évidence dinteractions protéine P14-acides nucléiques. .................................... 65 1-Clonage du gène VI dans le vecteur pET. .............................................................. 65 2-Purification partielle de la protéine P14 par chromatographie daffinité sur une colonne "Zinc Chelate Affinity Adsorbent" (ZCAA). ............................................... 67 3-Mise en évidence dinteractions protéine P14-acides nucléiques par la technique de "Northwestern" (Gramstat et al, 1990). ................................................69IV-Conclusion ....................................................................................................................... 69Publication n°2 : THE SMALL CYSTEIN-RICH PROTEIN P14 OF BEET NECROTICYELLOW VEIN VIRUS REGULATES ACCUMULATION OF RNA 2 IN CIS ANDCOAT PROTEIN IN TRANS................................................................................................. 73CHAPITRE 3 : DES RNA 2 DEFECTIFS SONT CAPABLES DINHIBER LAREPLICATION DU BNYVV ............................................................................................. 103 I-Rappel sur les stratégies de lutte antivirale par transgénose : expression de séquences dérivées du pathogène............................................................................... 103 II-Obtention de RNA défectifs artificiels du BNYVV : leur effet sur la réplication du virus. ................................................................................................... 109 2
  • 6. Sommaire______________________________________________________________________ 1-Obtention de RNA défectifs.................................................................... 109 2-Seules les délétions introduites dans le RNA 2 produisent des RNA ayant un effet Défectif Interférant........................................................................ 109 3-Analyse de leffet DI en fonction de la quantité de RNA DI utilisée et du temps. ......................................................................................................... 110 4-Analyse dans les plantes de leffet DI des différents mutants du RNA 2.112 III-Conclusions et perspectives. .................................................................................113Publication n°3 : ARTIFICIAL DEFECTIVE INTERFERING RNAs DERIVED FROMRNA 2 OF BEET NECROTIC YELLOW VEIN VIRUS .....................................................115CHAPITRE 4 : MISE EN EVIDENCE DUNE ACTIVITE PROTEOLYTIQUEASSOCIEE A LA PROTEINE P237 CODEE PAR LE RNA 1 DU BNYVV. ...............125 I-Les protéases dorigine virale et leurs caractéristiques ............................................127 1-Généralités sur les protéases. .................................................................. 127 2-Exemples de protéines virales présentant une activité protéasique ........ 130 II-Cas du BNYVV......................................................................................................131 1-Comparaison de séquences avec des domaines protéases dautres phytovirus................................................................................................... 131 2-Mise en évidence dune activité protéase associée à la protéine P237.... 134 III-Conclusions :.........................................................................................................135CONCLUSION ....................................................................................................................137 MATERIEL ET METHODESA-AMPLIFICATION, EXTRACTION ET MODIFICATIONS DE DNAPLASMIDIQUE...................................................................................................................141I-Souches bactériennes, vecteurs de clonage ou dexpression et milieux de culture. ............141 1-Souches bactériennes .............................................................................................141 2-Vecteurs .................................................................................................................143 3
  • 7. Sommaire______________________________________________________________________ 3-Milieux. .................................................................................................................. 146II-Transformation des souches bactériennes et mise en culture. ........................................... 146 1-Utilisation de Chlorure de Calcium........................................................................ 146 2-Transformation par électroporation ........................................................................ 147 3-Caractérisation des clones par hybridation in situ. ................................................. 148III-Extraction et analyse de DNA plasmidique......................................................................148 1-Minipréparation et maxipréparation ....................................................................... 148 2-Analyse. ..................................................................................................................150IV-Préparation de DNA plasmidique simple brin uridylé et mutagénèse dirigée selon laméthode de Kunkel . .............................................................................................................. 152 1-Culture. ................................................................................................................... 152 2-Purification du DNA simple brin. ..........................................................................152 3-Mutagénèse dirigée en utilisant des oligonucléotides modifiés (Zoller & Smith, 1982). .........................................................................................................................152V-Techniques de sous clonage par lutilisation denzymes.................................................... 153 1-Digestion enzymatique. .......................................................................................... 153 2-Obtention dextrémités franches. ............................................................................ 154 3-Déphosphorylation..................................................................................................155 4-Phosphorylation. ..................................................................................................... 156 5-Ligation................................................................................................................... 156VI-Amplification dun fragment de DNA par la technique de la PCR. .................................157 1-Principe de la méthode et conditions générales...................................................... 157 2-Cas particulier du RNA 2 du BNYVV. .................................................................. 158VII-Purification sur gel dagarose dun fragment de DNA obtenu par digestionenzymatique ou par PCR. ...................................................................................................... 158 1-Par électroélution....................................................................................................158 2-Par extraction dun gel LMP. ..................................................................................159VIII-Séquençage selon la méthode de Sanger, modifiée pour la T7 DNA polymérase.........159 1-Séquençage dun DNA plasmidique. ...................................................................... 159 4
  • 8. Sommaire______________________________________________________________________ 2-Séquençage dun produit PCR.................................................................................160IX-Transcription in vitro........................................................................................................161 1-Obtention de transcrits infectieux du BNYVV.......................................................161 2-Synthèse de sondes ribonucléiques.........................................................................163X-Analyse des transcrits par hybridation in situ ....................................................................163 1-Séparation des RNA par migration sur gel dagarose en conditions dénaturantes................................................................................................................163 2-Hybridation avec des sondes spécifiques radioactives. ..........................................165XI-Analyse de la descendance par réverse transcription........................................................166B-EXPRESSION IN VIVO OU TRADUCTION IN VITRO DES PROTEINES DEBNYVV .................................................................................................................................167I-Expression de protéines dans un système bactérien (Studier et al, 1990)...........................167II-Purification par chromatographie daffinité sur une colonne ZCAA (Zinc ChelateAffinity Adsorbent)................................................................................................................167III-Traduction in vitro dans un système acellulaire de réticulocytes de lapins. .....................168 1-Préparation du lysat de réticulocytes de lapins. ......................................................168 2-Traduction des produits de transcriptions...............................................................169IV-Analyse. ............................................................................................................................169 1-Par électrophorèse en conditions dénaturantes sur gel de polyacrylamide. ............169 2-Par immunorévélation après transfert. ....................................................................170V-Etude de lactivité fixatrice dune protéine par northwestern. (Gramstat et al, 1990)........173C-MULTIPLICATION DU VIRUS DANS UNE PLANTE HOTE :CHENOPODIUM QUINOA. ...............................................................................................173I-Plante hôte. ..........................................................................................................................173II-Préparation du virus. ..........................................................................................................174III-Extraction de RNA viraux à partir de feuilles de C. quinoa.............................................174 1-En présence de tampon "polysome" (Jackson & Larkins, 1976) ...........................174 5
  • 9. Sommaire______________________________________________________________________ 2- En présence de tampon Tris-Magnésium. .............................................................175IV-Préparation, inoculation et mise en culture de protoplastes. ............................................176 1-Préparation des protoplastes (Veidt et al, 1992)..................................................... 176 2-Infection des protoplastes par des acides nucléiques (RNA de BNYVV ou DNA plasmidique) et mise en culture........................................................................ 176V-Extraction des RNA viraux de protoplastes. ..................................................................... 177VI-Expression transitoire dans les feuilles de C. quinoa et Nicotiana tabacum. .................. 178 ANNEXESPublication n°4 : IDENTIFICATION AND CHARACTERIZATION OF RESISTANCETO RHIZOMANIA IN AN ECOTYPE OF BETA VULGARIS SUBSP. MARITIMA. ......... 179ABREVIATIONS ..................................................................................................................195REFERENCES BIBLIOGRAPHIQUES............................................................................... 199 6
  • 10. INTRODUCTION Cest en 1959, dans la vallée du Pô (Italie), que Canova décrit pour la premièrefois des betteraves malades présentant comme symptômes (1) des feuilles gaufrées avecdes tâches jaunes diffuses le long des nervures (voir figure 1-B) ; (2) un pivot de tailleréduite par rapport à celui dune plante saine ; (3) une nécrose des anneaux vasculairesfacilement observable lorsque le pivot est coupé transversalement ; et (4) une abondantebarbe "poivre et sel" due à une prolifération anormale et anarchique des radicelles (voirfigure 1-A). Cette dernière observation, la plus caractéristique, donne son nom à lamaladie : la rhizomanie, ce qui signifie étymologiquement "démence des racines" (rhizo= racines ; mania = folie) (voir figure 1-A). Cette maladie a ensuite été décrite au Japonen 1965 et fait son apparition en France, plus précisément en Alsace, dans les années 70(Putz et Vuittenez, 1974). La rhizomanie engendre une perte considérable dans lerendement en sucre qui passe de 18 à 8%, rendant lexploitation impropre. Dès 1966, Canova suggère que la maladie est due à un champignon du sol :Polymyxa betae. Cest un champignon inférieur, à zoospores biflagellées, parasiteintracellulaire des racines de betteraves. Il appartient à la classe des Myxomycètes et àlordre des Plasmodiophorales (Chadefaud & Emberger, 1942). Les spores de résistancese trouvant dans un sol contaminé vont germer et libérer des zoospores qui se déplacentvers les radicelles dune betterave, la propulsion se faisant grâce au mouvementcoordonné des 2 flagelles de la zoospore. Lorsque le contact avec une radicelle a lieu,les flagelles disparaissent et la zoospore déverse son contenu cellulaire dans la cellulehôte. Après 16 heures, on peut déjà observer un jeune plasmode qui va se différencier en
  • 11. Introduction______________________________________________________________________ABFigure 1 : Sym ptômes de la rhizomanie : (A) photo représentant des betteraves saines (à gauche) et rhizom aniées (à droite).(Photo fournie par lINRA de Colm ar). (B) Photo montrant les sym ptômes foliaires qui ont donné leur nom au virus. 8
  • 12. Introduction______________________________________________________________________ Figure 3 : Cycle de Polymyxa betae (daprès Keskin, 1967) 9
  • 13. Introduction______________________________________________________________________zoosporange ou en cystosore (Keskin, 1964 et 1967) (voir figure 3). Ce nest quen 1973 que Tamada et Baba démontrent que lagent responsable de larhizomanie est un virus : le beet necrotic yellow vein virus ou virus des nervures jauneset nécrotiques de la betterave (encore appelé BNYVV) ; ceci fut confirmé par Fujisawaet Sugimoto en 1977. Le champignon Polymyxa betae, quant à lui, est seulementimpliqué dans la transmission du BNYVV (Fujisawa & Sugimoto, 1976). Enfin, lespremières études au plan moléculaire furent initiées en 1983 (Putz et al, 1983) etdémarrèrent vraiment en 1985 (Richards et al, 1985). Le virus des nervures jaunes et nécrotiques de la betterave est un phytovirus (Putz,1977) appartenant à la famille des furovirus (fungus rod-shaped virus) (Brunt &Richards, 1989 ; Brunt, 1991). Son génome est composé de 4 RNA (voir figure 4) depolarité positive coiffés à leur extrémité 5 et polyadénylés à leur extrémité 3. Ces 4RNA sont encapsidés dans des particules virales de taille variable (390 nm, 265 nm, 100nm et 89 nm) et de symétrie hélicoïdale avec un diamètre constant de 20 nm. Danscertains isolats japonais, un 5ème RNA, de fonction inconnue, a été décrit (Tamada et al,1989). Les RNA 1 et 2 sont nécessaires à la réplication, lencapsidation et le mouvementde cellule à cellule du virus. Ils sont donc suffisants pour provoquer un processusinfectieux quand ils sont inoculés mécaniquement à des feuilles de Chenopodiumquinoa, une plante hôte (voir figure 2-B). Les RNA 3 et 4 restent cependant essentielslors de linfection naturelle des racines de betterave par lintermédiaire du champignonvecteur. Le RNA 1 (6746 nt) code pour une protéine de poids moléculaire 237 kDarenfermant les séquences consensus des méthyltransférase, hélicase (GKS) etpolymérase (GDD) (Bouzoubaa et al, 1987). Dautre part, comme nous le verrons dansle chapitre IV, la protéine P237 contient une séquence caractéristique des protéases detype papaïne (Koonin & Dolja, 1993 ; Rozanov et al, 1995) localisée entre le domainehélicase et le domaine polymérase. Le RNA 1 est capable de sautorépliquer lorsquil estinoculé seul à 10
  • 14. Introduction______________________________________________________________________ P 237 GKS GDD RNA 1 MTR HEL PRO POL AAA ? ? ? P75 TGB CP P13 P14 RNA 2 GKS AAA UAG 15 K P42 RNA Subgénomique P25 P31 4.6 K RNA 3 AAA RNA 4 AAA N Fonctions dans le cycle de multiplication. Mouvement de Réplication Transmission cellule à cellule Encapsidation Symptomatologie et Régulation de la amplification du réplication et de la virus dans les racines traduction Inconnue Figure 4 : Organisation génétique du virus des nervures jaunes et nécrotiques de la betterave ou BNYVV et fonctions associées aux protéines codées par les différents RNA génomiques. 11
  • 15. Introduction______________________________________________________________________des protoplastes de cellules de mésophylle de C. quinoa (voir figure 5) (Bouzoubaa &Scheidecker, 1990 ; Gilmer et al, 1992). Le RNA 2 (4612 nt) présente une organisation génétique plus complexe avec 6phases de lecture ouverte (ORF). La première ORF dirige la synthèse de la protéine decapside (CP) dun poids moléculaire de 21 kDa. La protéine de translecture de 75 kDaobtenue par suppression du codon stop UAG de la première ORF (Ziegler et al, 1985 ;Bouzoubaa et al, 1986), joue un rôle dans linitiation de lencapsidation (Schmitt et al,1992), dans la transmission du virus par le vecteur (Tamada & Kusume, 1991) et a étévisualisée par microscopie électronique à lune des extrémités des particules virales(Haeberlé et al, 1994). Les 3 ORF chevauchantes III, IV et V sont regroupées sous leterme de "triple gene block" (ou TGB). Une organisation génétique analogue a étédécrite pour dautres furovirus (Herzog et al, 1994 ; Scott et al, 1994) mais égalementchez des virus comme les carlavirus, les hordeivirus et les potexvirus (Morozov et al,1989). Ces 3 ORF du BNYVV codent respectivement pour des protéines potentielles depoids moléculaire 42, 13 et 15 kDa. La protéine P42 dispose dune séquence consensusGKS caractéristique dune activité NTP-binding souvent associée aux hélicases et a étémise en évidence, ainsi que la protéine P13, dans les fractions membranaires préparées àpartir de feuilles de C. quinoa infectées par le virus (Niesbach-Klösgen et al, 1990). Enrevanche, la protéine P15 na pas encore été détectée in planta. Enfin, lORF 3proximale du RNA 2 code pour une protéine de 14 kDa riche en cystéine et qui a étélocalisée dans la fraction cytosolique de feuilles infectées (Niesbach-Klösgen et al,1990). Cette protéine, comme nous le verrons ultérieurement (voir chapitre 2), joue unrôle dans la régulation de linfection virale. Le RNA 3 (1773 nt) code pour une protéine de 25 kDa impliquée dans lamultiplication virale au niveau des racines de betteraves infectées (Koenig et al, 1986 ;Lemaire et al, 1988 ; Tamada & Abe, 1989) ainsi que dans la symptomatologie auniveau des feuilles (Jupin et al, 1992). Une étude immunocytochimique récente montreque la protéine P25 est synthétisée très tôt dans le cycle viral ; de plus elle est détectée à 12
  • 16. Introduction______________________________________________________________________la fois dans le cytoplasme et dans le noyau des cellules infectées (Haeberlé & Stussi-Garraud, 13
  • 17. Introduction______________________________________________________________________ Figure 4 : Protoplastes préparés à partir de cellules de mésophylle de Chenopodium quinoa dans les conditions décrites dans Matériel et méthodes. 14
  • 18. Introduction______________________________________________________________________1995). Une seconde ORF, lORF N, est exprimée lorsque des délétions dans le gènecodant pour la protéine P25 rapprochent lAUG initiateur de cette petite ORF de laséquence 5 non codante (Jupin et al, 1990). Lexpression de la protéine très hydrophobecodée par ce gène N entraîne lapparition de lésions nécrotiques sur les feuilles desplantes hôtes infectées. Enfin, une troisième ORF a été mise en évidence et code pourune protéine potentielle de 4,6 kDa qui serait exprimée à partir dun RNA subgénomiquedétecté dans les feuilles infectées et qui est redondant avec les 545 derniers nucléotidesdu RNA 3 (Bouzoubaa et al, 1991). Le rôle de ce peptide est actuellement en cours decaractérisation au laboratoire. Des résultats préliminaires montrent que des délétionsréalisées dans cette ORF inhibent le mouvement à longue distance du virus dans Betamacrocarpa (Tamada, communication personnelle) alors que des mutations ponctuellesintroduisant des codons de terminaison restent sans effet (Guntz-Lauber, communicationpersonnelle). Cette observation semble indiquer que cest la séquence nucléotidique dece RNA subgénomique qui est directement impliquée dans ce phénomène de transport àlongue distance et non pas son produit dexpression. Le RNA 4 (1467 nt) code pour une protéine de 31 kDa (Bouzoubaa et al, 1985)qui joue un rôle prépondérant dans la transmission du virus par le vecteur fongique(Koenig & Burgermeister, 1989 ; Tamada & Abe, 1989). Mon travail de thèse a consisté plus particulièrement à caractériser le rôle desproduits des gènes 3 proximaux du RNA 2. Pour cela nous disposions au laboratoiredes clones cDNA complets des 4 RNA viraux (Quillet et al, 1989) permettant dobtenirdes transcrits infectieux. A partir de ces clones, nous avons construit des mutantsponctuels ou des mutants de délétion dans lune ou lautre des séquences codantes, puisnous avons étudié in vivo leffet de ces modifications. Ainsi, dans le premier chapitre,jaborderai les problèmes du mouvement du virus de cellule à cellule et je démontreraique les protéines codées par les trois cistrons du triple gene block sont impliquées dansce processus. Dans le chapitre 2, je présenterai les résultats concernant le rôle de laprotéine P14, codée par lORF VI du RNA 2, dans la réplication et dans la traduction du 15
  • 19. Introduction______________________________________________________________________RNA 2. Le 3ème chapitre traitera des stratégies antivirales qui peuvent être envisagéespour bloquer la réplication du BNYVV. Jy montrerai comment nous avons obtenu desRNA défectifs interférants (ou RNA DI) à partir du RNA 2, RNA DI que lon peutenvisager dutiliser comme outil de lutte contre ce virus. Enfin dans le chapitre IV, jedécrirai des résultats préliminaires qui permettent daffirmer que la protéine P237, codéepar le RNA 1, est une polyprotéine susceptible dêtre maturée au cours du cycle demultiplication virale par une activité protéasique associée à cette polyprotéine. 16
  • 20. CHAPITRE 1 : LES PROTEINES EXPRIMEES A PARTIR DU "TRIPLE GENE BLOCK" (TGB) SONT DIRECTEMENT IMPLIQUEES DANS LE MOUVEMENT DU VIRUS DE CELLULE A CELLULE. Linfection dune plante par un virus à RNA passe, en général, par quatre étapesmajeures. Dans un premier temps le virus doit pénétrer dans les cellules de lhôte. Cetteinfection peut se faire par inoculation mécanique en provoquant une lésion au niveaudes tissus de la plante ; elle peut également sétablir par lintermédiaire dun vecteur(aphide, nématode, champignon). Quand il est en place, le virus doit pouvoir semultiplier, multiplication qui sous entend la décapsidation du ou des RNA génomiquesprovenant de linoculum, leur traduction, leur réplication et finalement lencapsidationdes RNA néosynthétisés. Dans un troisième temps, le virus est amené à quitter le sitedinfection pour migrer dans les cellules voisines. Finalement quand il atteint lesvaisseaux conducteurs, il va pouvoir infecter le reste de la plante provoquant ainsi uneinfection systémique. La spécificité dinfection dun virus pour un hôte particulierconsiste donc à pouvoir réaliser toutes ces étapes.
  • 21. Résultats______________________________________________________________________ Protéines de mouvement Paroi cellulaire Type TMV Réplication du virus ? protéines ? cellulaires RNA viral diffusion de néosynthétisé ? linfection virale Protéines de Type Protéines de mouvement CPMV coque Figure I-1 : Représentation schématique des 2 types de stratégies qui semblent se dégager des études effectuées sur le mouvement de cellule à cellule des virus de plantes. Le premier mécanisme fait appel à une protéine de mouvement qui augmente la limite dexclusion des plasmodesmes et qui permet une linéarisation des RNA viraux qui pourront ainsi diffuser sous forme de complexe ribonucléoprotéique. Cette stratégie est adoptée par le TMV. Le second mécanisme engendre une modification irréversible des plasmodesmes avec la présence de particules virales à lintérieur de microtubules (cest le cas du CPMV). 18
  • 22. Chapitre 1______________________________________________________________________ Avant de présenter les résultats obtenus dans létude des gènes responsables de ladiffusion du BNYVV, je voudrais rappeler brièvement ce que lon sait sur les différentsmécanismes de diffusion de cellule à cellule de linfection virale.I-Etat des connaissances sur les mécanismes de transport des virus. En raison de la présence de la paroi pectocellulosique qui entoure chaque cellulevégétale, les possibilités de mouvement du virus de cellule à cellule sont très restreintes.Le seul passage possible est représenté par les plasmodesmes qui sont descommunications intercellulaires assurant une continuité cytoplasmique entre 2 celluleset permettant ainsi des échanges de métabolites. Des études par micro injection demolécules fluorescentes de taille variable dans les cellules végétales ont permis demettre en évidence la limite dexclusion moléculaire (SEL ou Size Exclusion Limit) desplasmodesmes. Elle se situe entre 0,7 et 1 kDa ce qui correspond à peu près à undiamètre de 1,5 à 2 nm. (Goodwin, 1983 ; Tucker, 1982). Bien que la SEL soit relativement petite, Esau a montré, dès 1967, la présence devirus de la jaunisse de la betterave (BYV) au niveau des plasmodesmes de plantesinfectées. Or le diamètre de ces virus à symétrie hélicoïdale est voisin de 10 nm, soitcinq fois supérieure à la SEL. Dautres virus à symétrie hélicoïdale tels que le potatovirus X (ou PVX) (Allison & Shalla, 1974) et le barley stripe mosaic virus (ou BSMV)(Mc Mullen et al, 1977), ainsi que des virus à symétrie icosaédrique comme leslutéovirus (Gill & Chong, 1975 ; DArcy & De Zoeten, 1979) et les népovirus (DeZoeten & Gaard, 1969) ont pu être observés au niveau de ces structures. Compte tenu deleur SEL, il est évident que les plasmodesmes doivent donc subir des modificationsstructurales pour permettre le passage de ces virus (Robards & Lucas, 1990). A lheure actuelle, 2 mécanismes majeurs (figure I-1) semblent être mis en jeudans la diffusion de linfection virale à savoir le mécanisme utilisé par le virus de lamosaïque du tabac (ou TMV) et dautres tobamovirus et la stratégie employée par lescomovirus, les népovirus et les caulimovirus. 19
  • 23. Résultats______________________________________________________________________1-Stratégie utilisée par les tobamovirus. Les résultats majeurs ont été obtenus avec le TMV qui fut pendant longtemps lephytovirus le plus étudié sur le plan physico-chimique et biologique. Il code notammentpour une protéine de 30 kDa essentielle au mouvement du virus de cellule à cellule(Leonard & Zaitlin, 1982 ; Meshi et al, 1987). Des études par microscopie électroniqueont permis de montrer que des plantes infectées par ce virus ont des plasmodesmesayant une SEL supérieure à celle dune plante saine. Elle passe de 1,5 nm à 5-6 nm. Desplantes transgéniques exprimant la protéine P30 de manière constitutive présententmême une SEL de 6 à 9 nm (Deom et al, 1990 ; Wolf et al, 1989). La protéine P30 a puêtre localisée au niveau de ces plasmodesmes (Ding et al, 1992 ; Atkins et al, 1991 ;Moser et al, 1988, Tomenius et al, 1987) sans pour autant en modifier la structure(Shalla et al, 1982). Cette augmentation de la SEL nest pourtant pas suffisante pourpermettre le passage du TMV dune cellule à une autre, les particules virales en bâtonnetayant un diamètre moyen de 18 nm et lencombrement moyen dune molécule de RNAétant de 10 nm (Gibbs, 1976). La protéine P30 a également la propriété de fixer lesacides nucléiques (Citovsky et al, 1990). Ces propriétés ont donc amené Citovsky etcollaborateurs (1992) à proposer un modèle dans lequel la protéine P30 joue un rôledouble dans le mécanisme de mouvement : (1) elle augmente la SEL des plasmodesmesdun facteur 3 à 4 et (2), en se fixant au RNA, elle lui confère une structure déroulée quilui permet de passer au travers des plasmodesmes. Ceci sous-entend que le mouvementde cellule à cellule se fait sous forme de complexe ribonucléoprotéique sans interventionde la protéine de capside. Lintervention de facteurs cellulaires na pas encore étédémontrée pour le moment.2-Stratégie utilisée par les comovirus, les népovirus et les caulimovirus. Ce second mécanisme a été plus particulièrement étudié pour un comovirus : lecowpea mosaic virus (ou CPMV), un virus à génome bipartite qui exprime soninformation sous forme de polyprotéines qui sont ensuite maturées. Linformationgénétique de ce virus est portée par 2 RNA génomiques. Le B-RNA dispose de 20
  • 24. Chapitre 1______________________________________________________________________linformation nécessaire et suffisante à la réplication car il est capable de sauto répliquerdans les protoplastes (Goldbach et al, 1980). Par contre, en labsence du M-RNA, levirus nest pas capable dinduire une infection dans la plante. Une analyse détaillée amontré que non seulement les protéines 48K/58K, dont linformation est portée par larégion 5 terminale du M-RNA, sont nécessaires au mouvement de cellule à cellule(Rezelman et al, 1982), mais également les protéines de capsides VP37 et VP23. Lesprotéines non structurales 48/58 K ont été localisées au niveau de structures tubulairesdans les plasmodesmes de plantes infectées (Van Lent et al, 1990) : ces structuresmodifient les plasmodesmes de façon irréversible et renferment des particules virales.Ces tubules peuvent également être observées au niveau de la membrane de protoplastesinfectés (Van Lent, 1991). Enfin, plus récemment, grâce à des expériences dexpressiontransitoire, il a été possible de démontrer que la protéine de 48 K était, dune part, laprotéine de mouvement et, dautre part, la seule protéine virale responsable de laformation in vivo de ces tubules (Kasteel et al, 1993 ; Wellink et al, 1993). Cependant,comme dans le cas de la stratégie utilisée par les tobamovirus, la participation deprotéines cellulaires ne peut être exclue à lheure actuelle. La formation de tubules et la présence de particules virales à lintérieur de cesstructures ont également été observées pour dautres types de virus comme leuphorbiamosaic virus (EMV), un géminivirus (Kim & Lee, 1992), le cauliflower mosaic virus(CaMV), un caulimovirus (Stussi-Garraud et al, 1994), le tomato spotted wilt virus(TSWV), un tospovirus (Kormelink, 1994) et le grapevine fanleaf virus (GFLV), unnépovirus (Ritzenthaler et al, 1995).3-Stratégie utilisée par les hordeivirus, les potexvirus et les furovirus. Enfin dautres virus utilisent une stratégie de mouvement qui nécessite la synthèsede 3 protéines à partir de 3 gènes regroupés en triple gene block, mais, à lheure actuelle,le mécanisme mis en oeuvre nest pas encore élucidé. Cette stratégie est utilisée par le 21
  • 25. Résultats______________________________________________________________________ BNYVV RNA 1 A CP RNA 2 A TGB RNA 3 A RNA 4 A WClMV CP A TGB BSMV RNA α AA RNA ß CP AA TGB RNA γ AA Figure I-2 : Organisation génétique du BNYVV, du WClMV et du BSMV. Domaine hydrophobe Séquence GDD caractéristique des polymérases virales Séquence GKS, site de fixation de nucléotides triphosphates CP Protéine de capside TGB Triple Gene block impliqué dans le mouvement du virus de cellule à cellule Protéine jouant un rôle dans la réplication du virus 22
  • 26. Chapitre 1______________________________________________________________________BSMV) (Petty et al, 1990), un hordeivirus et le white clover mosaic virus (WClMV)(Beck et al, 1991), un potexvirus. Le BNYVV fait appel également à un ensemble de 3gènes pour assurer la fonction de transport. Les ressemblances entres ces 3 virus nesarrêtent pas là ; il faut également noter des homologies de séquences importantes entreces protéines, plus particulièrement au niveau des protéines codées par les 2 premiersgènes du TGB (Figure I-2).II-Rôle du Triple Gene Block dans le mouvement de cellule à cellule du BNYVV. Linoculation mécanique de feuilles de Chenopodium quinoa par des transcrits duRNA 1 et du RNA 2 provoque des lésions chlorotiques localisées. Les RNA 1 et 2 duBNYVV sont donc nécessaires et suffisants aux fonctions de base du virus, à savoir laréplication, lencapsidation et le mouvement de cellule à cellule de linfection virale. Les ORF III, IV et V du RNA 2 du BNYVV sont organisées en triple gene block.La protéine P42 exprimée à partir de lORF III renferme une séquence GKS souventassociée aux hélicases. Les protéines P13 et P15 codées respectivement par les ORF IVet V contiennent des domaines hydrophobes. Les protéines P42 et P13 ont été localiséesau niveau de fractions membranaires dans des plantes infectées (Niesbach-Klösgen et al,1990).1-Le Triple Gene Block du BNYVV est impliqué dans le mouvement du virus decellule à cellule. a-Construction de mutants du TGB. Pour tous les RNA génomiques, nous disposons de clones cDNA complets à partirdesquels il est possible de synthétiser in vitro des transcrits qui se sont révélés êtreinfectieux lors dune inoculation mécanique de feuilles de C. quinoa. Partant de cesconstructions, nous avons pu réaliser des modifications au sein des RNA génomiques 23
  • 27. Résultats______________________________________________________________________ CP RNA 2 A TGB mutant H A sauvage ACA CTA GTA GAG mutant ACA CTA GCT AGT mutant I A sauvage AT AGA G mutant AT AAC TCG mutant J A sauvage AGG AAT TCG mutant AGG AAT T AA TTC GFigure I-3 : Localisation des mutations introduites dans le triple gene block (TGB) du RNA 2 du BNYVV. Les sites de restriction utilisés pour introduire les modifications (Spe I pour le mutant H et Eco RI pour le mutant J) sont représentés en rouge. Les nucléotides insérés sont soulignés. 24
  • 28. Chapitre 1______________________________________________________________________afin de pouvoir étudier le rôle des différents gènes. Par mutagénèse dirigée, nous avonsconstruit les mutants décrits figure I-3. Pour obtenir le mutant H, nous avons linéarisé leplasmide pB218 en un site Spe I, puis, par lutilisation du fragment de Klenow de laDNA polymérase, ce site a été rempli, générant ainsi, après religation, un plasmidepB218 ayant une insertion de 4 nucléotides au niveau de lORF III. Lutilisation dunoligonucléotide mutagène nous a permis dinsérer 4 nucléotides (ACTC) dans le gène IVet dobtenir ainsi le mutant I. Enfin, pour construire le mutant J, il nous a fallu faire unedigestion partielle Eco RI du plasmide pBF14 suivie dun remplissage du site derestriction par le fragment de Klenow de la DNA polymérase. Après ligation, le cloneobtenu dispose dune insertion de 4 nucléotides. Pour tous les mutants décrits ci dessus,linsertion de 4 nucléotides génère un changement du cadre de lecture, lapparition duncodon stop et donc la synthèse de protéines tronquées non fonctionnelles. b-Etude de leffet des mutations introduites dans le TGB. Afin de vérifier si les protéines codées par le TGB jouent un rôle dans laréplication, les transcrits correspondants à ces différents mutants ont été coinoculés avecdu RNA 1 (nécessaire à la réplication) à des protoplastes de C. quinoa. Après 48 heuresde culture, les RNA totaux ont été extraits puis analysés par hybridation moléculaire enutilisant des sondes spécifiques des RNA 1 (pB12 : nt 4740 à 6560) et 2 (pB21 : nt 2335à 3793). Nous avons ainsi pu constater quen labsence des protéines P42 (mutant H),P13 (mutant I) et P15 (mutant J) fonctionnelles le virus était encore capable de serépliquer (voir publication 1, figure 4, pistes 2, 3 et 4). Les mutations introduites dansces 3 gènes naltèrent donc pas une structure impliquée en cis dans la reconnaissance parle complexe de réplication. Pour tester limpact des modifications introduites dans le TGB sur la diffusion delinfection virale, les différents mutants ont ensuite été transcrits et coinoculés avec duRNA 1 à des feuilles de C. quinoa. Une semaine après linfection, alors quil apparaît 25
  • 29. Résultats______________________________________________________________________des symptômes chlorotiques classiques sur les feuilles inoculées par du RNA 1 et 2sauvage, P75 CP 54 kDa P13 P14 RNA 2 A 4,6 kb P42 P15* TGB nt 2324-3789 pB21 A nt 638 à nt 3949 à 2081 ² BB nt 2078 à 4481 ² AS 2715 218Bg 2 sub c A 0,7 kb B 2 sub b A 1,4 kb 2 sub a A 2,6 kb Figure I-4 : Localisation (A) des sondes riboprobes utilisées pour la mise en évidence des RNA subgénomiques (B). (* le produit dexpression du gène V na jamais pu être détecté in vivo). 26
  • 30. Chapitre 1______________________________________________________________________les feuilles inoculées en présence des mutants du TGB ne présentent pas de lésions.Lanalyse par hybridation moléculaire des RNA extraits de ces feuilles ne permet pas demettre en évidence de RNA viral (Voir publication 1, figure 2, pistes 3, 4 et 5). On peutdonc conclure que les protéines du TGB sont toutes les 3 essentielles au mouvement decellule à cellule de linfection virale. En absence de mouvement, il est impossible dedétecter une infection qui reste limitée aux seules cellules initialement infectées.2-Les protéines P42 et P13 du Triple Gene Block sont exprimées à partir de RNAsubgénomiques. Pour exprimer des protéines codées par des cistrons internes dun RNAgénomique, les virus de plantes ont élaboré de nombreuses stratégies comme : (1) lemécanisme de "terminaison-réinitiation" où les ribosomes, après avoir traduit une ORFglissent sur le messager jusquà ce quils rencontrent un nouvel AUG initiateur (Kozak,1989) ; (2) le "leaky scanning" où les ribosomes initient la traduction au niveau dupremier AUG, mais également au niveau dun autre AUG plus en aval si le premierAUG nest pas dans un contexte favorable (Kozak, 1989) ; (3) le mécanisme "dentréeinterne" quand les ribosomes reconnaissent une séquence au sein dun RNA génomique(Pelletier & Sonnenberg, 1988) ; (4) la translecture obtenue par suppression dun codonstop (Ziegler et al, 1985) ; (5) le changement de cadre de lecture ou frame shift (Brault& Miller, 1992), enfin (6) lutilisation de RNA subgénomiques où le gène à exprimer setrouve localisé à lextrémité 5 du RNA messager. Pour mettre en évidence la présence de RNA subgénomiques correspondant auxcistrons 3 proximaux du RNA 2, nous avons inoculé des feuilles de C. quinoa ou uneautre plante hôte Tetragonia expansa avec du BNYVV isolat Stras 12 contenant lesRNA 1 et 2. Lorsque les lésions apparaissent, les RNA totaux sont extraits puis analyséspar hybridation moléculaire en utilisant des sondes ribonucléiques correspondant à desséquences internes du RNA 2 (figure I-4). Lutilisation dune sonde ∆AS correspondant àlextrémité 3 terminale du RNA 2 (nt 3949 à 4481) nous a permis de mettre en évidence4 bandes ayant une taille de 0,7 kb pour le RNA 2sub c, 1,4 kb pour le RNA 2sub b, 27
  • 31. Résultats______________________________________________________________________2,6 kb pour le RNA 2sub a et enfin 4,6 kb pour le RNA 2 complet (voir publication 1,figure 5, piste 4). Lorsque lon utilise dautres sondes, seule lune ou lautre de ces bandesapparait après autoradiographie. Ainsi la sonde 218Bg (nt 2078 à 2715) ne révèle que leRNA 2sub a et le RNA 2. Enfin la sonde ∆BB (nt 638 à 2081) ne shybride quau RNAgénomique. La taille de ces différents RNA subgénomiques correspond aux taillesattendues pour des RNA permettant lexpression de la protéine P42 (RNA 2sub a), de laprotéine P13 (RNA 2sub b) et de la protéine P14 (RNA 2sub c). Pour la protéine P15, aucun RNA subgénomique na pu être mis en évidence. Pourexpliquer cela, 2 hypothèses peuvent être émises : soit la synthèse du RNAsubgénomique est très faible, soit la protéine P15 est exprimée sous forme duneprotéine de fusion P13-P15. Ceci impliquerait alors un changement de cadre de lecturede lORF IV. Dans ce cas, la synthèse de la protéine P13-P15 se ferait à un taux trèsfaible, ce qui expliquerait pourquoi elle na pas encore pu être détectée in vivo enutilisant un sérum anti P13.III-Conclusions et perspectives. Nous avons montré dans ce chapitre que les protéines exprimées à partir du TGBétaient toutes les 3 essentielles au mouvement du virus de cellule à cellule. En leurabsence, linfection dune plante ne peut avoir lieu. Nous avons également montré quelexpression de 2 des 3 protéines au moins se faisait à partir de RNA subgénomiques.Ces résultats vont dans le sens dobservations faites pour dautres virus comme leWClMV, un potexvirus (Beck et al, 1991) et pour le BSMV, un hordeivirus (Petty et al,1990). Des études ont été entreprises au laboratoire, afin de mieux comprendre le rôle deces 3 protéines dans le mouvement de cellule à cellule. Les résultats préliminairesindiquent que la protéine P42 est dotée dune activité ATP binding à limage de laprotéine de 58 K codée par le RNA ß du BSMV (Jackson et al, 1991). Enfin, commedans le cas de la protéine de coque dAMV (Baer et al, 1994), il semblerait que 28
  • 32. Chapitre 1______________________________________________________________________lextrémité N-terminale de la protéine P42 soit indispensable à lactivité de fixation desacides nucléiques (C. Bleykasten, communication personnelle). Des études dinteractionentre les 3 protéines du TGB ont également été initiées en utilisant la technique "doublehybride" (Hope & Struhl, 1986 ; Keegan et al, 1986 ; Ma & Pasthne, 1987). En effet, lesprotéines P13 et P42 ont été retrouvées au niveau de fractions membranaires (Niesbach-Klösgen et al, 1990). Or, seule la protéine P13 est dotée de régions hydrophobespouvant faciliter lancrage au niveau des membranes. Pour expliquer la colocalisationmembranaire de la protéine P42, on peut donc imaginer des interactions entre cetteprotéine et la protéine P13. 29
  • 33. Résultats______________________________________________________________________ 30
  • 34. Publication n°1EFFICIENT CELL TO CELL MOVEMENT OF BEET NECROTIC YELLOW VEIN VIRUS REQUIRES 3 PROXIMAL GENES LOCATED ON RNA 2 D. Gilmer, S. Bouzoubaa, A. Hehn, H. Guilley, K. Richards and G. Jonard. Virology (189, 40-47) (1992)
  • 35. Résultats______________________________________________________________________ 32
  • 36. Publication n°1______________________________________________________________________ 33
  • 37. Résultats______________________________________________________________________ 34
  • 38. Publication n°1______________________________________________________________________ 35
  • 39. Résultats______________________________________________________________________ 36
  • 40. Publication n°1______________________________________________________________________ 37
  • 41. Résultats______________________________________________________________________ 38
  • 42. Publication n°1______________________________________________________________________ 39
  • 43. Résultats______________________________________________________________________ 40
  • 44. CHAPITRE 2 : ETUDE DE LA PROTEINE P14 CODEE PAR LORF 3 PROXIMALE DU RNA 2 DU BNYVV.I-Mise en évidence du rôle de la protéine P14 dans le cycle de multiplication duBNYVV.1-Des mutations introduites dans le gène VI du RNA 2 engendrent une diminution dutaux de réplication des RNA viraux. (publication n°1) Dans le chapitre précédent, nous avons montré que les trois protéines codées parle TGB sont nécessaires au mouvement à courte distance du virus. Dans ce deuxièmechapitre, nous allons nous intéresser plus particulièrement au rôle de lORF 3 proximaledu RNA 2 (encore appelée ORF VI) dans le cycle de multiplication du BNYVV. CetteORF code pour une protéine de 14 kDa qui a été localisée par immunochimie au niveaude la fraction cytosolique (Niesbach-Klösgen et al, 1990) et qui est exprimée à partirdun RNA subgénomique, le RNA 2sub c. Pour essayer de mieux comprendre lafonction de cette protéine dans le cycle de multiplication viral, nous avons utilisé lamême approche
  • 45. Résultats______________________________________________________________________ TGB P75 RNA 2 CP P13 P14 A P42 15 kDa nt 4043 mutant 3722 ATG GAG ATC TGG TAG nt 4043 nt 4078 mutant 4003 GGT TGA TGC nt 4043 nt 4148 mutant 3992 TGG TAA TTG Figure II-1 : Caractéristiques des mutants du RNA 2 nexprimant pas la protéine P14. Les nucléotides introduits dans le génome viral sont écrits en rouge. Les codons stop qui apparaissent sont soulignés. 42
  • 46. Chapitre 2_____________________________________________________________________que précédemment dans létude du TGB, à savoir lintroduction de mutations dans lORFVI et lanalyse des conséquences au niveau biologique. a-Construction de mutants nexprimant pas la protéine P14. Lintroduction de mutations dans la région 3 proximale du RNA 2 pouvaittoucher des séquences impliquées en cis dans la réplication du RNA 2. Cest pourquoi,pour minimiser ce risque, nous avons multiplié les constructions et réparti les mutationstout au long de la séquence de lORF VI. Deux approches différentes ont été utilisées : lapremière a consisté à insérer un linker Bgl II de 10 nucléotides au niveau du site Sma Isitué en position 4331, entraînant ainsi un changement du cadre de lecture (+1) (voirpublication 1, figure 1) et donnant le mutant RNA 2-L. La seconde approche repose surlintroduction de mutations ponctuelles (figure II-1) dans un fragment correspondant aux824 derniers nucléotides du RNA 2 cloné dans le vecteur Bluescribe. Trois mutants ontainsi été obtenus : (1) le mutant RNA 2-3722 (voir publication 1, figure 1) où 2nucléotides ont été insérés en position 4050 ce qui a pour conséquence déliminer le2ème ATG initiateur et dintroduire un changement du cadre de lecture qui entraînelapparition dun codon stop. (2) Le mutant RNA 2-3992 où la substitution dunnucléotide génère un codon stop en position 4148. (3) Le mutant RNA 2-4003 oùlintroduction dun T en position 4078 fait apparaître un codon de terminaison TAA. Toutes ces mutations entraînent soit labsence de synthèse de protéine P14(mutant 3722), soit conduisent à la synthèse dune protéine P14 plus ou moins tronquée(mutants 3994 et 4003). Le fragment de 824 nt a finalement été réinséré dans le clonecDNA complet du RNA 2. b-Effet in planta des mutations introduites dans le gène VI. Pour analyser les effets des mutations introduites dans le gène VI, les différentsmutants ont été transcrits puis coinoculés avec des transcrits du RNA 1 à des feuilles deC. quinoa. Huit à dix jours après linfection, on voit apparaître des lésions ayant un 43
  • 47. Résultats______________________________________________________________________phénotype différent de celui des lésions provoquées par lisolat sauvage : ces lésionssont 44
  • 48. Chapitre 2_____________________________________________________________________A Stras 123 Mutant 2-3722B RN RN RN A A A RN 2- 2- 2- A2 37 39 40 22 92 03 RNA 1 RNA 2 1 2 3 4Figure II-2 : Effets des mutations introduites dans le gène VI. (A) Symptômes observés sur des feuilles de C. quinoa inoculées avec lisolat sauvage et le mutant RNA 2-3722 (B) Analyses par hybridation moléculaire des RNA totaux extraits des feuilles de C. quinoa : sur la piste 1 ont été déposés 1/20 des RNA totaux extraits des feuilles inoculées avec lisolat sauvage Stras 123. Les pistes 2, 3 et 4 correspondent respectivement à la totalité des RNA extraits de feuilles inoculées par les mutants RNA 2-3722, RNA 2-3992 et RNA 2-4003. 45
  • 49. Résultats______________________________________________________________________petites et nécrotiques en leur centre (figure II-2-A). Afin danalyser la quantité de RNAviral présent dans les feuilles inoculées, nous avons prélevé ces lésions ainsi que leslésions provoquées par les RNA viraux sauvages, en prenant garde de récupérer lamême surface foliaire dans les 2 cas. Les RNA sont extraits en présence de tamponpolysome, comme cela a été décrit dans le chapitre matériel et méthodes. La lecture dela DO260nm permet destimer la quantité de RNA total présent dans lextrait et 300 ngsont déposés sur gel dagarose en conditions dénaturantes. Après transfert sur membranede nitrocellulose, les RNA sont analysés par hybridation moléculaire en utilisant dessondes ribonucléiques spécifiques complémentaires du RNA 1 (pB12 : nt 4740 à 6560)et du RNA 2 (pB21 : nt 2335 à 3793). Quel que soit le mutant analysé, on peut constaterune forte diminution de la quantité de RNA 2 mutant par rapport au RNA 2 sauvage. Laréplication du RNA 1 est également affectée mais dans des proportions plus faibles(publication 1, figure 2, pistes 6, 7, 9 et 10, et voir figure II-2, pistes 2, 3 et 4). Ces résultats suggèrent donc que la protéine P14 nest pas essentielle à linfectionvirale mais la favorise, soit en améliorant lefficacité du mouvement de cellule à cellule,soit en stimulant la multiplication du virus. Pour discriminer entre ces 2 possibilités,nous avons inoculé ces mêmes mutants à des protoplastes de C. quinoa. c-Mise en évidence du rôle de la protéine P14 dans la réplication du BNYVV et la quantité de protéine de capside synthétisée. Les transcrits des différents mutants nexprimant pas la protéine P14 ainsi que lestranscrits du RNA 1 (nécessaire à la réplication) ont été coinoculés à des protoplastes deC. quinoa. Après 48 heures de culture, nous avons extrait et analysé les RNA totaux parhybridation moléculaire. Les résultats que nous avons obtenus révèlent une chuteimportante de la quantité de RNA 2 et une diminution beaucoup plus faible voire parfoisnulle du signal correspondant au RNA 1 (voir publication 1, figure 4, pistes 5 et 6). Cesrésultats qui sont tout à fait comparables à ceux obtenus sur plantes sont regroupés dansle tableau II-1 : le pourcentage dinhibition de la réplication du RNA 2 en absence desynthèse de protéine P14 peut atteindre 85 à 98 % ; par contre ce pourcentage nest plus 46
  • 50. Chapitre 2_____________________________________________________________________ Accumulation par rapport au témoin sauvage Expérience n° Mutant RNA 1 RNA 2 2-4003 120 % 13 % 1 2-3992 150 % 14 % 2-3722 42 % 2% 2-4003 58 % 2% 2 2-3992 38 % 7% 3 2-4003 64 % 5% 4 2-4003 37 % 2%Tableau II-1: Effets des mutations introduites dans le gène VI sur la réplication des RNA 1 et RNA 2 de BNYVV. Synthèse de Réplication protéine de du RNA 2 coque RNA 1 + RNA 2 ++++ ++++ RNA 1 + RNA 2-4003 + + RNA 1 + RNA 2-4003 + RNA 2-F + ++++ RNA 1 + RNA 2-4003 + rep 14 + +++ Tableau II-2 : Bilan des expériences de complémentation démontrant que la protéine P14 a une action en cis sur la réplication du RNA 2 et en trans sur la synthèse de protéine de capside. 47
  • 51. Résultats______________________________________________________________________ Figure II-3 : Cinétique de réplication des RNA viraux et de synthèse des protéines P14, CP et P42 dans des protoplastes de C. quinoa infectés par lisolat Stras 12 de BNYVV. Les prélèvements ont été effectués au bout de 9, 16, 24 et 48 heures dinfection et les analyses réalisées par hybridation moléculaire et par immunoempreinte pour détecter les RNA viraux (A) et les protéines P14 (B), CP (C) et P42 (D) 48
  • 52. Chapitre 2_____________________________________________________________________que de 63 % dans le pire des cas pour le RNA 1. Dautres expériences ont égalementmontré que la réplication du RNA 3 est peu ou pas affectée par labsence de protéineP14. Lautre effet significatif des mutations introduites dans lORF VI est unediminution importante de la quantité de protéine de capside synthétisée (tableau II-2 etpublication 2, figure 4-B, pistes 3 et 4) alors que la synthèse de protéine P25 codée parle RNA 3 nest pas affectée (publication 2, figure 4-A, pistes 3 et 4). Enfin, pourexpliquer la petite taille des lésions et leur phénotype nécrogène, on peut émettrelhypothèse suivante. En absence de protéine P14, les taux de réplication des RNAviraux et de synthèse de protéine de coque sont considérablement abaissés ce qui peut serépercuter de manière directe ou indirecte sur la synthèse des protéines de mouvementdu virus, ralentissant ainsi sensiblement le processus infectieux. Cet effet pourrait alorspermettre à la plante de mettre en place un système de défense qui sapparenterait, dansce cas là, à une réaction dhypersensibilité sévère caractérisée par lapparition de lésionsnécrotiques.2-La protéine P14 joue un rôle en cis dans la réplication du RNA 2 et active en transla synthèse de la protéine de coque. (publication n°2) Avant de décrire les expériences de complémentation qui nous ont permis demieux comprendre le mécanisme daction de la protéine P14 dans la réplication et dansla traduction du RNA 2, il était intéressant détudier la cinétique dapparition de cetteprotéine ainsi que son rôle dans la synthèse de RNA de polarité négative. a-Cinétique dapparition de la protéine P14 lors de linfection de protoplastes de C. quinoa. Les cinétiques réalisées avec lisolat Stras 12 montrent que la protéine P14 peutêtre détectée en western blot à partir de 16 heures (figure II-3-B, piste 3). Des étudeseffectuées en parallèle sur la synthèse de protéine capsidaire et de la protéine P42révèlent que toutes ces protéines apparaissent en même temps (figure II-3-C et D, piste 49
  • 53. Résultats______________________________________________________________________3). Cependant au bout de 48 heures de culture, la synthèse de protéine P42 atteint unmaximum alors que les protéines P14 et CP continuent à saccumuler ; nous avons pumontrer dans dautres expériences que laccumulation de protéine de coque et deprotéine P14 continuait jusquau temps 72 heures. Au delà de ce temps, le taux demortalité des protoplastes devient trop important pour que les résultats obtenus puissentêtre pris en considération. Ces observations suggèrent que la synthèse de protéine P42est donc régulée différemment des 2 autres protéines étudiées. Des observationsanalogues ont été faites par Davies et collaborateurs (1993) en ce qui concerne laprotéine P25 synthétisée à partir de la première ORF du TGB du potato virus X (ouPVX). b-Labsence de protéine P14 a un effet inhibiteur sur la synthèse de RNA (-). Après avoir mis en évidence un effet négatif sur la synthèse des brins (+), nousavons cherché à savoir si labsence de protéine P14 affectait également la synthèse desbrins (-). Pour cela, les RNA totaux ont été extraits de protoplastes infectés après 36heures de culture dans les conditions décrites dans le chapitre matériel et méthodes. Laseule modification introduite dans le protocole expérimental consiste à précipiterlensemble des acides nucléiques en présence déthanol et dacétate dammonium 2 M.Nous avons ainsi pu montrer quen labsence de protéine P14, leffet observé pour lesRNA brin (+) se retrouve au niveau de la synthèse des RNA brins (-) (publication 2,figure 5-A et B) en provoquant une réduction importante de lintensité des signaux plusparticulièrement au niveau des brins (-) correspondant au RNA 2. c-La protéine P14 agit en cis sur la réplication du RNA 2. Dans les expériences décrites ci-dessous, nous avons entrepris de complémenterleffet des mutations introduites dans lORF VI par lapport de protéine P14 sauvage. Cesexpériences de complémentation ont été réalisées de 2 façons différentes : 50
  • 54. Chapitre 2_____________________________________________________________________ - Dans une première série dexpériences, nous avons utilisé le mutant RNA 2-F(figure II-4) caractérisé par une délétion de 935 nt au niveau de lORF II. Ce mutant estcapable de se répliquer dans les protoplastes (voir publication 1, figure 4, piste 1 ; 1143 2077 RNA 2-F An RNA 2 sub c An 382 1688 tRep 14 An Protéine P14Figure II-4 : Caractéristiques des transcrits RNA 2 F et tRep 14 exprimant la protéine P14 dans les expériences de complémentation. : Séquences 5 et 3 non codantes du RNA 3. : ORF VI dirigeant la synthèse de la protéine P14. : Protéine P14.. 51
  • 55. Résultats______________________________________________________________________ 52
  • 56. Chapitre 2_____________________________________________________________________ 380 linker BamHI 1470 Bam HI Bam HI + P14 promoteur T7 pB6 (²ES) PCR ORF VI (+ sites Bam HI) Rep 14 P14 tRep 14 P14 AnFigure II-5 : Représentation schématique de la construction du clone Rep 14. Après amplification par PCR, lORF VI du RNA 2 de BNYVV est introduit dans le clone cDNA du RNA 3 délété de toute linformation codante (pB6 (²ES). 53
  • 57. Résultats______________________________________________________________________publication 2, figure 1, piste 2) et permet la synthèse dune protéine P14 native. Lesexpériences de complémentation ont consisté à coinoculer le mutant RNA 2-F avec leRNA 1 et le RNA 2-4003 nexprimant pas la protéine P14. Ces expériences qui ont étérépétées un grand nombre de fois nont jamais permis de déceler une stimulation de laréplication du RNA 2-4003 (publication 2, figure 1, piste 4) suggérant ainsi que laprotéine P14 ne peut être efficace lorsquelle est apportée en trans. Cependant on peutimaginer une autre explication : la synthèse de protéine P14 à partir du RNA 2-F seferait à un taux trop faible pour être efficace dans une action en trans. - Cest pourquoi, dans une deuxième série dexpériences, nous avons utilisé untranscrit exprimant la protéine P14 en grande quantité, le transcrit rep 14 (figure II-4)correspondant obtenu de la manière suivante (voir figure II-5) : le gène VI a dabord étéamplifié par PCR en utilisant des amorces contenant les sites de restriction Bam HI.Après digestion Bam HI, le produit PCR a été introduit dans le clone pB6 (∆ES) entreles séquences 5 (1 à 380) et 3 (1470 à 1773) non traduites du RNA 3 du BNYVV. Dansce clone construit par Isabelle Jupin (Jupin et al, 1990), la séquence virale est placéesous le contrôle du promoteur T7 . Le produit de transcription rep 14 est capable de serépliquer dans les protoplastes lorsquil est inoculé en présence de transcrits du RNA 1.De plus ce transcrit est capable dexprimer efficacement la protéine P14 (publication 2,figure 3-B, piste 4 et 5). Le transcrit rep 14 a donc été coinoculé avec les RNA 1 et 2-4003 et, là encore, les résultats de ces expériences de complémentation ne révèlentaucune stimulation de la réplication du RNA 2-4003 (publication 2, figure 1, piste 6).On peut donc en conclure que la protéine P14 joue très certainement un rôle en cis sur laréplication du RNA 2 (voir tableau II-2). d-La protéine P14 stimule en trans la synthèse de la protéine de capside. Parallèlement à ces analyses par hybridation moléculaire, nous avons recherchépar immunoempreinte la présence de protéine de coque. Nous avons ainsi pu mettre enévidence une seconde fonction liée à la protéine P14 : indépendamment de leffet en cissur la réplication, la protéine P14 peut stimuler fortement en trans, la synthèse de la 54
  • 58. Chapitre 2_____________________________________________________________________protéine de coque. En effet, le signal correspondant à la protéine de coque est beaucoupplus intense en présence de protéine P14 apportée en trans par le transcrit rep 14(publication 2, figure 3-A, piste 5) quen son absence (publication 2, figure 3-A, piste 3)bien que le taux de réplication du RNA 2-4003 ne soit pas stimulé (publication 2,figure 2, piste 3 et 6 et tableau II-2). Pour expliquer ce résultat, nous avons émis lhypothèse que la protéine P14 a uneaffinité pour une séquence spécifique du RNA 2 et favorise ainsi la traduction de laprotéine capsidaire. Cest pourquoi nous avons entrepris des expériences dexpressiontransitoire en bombardant des feuilles de C. quinoa et de Nicotiana tabacum avec 2types de vecteurs : lun permet la synthèse de protéine P14 et lautre renferme laséquence cible potentielle reconnue par la protéine P14, en loccurrence la région 5terminale de lun ou lautre RNA du BNYVV. Cette séquence cible est placée en amontdun gène rapporteur permettant de visualiser la stimulation si celle-ci a lieu. Lescaractéristiques de ces vecteurs sont les suivantes : - Les vecteurs permettant lexpression de la protéine P14 native ou tronquée ontété obtenus par insertion de la séquence nucléotidique correspondante dans le plasmidepMJD 82 (Dowson Day et al, 1994). Pour cela, nous avons amplifié, par PCR, le cistronde la protéine P14 sauvage ou mutée en utilisant une amorce 5 renfermant le site Nco Iet un oligonucléotide correspondant à lextrémité 3 du RNA 2. Ce produit PCR aensuite été digéré par les enzymes Nco I et Stu I (site naturel localisé en position 4479du RNA 2) puis inséré dans le vecteur pMJD 82 linéarisé par Nco I et Sma I. Nousavons ainsi obtenu les vecteurs pMJD-P14 exprimant la protéine P14 sauvage et pMJD-P14∆1 exprimant une protéine P14 délétée de 30 acides aminés. Ce mutant de délétiona été obtenu par une digestion à lexonucléase III générant une délétion de 98 nt (nt4286-4284) suivie dune insertion dun linker de 8 nucléotides permettant de récupérer laphase de lecture. Lorsque ce mutant du gène VI est introduit dans le RNA 2 et que letranscrit correspondant est inoculé à des protoplastes, on obtient des résultats analoguesaux résultats obtenus avec les mutants ponctuels RNA 2-3722, -3992 et -4003. Le clone 55
  • 59. Résultats______________________________________________________________________pMJD-P14∆1 nous a servi de témoin négatif dans les expériences dexpressiontransitoire décrites ci-dessous. - Les vecteurs renfermant les séquences cibles ont été obtenus par insertion deproduits PCR correspondant aux extrémités 5 non codantes des RNA 2, 3 et 4 duBNYVV (respectivement les 142, 442 et 377 premiers nucléotides) dans le vecteurpRT2-syn-LUC : les amplifications PCR ont été effectuées en utilisant desoligonucléotides renfermant un site Xho I pour lamorce 5 et un site Nco I pour lamorce3. Après digestion par ces 2 enzymes, les fragments ont été introduits dans le vecteurrapporteur pRT2-syn-LUC coupé par Xho I et Nco I. Les plasmides recombinants ainsiobtenus ont été appelés pRT-BN2-LUC, pRT-BN3-LUC et pRT-BN4-LUC. Lesdifférents plasmides recombinants ont ensuite été cobombardés (un vecteur de typepMJD avec un vecteur de type pRT) sur des feuilles de C. quinoa et de N. Tabacum(voir matériel et méthodes). Vingt quatre heures après linoculation, la stimulation delactivité luciférase a été analysée. Les résultats (publication 2, tableau 2) démontrentque la protéine P14 est en mesure de stimuler lactivité luciférase dans les 2 types defeuilles bombardées ; ce facteur de stimulation peut varier de 2,4 à 4,5 . Cependant,cette stimulation nest pas spécifique dune séquence présente dans la région 5 leader duRNA 2 car elle a lieu quelle que soit la séquence cible utilisée ; même le vecteurrapporteur renfermant uniquement la cassette de clonage montre une stimulation delactivité luciférase en présence de la protéine P14. Cependant, le facteur de stimulationest plus faible que celui observé lors de la synthèse de protéine CP dans les expériencesde complémentation dans les protoplastes où la protéine P14 est apportée en trans. Il estclair que ces expériences devront donc être reprises avec des séquences du RNA 2 duBNYVV allongées au delà de la séquence 5 leader si lon veut observer une stimulationbeaucoup plus significative.3-Mode daction de la protéine P14. Pour expliquer les résultats décrits ci dessus, nous avons proposé le modèlesuivant (voir figure II-6) : dans les premiers instants de linfection, les RNA décapsidés 56
  • 60. Chapitre 2_____________________________________________________________________ CP P75 5 3 Brin plus Brin moins 3 5 Rôle au niveau de la RNA 2 sub c 5 3 réplication Rôle au niveau (en cis) de la traduction P14 (en trans) CP P75 5 3 Brin plus Figure II-6 : Modèle permettant dexpliquer le rôle de la protéine P14 dans le cycle de multiplication du BNYVV. 57
  • 61. Résultats______________________________________________________________________ Synthèse de RNA brin + et de RNA subgénomiques 3 5 - Complexe de réplication 5 3 - + La protéine P14 naissante se fixe au complexe de réplication et reconnait une séquence sur le brin + néosynthétisé. Puis elle stimule la synthèse de RNA brin -. 3 - + + - Figure II-7 : Modèle proposé pour expliquer le rôle en cis de la protéine P14 dans la réplication du RNA 2. 58
  • 62. Chapitre 2_____________________________________________________________________de polarité positive provenant de linoculum, sont traduits permettant, entre autre, lasynthèse de RNA polymérase RNA dépendante. Cette enzyme va permettre la formationdun complexe de réplication induisant, à un taux que nous allons qualifier de basal, lasynthèse de RNA de polarité négative. Ces RNA (-) servent ensuite de matrice pour laformation des RNA complémentaires génomiques et subgénomiques. Puis la protéineP14 néosynthétisée à partir du RNA 2sub c pourra stimuler en cis la synthèse denouveau brin moins à partir desquels se fera une synthèse massive de RNA génomiques.Cet effet en cis est assez peu courant et mérite que lon sy attarde un peu plus : commeon peut le voir sur la figure II-7, le RNA de polarité négative sert de matrice à lasynthèse de RNA génomique, mais également à la synthèse de RNA subgénomique.Celui ci pourra être pris en charge, durant sa synthèse par les ribosomes pour initier laproduction de protéine P14. Dans ces conditions, on aura un couplageréplication/traduction. La protéine P14 ainsi synthétisée pourra ensuite reconnaître uneséquence spécifique dans la région 3 terminale du RNA brin plus génomique et stimulerainsi la synthèse de nouveaux brins de RNA de polarité négative. On peut imaginer que,durant sa synthèse, un site cryptique de la protéine P14 reconnaît une séquencespécifique du RNA 2. Le masquage de ce site sur la protéine mature pourrait expliquerpourquoi la protéine P14 apportée en trans reste sans effet sur la réplication du RNA 2. Après avoir stimulé en cis la synthèse de RNA brin moins, la protéine P14 quicommence à saccumuler dans la cellule pourra alors induire en trans la synthèse de laprotéine de coque. Pour mieux comprendre lintérêt dun tel système, il faut se rappeler que laplupart des virus de plante expriment leur protéine de coque à partir dun RNAsubgénomique (TMV, AMV, etc...) ou alors par lintermédiaire dune polyprotéinematurée (CPMV, GFLV, etc ...). Ces 2 systèmes permettent une régulation relativementfacile de la production de la CP. Par contre dans le cas du BNYVV, du BSMV, unhordeivirus ou du TRV, un tobravirus, le cistron codant pour la protéine de coque estlocalisé en 5 dun RNA génomique et sera donc traduit en premier. Si tel est le cas, laprésence de protéine CP dès le début du cycle de réplication devrait favoriser la 59
  • 63. Résultats______________________________________________________________________réencapsidation des 60
  • 64. Chapitre 2_____________________________________________________________________ A 10 20 30 40 50 60 70 80 90 100 110 120 Hydrophilicité (KD) Probabilité de surface B ATGGGGATGGTAGATAGTTTGTGCGTGTTTGTTGGTCGAGTCATAACTGAGGGATCTGAA M G M V D S L C V F V G R V I T E G S E AGTGTTGAGGGTGTGGAAAGGTTTTCCATTAAGTTTAGTGAGTGGAAATTGTTCACCATC S V E G V E R F S I K F S E W K L F T I GCGGTGTTTGTTGAATATCGTGAGTTAGGTGAGAAAGAGTGCAGTTTGAAGGATGCTGGT A V F V E Y R E L G E K E C S L K D A G AGATTACACTTTAATGTGTCATGTGTGAAATGCTGTCAAAAACTTAAATGCAAGAAACAA R L H F N V S C V K C C Q K L K C K K Q AATAAAAATCATAGTAAACACGTCCAAAATGGATATTTACGCAAGGTACGTAATTTTTCC N K N H S K H V Q N G Y L R K V R N F S ATTTTAGGTGTTTGCGGTGATTGTTGTGAGTCTTTTACACTCGCGGACGAAAAACCTCAT I L G V C G D C C E S F T L A D E K P H GTTATTGTCGATCCTGAGGTGTAA V I V D P E V * Figure II-8 : Caractéristiques de la protéine P14 codée par lORF VI du RNA 2. A : Profil dhydrophilicité selon Kyte & Doolittle (1982) et probabilité de surface des acides aminés : ces profils ont été obtenus en utilisant le logiciel de prédiction de structure "plotstructure" de UWGCG. B : Séquence nucléotidique de lORF VI du RNA 2 et structure primaire de la protéine P14 correspondante. 61
  • 65. Résultats______________________________________________________________________ A B K80 K79 C72 C106 Zn C69 C109 E118 K119Figure II-9 : (A) Comparaison de séquence entre lORF 6 du RNA 2 du BNYVV et un certain nombre de papillomavirus (Koonin et al, 1991). HPV 1a, human papilloma virus type 1a ; BPV2, bovine papillomavirus type 2 ; DPV, deer papilloma virus ; CRPV, cottontail rabbit papilloma virus. + correspond à des acides aminés hydrophobes et * désigne des acides aminés du BNYVV faisant partie de la séquence consensus. (B) Structure en doigt de zinc hypothétique de la protéine P14 du BNYVV. Les acides aminés représentés correspondent aux mutants alanines décrits dans le chapitre II, paragraphe III. 62
  • 66. Chapitre 2_____________________________________________________________________RNA génomiques provenant de linoculum et empêcher ainsi la multiplication du virus.Or, à la lumière des résultats obtenus, le rôle bifonctionnel de la protéine P14permettrait une régulation temporelle du processus dinfection virale : au début delinfection virale, la protéine P14 serait intégralement utilisée pour stimuler laréplication des RNA viraux ; dans un deuxième temps son accumulation stimulerait lasynthèse de protéine capsidaire et donc lencapsidation des RNA viraux néosynthétisés.II-Mise en évidence de limportance des résidus cystéines 69, 72, 106 et 109 danslactivité de la protéine P14. La protéine P14 est un polypeptide de 126 acides aminés très riche en cystéines(8 %) et en lysines (10 %) et dont la séquence est présentée figure II-8-B. Bien que codée par une ORF localisée à lextrémité 3 du RNA 2, la protéine P14présente très peu dhomologies avec dautres protéines riches en cystéines égalementexprimées à partir dORF localisées en 3 de RNA génomiques dautres phytoviruscomme le BSMV ou encore le TRV. Par contre, des comparaisons de séquences(Koonin et al, 1991) (figure II-9) montrent une homologie non négligeable entre cetteprotéine P14 et la protéine E6 des papillomavirus, une protéine impliquée dans latransactivation de la transcription du génome viral grâce à la présence dune structure endoigt de zinc (Lamberti et al, 1990). Avant dinitier une étude fine des acides aminés essentiels à lactivité biologiquede la protéine P14, nous avons effectué des prédictions de structure à laide dunprogramme informatique "plotstructure" de UWGCG et les résultats sont décrits figureII-8-A. Lexamen du profil de probabilité des acides aminés dêtre en surface de laprotéine P14 (figure II-8-A) révèle lexistence de 2 domaines : ces 2 domaines sontsitués au voisinage des acides aminés 80 et 120, le premier domaine très hydrophile estencadré de résidus cystéines conservés chez les papillomavirus. Ces observations ainsique les résultats déjà obtenus par U. Niesbach-Klösgen (1990) et montrant que laprotéine P14 63
  • 67. Résultats______________________________________________________________________ A B C Figure II-10 : Symptômes induits par le mutant RNA 2 (E118-K119) (A), le mutant RNA 2 (K79-80) (B) et les mutants RNA 2 (C106-109) ou RNA 2 (C69-72) (C) inoculés à des feuilles de C. quinoa. 64
  • 68. Chapitre 2_____________________________________________________________________était capable de fixer le zinc, permettent de proposer, pour cette région très hydrophilecomprise entre les acides aminés 69 et 109, lexistence dune structure en doigt de zincqui est représentée figure II-9-B.1-Construction de mutants alanine (Giesman-Cookmeyer & Lommel, 1993). Pour vérifier limportance de certains résidus aminés, nous avons entrepris deconstruire des mutants ponctuels dans lesquels ces acides aminés sont remplacés par desalanines. Ces mutations concernent plus précisément des acides aminés supposés ensurface tels que les lysines 79, 80 et 119 et lacide glutamique 118 (figure II-8) ou alorsdes cystéines (69, 72, 106 et 109) potentiellement impliquées dans une structure endoigt de zinc. Nous avons ainsi obtenus les mutants pB2(C69-72), pB2(C106-109),pB2(K79-80) et pB2(E118-K119).2-Propriétés biologiques des mutants alanine. Afin de tester leffet de ces modifications sur la réplication du virus in planta,nous avons transcrit les différents clones obtenus et nous les avons coinoculés à desplantes en présence de transcrits correspondant aux RNA 1 et RNA 3. Après une dizainede jours dinfection, nous avons observé 3 types de lésions (figure II-10). (1) Des lésions de type sauvage, chlorotiques et de grande taille pouvant diffuserle long des nervures avec le mutant pB2(E118-K119). Ces lésions sont tout à faitsemblables à celles observées avec un isolat sauvage. (2) Des lésions chlorotiques de taille beaucoup plus petite avec le mutantpB2(K79-80). (3) Des lésions nécrotiques avec les mutants pB2(C69-72) et pB2(C106-109) ;ces lésions sont analogues aux lésions obtenues avec les mutants nexprimant pas laprotéine P14 (figure II-2). Lanalyse des RNA extraits des lésions révèle une diminution de tous les RNAviraux dans les lésions de type nécrotique (figure II-11-A, piste 4 et 5) et une diminution 65
  • 69. Résultats______________________________________________________________________ RNA 2 (E118-K119)2 (C106-109) RNA RNA RNA 2 (K79-80) 2 (C69-72) RNA 2 A RNA 1 RNA 2 RNA 3 B CP C P14 1 2 3 4 5 Figure II-11 : Analyse par hybridation moléculaire des RNA extraits des lésions locales provoquées par les mutants alanine (A). les quantités de protéine de capside (B) et de protéine P14 (C) présentes dans ces mêmes lésions ont été mises en évidence par immunoempreinte. 66
  • 70. Chapitre 2_____________________________________________________________________ RNA 2 AAAA Promoteur T7 Terminateur T7 P14 Nco I pET 3d T7 RNA Polymérase pro Lac UV 5 E. coli BL21(DE3)plysS IPTGFigure II-12 : Schéma du système pET adapté à la protéine P14. En présence dIPTG, la synthèse de T7 RNA polymérase va permettre lexpression de la protéine P14 à partir du plasmide recombinant pET-P14. 67
  • 71. Résultats______________________________________________________________________moins spectaculaire de tous les RNA pour les lésions obtenus avec le mutant pB2 (K79-80) (figure II-11-A, piste 3). Pour les RNA correspondant au mutant pB2 (E118-K119)(figure II-11-A, piste 2), il ny a pas de différence par rapport aux RNA isolés à partir deplantes inoculées avec lisolat sauvage (figure II-11-A, piste 1). Les mutations E118-K119 introduites en aval de la structure en doigt de zinc potentielle nont donc pasdeffet. Parallèlement, lanalyse par western blot montre une diminution très nette de laquantité de protéine de coque pour les mutants pB2(C69-72) et pB2(C106-109) (figureII-11-B, pistes 4 et 5) et une diminution moins importante pour le mutant pB2(K79-80)(figure II-11-B, piste 3). Il en va de même pour la protéine P14 qui passe sous le seuil dedétection dans le cas des mutants où les cystéines ont été remplacées par des alanines(figure II-11-C, pistes 4 et 5). Pour tous les mutants étudiés, et plus particulièrementpour le mutant qui se comporte comme le RNA 2 sauvage, nous avons séquencé ladescendance et montré quil ny avait pas réversion au niveau des mutations "alanines"introduites. Ces résultats préliminaires indiquent donc que les cystéines 69, 72, 106 et 109jouent un rôle important par lintermédiaire dune structure qui pourrait être une structureen doigt de zinc telle quelle est représentée sur la figure II-9. Les mêmes expériencesvont maintenant être réalisées dans les protoplastes.III-Mise en évidence dinteractions protéine P14-acides nucléiques.1-Clonage du gène VI dans le vecteur pET. Pour mettre en évidence une possible activité fixatrice dacides nucléiques par laprotéine P14, nous avons entrepris de lexprimer et de la purifier à partir dun systèmedexpression procaryotique. Nous avons opté pour le système pET décrit par Studier etcollaborateurs (1990) (figure II-12). Ce système implique lutilisation dun vecteurdexpression bactérien, le pET (plasmid for expression by T7 RNA polymerase) et dunesouche bactérienne particulière, la bactérie BL21 (DE3) pLys S. Le plasmide pETdispose dun promoteur reconnu par la RNA polymérase du bactériophage T7. Le gèneVI a été 68
  • 72. Chapitre 2_____________________________________________________________________ ma pH pH ma rqu pH pH 6 5 rquA eur 8 7 eur 2 3 4 5 6 7 8 9 2 3 94 67 43 30 20,1 P14 14,4 ext rait tot al de pH pH ma ma bac 6 5 rqu pH pH rquB téri eur 8 es 7 2 eur 3 4 5 6 7 8 9 2 3 106,5 80,0 49,5 32,5 27,5 18,5 P14C 1 2 3 106,5 80,0 49,5 32,5 27,5 P14 18,5 Figure II-13 : Purification de la protéine P14 par chromatographie daffinité sur colonne ZCAA. Les différentes fractions éluées à pH 8, 7, 6 et 5 ont été analysées par électrophorèse en gel de polyacrylamide 15% et les protéines ont été visualisées soit par coloration au bleu de coomassie (A), soit par immunoempreinte en utilisant un sérum anti P14 (B). C- Analyse comparative par immunoempreinte de la protéine P14 obtenue soit par expression dans un système procaryotique (piste 1), soit à partir de feuilles infectées par le BNYVV (piste 2). Piste 3 : marqueurs de PM. 69
  • 73. Résultats______________________________________________________________________amplifié par la technique PCR en utilisant des oligonucléotides contenant un site Nco Ipour lamorce 5 et un site Bam HI pour lamorce 3. Après digestion par ces 2 enzymes,le fragment a été introduit dans le vecteur pET, linéarisé en aval du promoteur T7 par lesenzymes Nco I et Bam HI. Puis le plasmide recombinant pET-P14 a été introduit parélectroporation dans des bactéries BL 21 (DE3) pLys S qui renferment dans leur génomele gène permettant la synthèse de T7 RNA polymérase sous le contrôle du promoteur lacUV 5 inductible par lIPTG (voir figure II-12). Les bactéries BL21 (DE3) pLys Stransformées par pET-P14 sont ensuite mises en culture dans 200 ml de milieu LBadditionné dampicilline (50 µg/ml) et de chloramphénicol (34 µg/ml). Quand la cultureatteint une DO550nm comprise entre 0,6 et 1, lexpression de protéine P14 est induite parladdition dIPTG (0,2 g/l). Après 2 heures dinduction, les protéines sont extraites etreprises dans du tampon SB (50 mM NaH2PO4, 300 mM NaCl) à pH 8.2-Purification partielle de la protéine P14 par chromatographie daffinité sur unecolonne "Zinc Chelate Affinity Adsorbent" (ZCAA). Après lyse des bactéries induites, les protéines totales sont reprises dans 2 ml detampon SB pH 8 et déposées sur une colonne ZCAA dont le principe est décrit dans lechapitre matériel et méthodes. Lélution est réalisée à température ambiante avec 13,5ml de tampon SB pH 8, puis 13,5 ml de tampon SB pH 7, puis 13,5 ml de tampon SBpH 6 et enfin 13,5 ml de tampon SB pH 5. Les fractions récoltées, et plusparticulièrement les fractions obtenues par élution à pH 6, ont été analysées sur gel depolyacrylamide soit par coloration au bleu de coomassie (figure II-13-A) soit parimmunoempreinte grâce à un sérum anti-P14 (figure II-13-B). Comme on peut leconstater sur les figures II-13-A et II-13-B, la protéine P14 est éluée à pH 6 mais ellenest pas purifiée à homogénéité ; elle reste soluble et se conserve aisément à -20 °C.Enfin, nous avons montré que cette protéine exprimée dans un système procaryotecomigre avec la protéine P14 présente dans les plantes infectées (figure II-13-C). Il fautcependant noter que son poids moléculaire apparent est de lordre de 18 kDa, cest à diresupérieur à son poids moléculaire 70
  • 74. Chapitre 2_____________________________________________________________________ r eu i u on in in n q o o oi ar ém 1 M T P4 m 4 é 1 T P m 4 T P1 é m 4 T P1 é 106,5 80,0 49,5 32,5 27,5 18,5 P14 1 2 3 4 Figure II-14 : Mise en évidence de la capacité de la protéine P14 à se lier de manière non spécifique aux acides nucléiques. Les extraits bactériens ont été préparés à partir de bactéries transformées avec le plasmide pET 3d (Témoin) et le plasmide recombinant pET-P14 (P14). Immunoempreinte effectuée avec un sérum dirigé contre la protéine P14 (1). Incubation en présence de sonde ribonucléique pB21 (2), dun oligonucléotide radiomarqué par phosphorylation au γ32P (3) et dun DNA plasmidique phosphorylé au γ32P (4). 71
  • 75. Résultats______________________________________________________________________théorique. Cette technique de purification originale, basée sur la présence potentielledune structure en doigt de zinc, nous a donc permis dobtenir une protéine solublesuffisamment pure pour étudier les interactions protéines-acides nucléiques en utilisantla technique décrite par Gramstat et al (1990).3-Mise en évidence dinteractions protéine P14-acides nucléiques par la technique de"Northwestern" (Gramstat et al, 1990). Ces expériences ont été réalisées de la façon suivante : des échantillons deprotéine P14 sont déposés sur gel de polyacrylamide, soumis à une électrophorèse,transférés sur membrane de nitrocellulose et renaturés en présence durée. Finalement,les membranes sont incubées en présence de différents types dacides nucléiquesradiomarqués : du DNA simple brin correspondant à un oligonucléotide de 39 ntphosphorylé au 32P (figure II-14, 3), du DNA plasmidique double brin linéarisé puisphosphorylé au 32P (figure II-14, 2) et une sonde ribonucléique pB21 (figure II-14, 1).Dans les trois cas, la protéine P14 fixe, de façon non spécifique, les acides nucléiquesradiomarqués. Cette fixation nest pas liée à la présence de protéines doriginebactérienne car, dans les mêmes conditions de purification, un témoin préparé à partir debactéries BL 21 (DE3) pLys S transformées par le vecteur pET 3d sans linsertcorrespondant au gène de la protéine P14 ne montre aucune fixation. Ces résultatspréliminaires demandent à être confirmés dans dautres conditions et notamment enmilieu liquide, ce qui va nécessiter lutilisation de protéine P14 purifiée à homogénéité.Pour cela, on peut envisager daméliorer la purification de la protéine P14 en utilisantdautres techniques de chromatographies, et notamment des colonnes dexclusionmoléculaire.IV-Conclusion . 72
  • 76. Chapitre 2_____________________________________________________________________ La protéine P14 exprimée à partir de lORF 3 terminale du RNA 2 de BNYVVest une protéine riche en cystéines et en lysines qui est capable de se lier de façonaspécifique à du DNA simple brin, double brin ou du RNA simple brin. Elle partage uncertain nombre dhomologies de séquences avec les protéines E6 de papillomavirus(Koonin et al, 1991 ; Lamberti et al, 1990) et, daprès nos expériences préliminaires,présente une structure potentielle en doigt de zinc qui semble être essentielle au bonfonctionnement de la protéine P14. Nous avons montré que cette protéine a un rôledouble car elle intervient à la fois dans la réplication du RNA 2 et dans sa traduction. En ce qui concerne son activité en cis dans la réplication, il faut rappeler quunetelle activité en cis a été mise en évidence pour la protéine de 58 kDa située à lextrémitéN-terminale de la polyprotéine codée par le M-RNA du CPMV. Dans ce cas,lintroduction de mutations au sein de la protéine, empêche la réplication du M-RNA,sans pour autant inhiber celle du B-RNA qui porte toute linformation nécessaire à laréplication. Là aussi, les expériences de complémentation se sont révélées négatives(Van Bokhoven et al, 1993 ; Wellink et al, 1994). Cette stimulation en cis de laréplication est un phénomène assez rare pour les virus de plantes. En effet pour dautresvirus, la réplication est assurée avec laide dun facteur cellulaire qui agit en trans avec lecomplexe de réplication viral. Ainsi, pour le BMV, il a été montré quun sérum dirigécontre la protéine 1a permettait de coprécipiter un complexe composé des protéines 1a,2a et de 5 protéines cellulaires ayant un poids moléculaire de 43 à 67 kDa (Quadt &Jaspars, 1990). Toujours pour le BMV, un modèle a été établi par Pogue et Hall (1992)qui stipule quun facteur cellulaire reconnaît une structure secondaire en 5 du brin (+) dela forme réplicative RNA double brin. Il permet, en sy fixant, de libérer lextrémité 3 duRNA brin moins, et ainsi de faciliter laccès au complexe de réplication. La synthèse deRNA (+) est donc facilitée. Enfin, signalons que lintervention de facteurs cellulairesnest pas propre aux virus de plantes. En effet, dans le cas du poliovirus, une protéinecellulaire de 36 kDa est essentielle à la formation du complexe de réplication (Andino etal, 1993 ; Harris et al, 1994). Ce facteur cellulaire p36 et la protéine 3CD interagissentavec la structure en forme de trèfle composée des 90 nucléotides 5 terminaux du 73
  • 77. Résultats______________________________________________________________________poliovirus et le complexe ainsi formé permet linitiation de la synthèse de nouveauxRNA génomiques de polarité positive. La seconde fonction de la protéine P14 se situe au niveau de la stimulation de latraduction de la protéine de coque. Un tel phénomène a également été mis en évidencechez le BSMV où une protéine riche en cystéine est codée par un gène localisé en 3 duRNA γb . Dans ce cas là, des mutations abolissant lexpression de la protéine γbentraînent une diminution considérable de la quantité de protéine de coque (Petty et al,1990) mais une action en cis comme pour le BNYVV, na pas été démontré. Des étudesplus récentes ont montré que cette protéine renfermait deux domaines riches encystéines dont lun est impliqué dans la synthèse de la protéine de coque et de lapremière protéine du TGB (Donald & Jackson, 1994). Les résultats que nous venons de décrire soulèvent un certain nombre dequestions. Ces questions concernent tout dabord les cystéines qui jouent un rôleimportant dans la réplication. Interviennent-elles également dans la régulation de lasynthèse de la protéine de capside ? Jouent-elles un rôle dans la propriété de la protéineP14 à fixer les acides nucléiques ? Autrement dit, la protéine P14 possède-t-elle un ouplusieurs domaines fonctionnels ? Autre question importante : existe-t-il des interactions spécifiques entre laréplicase virale codée par le RNA 1 et la protéine P14 ? Si de telles interactions peuventêtre mises en évidence, il sera bien sûr intéressant de définir quels sont les domainespeptidiques qui interagissent entre eux pour initier la réplication du RNA 2. 74
  • 78. Chapitre 2_____________________________________________________________________ 75
  • 79. Publication n°2THE SMALL CYSTEIN-RICH PROTEIN P14 OF BEET NECROTIC YELLOWVEIN VIRUS REGULATES ACCUMULATION OF RNA 2 IN CIS AND COAT PROTEIN IN TRANS.A. Hehn, S. Bouzoubaa, N. Bate, D. Twell, J. Marbach, K. Richards, H. Guilley and G. Jonard. Virology (210, 73-81) (1995)
  • 80. Publication n°2______________________________________________________________________ AbstractThe effect of null mutations of the small cysteine-rich protein P14 encoded by RNA 2 ofbeet necrotic yellow vein virus has been investigated using in vitro transcripts of viralRNA to infect Chenopodium quinoa protoplasts. The P14 mutations down-regulatedRNA 2 accumulation by approximately 10-50 fold. Accumulation of minus-strandRNA 2 was also diminished but RNA 1 accumulation was much less affected. Theinhibition of RNA 2 accumulation could not be complemented in trans by providingP14 from another source (either a second molecule of RNA 2 or an RNA 3 basedreplicon) containing and expressing the P14 gene. The P14 null mutations dramaticallyinhibited accumulation of viral coat protein, which is encoded by the 5-proximal geneon RNA 2, but this effect could be complemented in trans, indicating that it occurs by amechanism distinct from that affecting RNA 2 accumulation. Transient expressionexperiments were also carried out in which a plasmid expressing P14 and plasmidsexpressing a reporter gene placed downstream of potential translational controlsequences (the 5-noncoding sequences of RNAs 2, 3 or 4) were introduced into C.quinoa or Nicotiana tabacum leaves by microprojectile bombardment. Co-expression ofP14 produced a 3-4 fold stimulation of reporter gene expression levels for all theconstructs. The lack of sequence specificity suggests that this phenomenon is notdirectly related to the RNA 2 specific stimulation of coat protein accumulation observedin a viral infection. 77
  • 81. Résultats______________________________________________________________________ INTRODUCTION The genome of beet necrotic yellow vein virus consists of four plus-sense RNAs, ofwhich the two largest (RNA 1 and RNA 2) are required for host-nonspecifichousekeeping functions such as replication and encapsidation of the viral RNA andvirus movement while the two smaller RNA species control proliferation of theinfection within sugar beet roots and production of rhizomania symptoms (RNA 3) andtransmission of the virus by its fungal vector, Polymyxa betae (RNA 4) (for reviews, seeJupin et al., 1991, and Richards and Tamada, 1992). Some Japanese isolates alsocontain a third accessory RNA (RNA 5) whose function has not yet been determined(Tamada et al., 1989). The single long open reading frame (ORF) on RNA 1 possessesthe alphavirus superfamily core polymerase and RNA helicase motifs (Bouzoubaa etal., 1987), marking it as the RNA-dependent RNA replicase; RNA 1 is the onlyBNYVV RNA that can replicate autonomously in protoplasts and is required for thereplication of the other viral RNAs (Bouzoubaa and Scheidecker, 1990). RNA 2 has sixlong ORFs (Figure 1). The 5-proximal AUG is the site of translation initiation for twoproteins, the 21 kilodalton (kDa) major coat protein (P21) and the translationalreadthrough protein P75 (Ziegler et al., 1985; Bouzoubaa et al., 1986), which is a minorcomponent of the viral capsid (Tamada and Kusume, 1991; Schmitt et al., 1992;Haeberlé et al., 1994). The three following partially overlapping ORFs, encoding theproteins P42, P13 and P15, form a cassette of cell-to-cell movement proteins known asthe Triple Gene Block (TGB; Figure 1). Counterparts of the TGB are present in someother furoviruses (Herzog et al., 1994; Scott et al., 1994) and in potex-, carla- andhordeiviruses (Morozov et al., 1989). Mutations in full-length BNYVV RNA 2transcripts knocking out any one of the three TGB genes completely abolished locallesion formation on C. quinoa leaves (when coinoculated with a transcript of the wild-type BNYVV RNA 1) but had relatively little effect on C. quinoa protoplast infection(Gilmer et al., 1992). 78
  • 82. Publication n°2______________________________________________________________________ The 3-proximal ORF of RNA 2 encodes a cysteine-rich 14 kDa protein (P14) whichis expressed from a subgenomic RNA (Gilmer et al., 1992) and is readily detected byserological techniques in the cytoplasmic fraction of infected cells (Niesbach-Klösgen etal., 1990). Unlike mutations in the TGB, null mutations of P14 did not abolish locallesion formation on C. quinoa leaves, although lesion size was diminished and theaccumulation of progeny viral RNA was greatly reduced (Gilmer et al., 1992). Theeffect of the P14 mutations on lesion size suggested that P14 intervenes in cell-to-cellmovement of the virus, perhaps by regulating the expression of the TGB proteins.Preliminary experiments with C. quinoa protoplasts revealed that mutation of P14 alsodiminished accumulation of RNA 1 and 2, particularly the latter, in single cells (Gilmeret al., 1992). In this paper we have further investigated the role of P14 in the viralreplication cycle in C. quinoa protoplasts. Our results are consistent with a model inwhich P14 acts in cis to stimulate the accumulation of RNA 2, but also actsindependently and in trans as an enhancer of viral coat protein synthesis. MATERIALS AND METHODScDNA constructs The vectors for production of in vitro run-off transcripts of wild-type BNYVVRNA 1 (pB15), RNA 2 (pB218 and pBF14), RNA 3 (pB35) and the plasmid containingthe P75 deletion (pB218-F) have been described elsewhere (Ziegler-Graff et al., 1988;Quillet et al., 1989; Gilmer et al., 1992). For site-directed mutagenesis of the P14 gene,an EcoRI fragment extending from residue 3789 to the 3-end of the insert was excisedfrom pBF14 and subcloned into pBluescript (-). Oligonucleotide-directed mutagenesiswas carried out on single-stranded phagemid DNA (Zoller and Smith, 1982; Kunkel etal., 1987) and the EcoRI fragment bearing the mutation was substituted back into pBF14to produce pBF14-4003 and pBF14-3992 (Figure 1). The P14-expressing RNA 3construct (pB3rep14) was obtained by inserting a polymerase chain reaction (PCR)product containing the P14 ORF (with BamHI sites built into the PCR primers) into theBamHI site of the RNA 3 deletion mutant pB6(∆E-S) (Jupin et al., 1990). 79
  • 83. Résultats______________________________________________________________________In vitro transcription Bacteriophage T7 RNA polymerase run-off transcripts of pB15 and pB3rep14 wereobtained from HindIII-linearized template DNA (Ziegler-Graff et al., 1988; Quillet etal., 1989). After the transcription reaction, template DNA was eliminated by treatmentwith DNase followed by extraction with phenol-chloroform (1:1) (Veidt et al., 1992).The transcripts were ethanol precipitated in the presence of 2 M ammonium acetate, andthe pellet, after centrifugation, was disolved in sterile water. The yield and integrity ofthe transcripts were monitored by agarose gel electrophoresis. Templates for run-off transcription of full-length wild-type or mutant RNA 2 werethe appropriate ligation products of the large BamHI-BstXI fragment of pB218 (orpB218-F) and the small BstXI-SalI fragment of pBF14, pBF14-4003 or pBF14-3992(Quillet et al., 1989). The full-length cDNA (plus an upsteam bacteriophage T7 RNApolymerase consensus promoter) in an aliquot corresponding to 200 nl of the ligationmix was then amplified by PCR. The PCR primers were 5-CGAATTCTAATACGACTCACTATAGGAAATTCTAACTAT (the sequence in italicscorresponds to the bacteriophage T7 promoter and the underlined sequence to the 5-terminus of RNA 2) and 5-GCCAAGCT20CAATATACTGAAAAC (the underlinedsequence is complementary to the 3-terminus of RNA 2 upstream of the 3-poly(A) tail).PCR was carried out with 5 units Thermus thermophilus DNA Polymerase (Eurogentec)as described by the supplier except that the reaction mix was supplemented with 6%dimethylsulfoxide and 100 µg/ml bovine serum albumin. One µg of each primer wasadded and the reaction was carried through 25 cycles at 94° for 30 sec, 50° for 30 secand 72° for 6 min with the last (elongation) step incremented 5 sec per cycle. The PCR-amplified DNA was extracted with phenol-chloroform, precipitated with ethanol, takenup in water at a concentration of 1 µg/µl and transcribed as detailed above for plasmidtemplates. The full-length RNA 2 transcripts containing mutations will be referred to ast2-4003, etc (Fig. 1). 80
  • 84. Publication n°2______________________________________________________________________Protoplast inoculation and extraction Protoplasts were prepared from C. quinoa leaves and inoculated by electroporationas described (Veidt et al., 1992). The inoculum contained 10 µg RNA 1 transcript and 5µg of the appropriate RNA 2 transcript per 200,000 protoplasts. In some experiments, 2µg of pB3rep14 transcript or wild-type RNA 3 transcript was also included in theinoculum. RNA was extracted from 133,000 protoplasts 48 hr post-inoculation asdescribed (Veidt et al., 1992). Viral plus-strand RNAs were detected by Northernhybridization using 32P-labelled riboprobes complementary to RNAs 1, 2 and 3(Lemaire et al., 1988) followed by autoradiography. Radioactivity in the bands wasquantified in some experiments using a Fujix MAS1000 Bio-Analyzer. For analysis ofviral minus-strands, RNA was extracted from the protoplasts as described (Veidt et al.,1992) except that the RNA was ethanol-precipitated in the presence of 2M ammoniumacetate and the LiCl precipitation step was omitted. Riboprobes for detection of RNA 1and 2 minus-strands were obtained by transcribing HindIII-linearized pB12 and EcoRI-linearized pB21 (Lemaire et al., 1988) with bacteriophage T7 and bacteriophage T3RNA polymerase, respectively. For detection of viral proteins, protoplasts were collected by centrifugation and thepellet was resuspended in 20 µl of two-times concentrated gel loading buffer, the samplewas heated to 95° for 5 min and analyzed by polyacrylamide gel electrophoresis(Laemmli, 1970). After electrotransfer to nitrocellulose, the viral coat protein, P14 andthe RNA 3 translation product P25 were detected using specific antisera as described(Niesbach-Klösgen et al., 1988).Transient expression The P14 ORF was amplified by PCR with primers containing a built-in NcoI site forthe primer flanking the 5-end of the ORF and a StuI site for the primer flanking the 3-end. The PCR product was cut with NcoI and StuI and inserted between the NcoI and 81
  • 85. Résultats______________________________________________________________________SmaI sites of pMJD82 (Dowson Day et al., 1994), a plasmid containing a partiallyduplicated 35S promoter, the tobacco mosaic virus omega translational enhancer, apolylinker (SYN) and the nopaline synthase terminator, to produce pMJD-P14. Theconstruct pMJD-P14∆1, which contains a 98 residue deletion (plus an 8 residue linkerinsertion) in the P14 ORF, was produced similarly except that the template for PCR wasa plasmid containing a P14 deletion mutant generated by exonuclease III digestionfollowed by linker insertion (Gilmer et al., 1992). The 5-noncoding regions of BNYVVRNA 2 (residues 1-142), RNA 3 (residues 1-442) and RNA 4 (residues 1-377) wereamplified by PCR using primers flanking the noncoding regions and containing a built-in XhoI site in the primer flanking the 5-end of the noncoding region and a built-in NcoIsite in the 3-flanking primer. The PCR products were cleaved with XhoI and NcoI andinserted between the XhoI and NcoI sites of pRT-SYN-LUC (Turner et al., 1994) toproduce pRT-BN2-LUC, pRT-BN3-LUC and pRT-BN4-LUC (see below). The lower surfaces of C. quinoa leaves (3-4 cm length, from 4 week-old plants) or3-4 cm long half leaves of Nicotiana tabacum were used as targets. Bombardment ofthe leaves with tungsten microprojectiles coated with DNA and measurements ofluciferase activity were essentially as described (Twell et al., 1989). RESULTSPoint mutations in P14 inhibit accumulation of RNA 2 and coat protein We have shown previously that infection of C. quinoa with wild-type RNA 1 plusRNA 2 carrying a mutation, either a ten base insertion (mutant 2-L) or a +2 frameshiftmutation (mutant 2-3722), in the P14 ORF produced smaller local lesions containingdiminished amounts of progeny viral RNA (Gilmer et al., 1992). The mutations alsodown-regulated production of RNA 2 and (to a lesser extent) RNA 1 in protoplasts. Itmay be argued that the reduction in RNA 2 accumulation in the aforesaid mutants is aconsequence of alteration of cis-acting replication signals on the viral RNA sequence.This explanation appears unlikely, however, because the +2 frameshift is at thebeginning of the ORF and the ten-base insertion is 335 residues downstream. Additional 82
  • 86. Publication n°2______________________________________________________________________evidence that the decreased accumulation of RNA 2 is not due to cis affects on RNA 2synthesis has come from a study of two additional P14 null mutants, t2-4003 and t2-3992, in which the P14 ORF has been prematurely terminated by mutation of a singlebase to produce an in-frame stop codon, either 13 amino acids (2-4003) or 35 aminoacids (2-3992) downstream of the P14 N-terminus (Fig. 1). Both mutants displayed thesame phenotype on C. quinoa as mutants 2-L and 2-3722 (data not shown). In twelveexperiments in which t2-4003 or t2-3992 was coinoculated with wild-type RNA 1transcripts to C. quinoa protoplasts, a pronounced reduction in the accumulation ofprogeny RNA 2, generally ranging from ten-fold to one hundred-fold compared to thelevel obtained with wild-type RNA 2, was consistently observed (Table 1 and additionalobservations; also see Figure 2 lane 3). In most experiments, the accumulation of RNA1 was also diminished by the mutations, but the effect (three-fold or less; Table 1) wasmuch less pronounced than that observed for RNA 2. Since the different P14 nullmutants behaved similarly in whole plant and protoplast infections, only one of them, 2-4003, was used for further experiments. Western blot analysis of protein extracted from virus-infected protoplasts revealedthat inhibition of RNA 2 accumulation provoked by 2-4003 was accompanied by areduction in the amount of the major viral capsid protein P21. The reduction rangedfrom about one tenth the wild-type level in some experiments (e.g., Fig. 3A, lane 3) tobelow the limits of detection in others (e.g., Fig. 4B, lane 4). Accumulation of the minorreadthrough capsid protein P75, which is normally synthesized at about one tenth thelevel of P21, underwent a comparable reduction. Diminished accumulation of P21 andP75 is consistent with the observed lower levels of RNA 2 in the P14 mutant, but it isdifficult to separate cause from effect in these circumstances. Thus, it could be arguedthat the primary action of the P14 mutations is to down-regulate synthesis of the viralcapsid proteins and that the concomitant decrease in progeny RNA levels is not due todefective RNA synthesis, but is instead an indirect effect in which the progeny RNAthat is not packaged by the smaller pool of capsid protein is unstable in the cytosol.Instability of nonpackaged viral RNAs in protoplasts has been reported for cowpea 83
  • 87. Résultats______________________________________________________________________mosaic virus (De Varennes and Maule, 1985; Van Bokhoven et al., 1993). We do notrule out the possibility that RNA instability contributes in a secondary manner to thediminished accumulation of progeny RNA levels in the P14 null mutants, but theevidence presented below indicates that the principal cause, at least in the case of RNA2, is down-regulation of viral RNA synthesis.Coat protein synthesis but not replication of a P14-defective RNA 2 mutant can becomplemented in trans To determine if the defect in RNA 2 synthesis of mutant 2-4003 can becomplemented in trans, t2-4003 was coinoculated to protoplasts along with wild-typeRNA 1 transcripts and transcripts of the previously described RNA 2 mutant 2-F(Gilmer et al., 1992), in which the sequence encoding the C-terminal half of P75 hasbeen deleted (Fig. 1). This mutant was used as a source of wild-type P14 in the three-component infections because its 934 residue deletion makes it easily distinguishable inNorthern hybridization experiments from 2-4003. Mutant 2-F replicated efficientlywhen coinoculated with RNA 1 transcripts to protoplasts both in the absence (Fig. 2,lane 2) and the presence (Fig. 2, lane 4) of mutant 2-4003. Western blot analysis usingP14-specific antiserum revealed that addition of mutant 2-F to the inoculum resulted inthe appearance of amounts of P14 comparable to those produced from the wild-typeRNA 2 transcript (data not shown). This extraneous source of P14 did not, however,significantly stimulate accumulation of progeny 2-4003 when both 2F and 2-4003 wereincluded in the inoculum (Fig. 2, lane 4). In a second attempt to complement mutant 2-4003 replication, we constructed aBNYVV RNA 3-based replicon, B3rep14, in which the P14 ORF was substituted forthe central 1307 residues of RNA 3. It has been shown previously that an RNA 3construct with the ß-glucuronidase (GUS) gene substituted in this region is efficientlyreplicated when inoculated to C. quinoa leaves with RNA 1 and 2 and expresses GUSactivity (Jupin et al., 1990). B3rep14 transcript was likewise replicated efficiently inprotoplasts when inoculated with RNA 1 and the 2-4003 transcript (Fig. 2, lane 5). 84
  • 88. Publication n°2______________________________________________________________________Western blot analysis revealed that the B3rep14 directed synthesis of P14 in the infectedprotoplasts in amounts higher than wild-type RNA 2 in a parallel experiment. (Fig 3B,lanes 2 and 4). The production of abundant amounts of P14 by B3rep14 was not,however, accompanied by increased accumulation of progeny 2-4003 RNA (Fig. 2,lane 6), confirming that the defect in RNA 2 accumulation caused by mutation of P14cannot be complemented in trans. While an external source of P14 in three-component infections reproducibly failedto elevate 2-4003 accumulation, P14 from tB3rep14, on the other hand, had apronounced and reproducible stimulatory effect on translation of 2-4003. Western blotanalysis using P21-specific antiserum revealed that inclusion of tB3rep14 in theinoculum resulted in the accumulation of P21 (Fig. 3A, lane 5) in amounts similar tothose obtained with the wild-type RNA 2 transcript. Stimulation of P75 accumulation isnot readily detectable in Fig. 3A, lane 5, but was observed in other experiments, (datanot shown). In additional experiments, three-component infections were carried out withRNA 1 transcript, t-4003 and 2-4 times less tB3rep14 than in the experiment shown inFigure 3. This resulted in significantly lower levels of P14, but the same strongstimulatory effect on P21 accumulation was observed (data not shown). We assume that the increased levels of P21 and P75 provoked by addition oftB3rep14 are due to stimulation of RNA 2 translation rather than to decreased rates ofdegradation of P21 and P75. Although the latter possibility cannot formally be ruled out,it appears unlikely because capsid proteins such as P21 and P75 are expected to beintrinsically stable. However, regardless of the mechanism by which capsid proteinlevels are regulated by P14, the failure of wild-type levels of P21 and P75 producedduring the three-component infection with RNA 1, t2-4003 and tB3rep14 to enhanceaccumulation of progeny 2-4003, represents strong evidence that the principal effect ofP14 on RNA 2 accumulation is at the level of RNA 2 synthesis rather than through anindirect encapsidation-mediated effect on stability. At present, we reserve judgement asto whether a similar conclusion applies to the much less dramatic effect of the P14mutations on RNA 1 levels. 85
  • 89. Résultats______________________________________________________________________ It was of interest to determine if the stimulatory effect of P14 on protein synthesiswas limited to the proteins encoded by full-length RNA 2 or also applied to viralproteins translated from subgenomic RNAs. The available antisera do not permitdetection of RNA 1-encoded products or the RNA 2 TGB proteins (encoded bysubgenomic RNAs (Gilmer et al., 1992)) in infected protoplasts. Therefore, noconclusion can be drawn concerning the effect of P14 on production of these proteins.Preliminary experiments revealed, however, that the RNA 3 translation product P25 canbe detected weakly by Western blot analysis of protein from infected protoplasts whenRNA 3 is included in the inoculum. Consequently, an experiment was carried out inwhich wild-type RNA 3 transcript was included in the inoculum along with RNA 1transcript and either wild-type RNA 2 transcript or t2-4003. Substitution of t2-4003 forwild-type RNA 2 transcript did not significantly reduce levels of RNA 3 (not shown) orP25 (Fig. 4A, lanes 3 and 4). Thus the inhibitory effect of P14 mutations on RNA 2replication and translation does not extend to RNA 3. To summarize, the foregoingexperiments show that P14 is required for both efficient replication and translation ofRNA 2. Furthermore, the two phenomena are distinct in that the effect of P14 onreplication is tightly coupled and cannot be complemented in a P14-defective RNA 2mutant by P14 supplied in trans whereas the effect of P14 on RNA 2 translation can becomplemented in trans.Mutation of P14 attenuates RNA 2 minus-strand synthesis In some experiments, the effect of mutation of P14 on levels of plus-strand RNAs(Fig. 5B) were accompanied by measurements of minus-strand viral RNA levels(Fig. 5A). Figure 5A, lane 4 shows that protoplasts inoculated with RNA 1 and the 2-4003 transcript accumulated significantly lower amounts of RNA 2 minus-strand thanthe control (Fig. 5A, lane 3). RNA 1 minus-strand synthesis, on the other hand, wasmuch less inhibited. This experiment shows that, in the absence of P14, minus-strandRNA 2 synthesis occured, but only at a low, basal level. Apparently, P14 produced inthe course of the infection cycle with wild-type RNA 2 stimulates synthesis of the 86
  • 90. Publication n°2______________________________________________________________________minus-strand RNA. The alternate possibility, that P14 enhances minus-strandaccumulation by diminishing its rate of degradation, seems unlikely in view of the cisnature of the relationship between P14 and RNA 2 in replication. We do not yet know ifP14 also stimulates synthesis of plus-strand RNA 2 directly or whether the up-regulationof plus-strand levels is an indirect consequence of enhanced accumulation of minus-strand. The effect of P14 on accumulation of the various RNA2-related subgenomicRNAs produced from the minus-strand RNA 2 template, including the subgenomicRNA encoding P14 itself, also remains to be investigated.P14 can stimulate expression of a reporter gene in a transient expression system The foregoing experiments have shown that, independent of its effects on RNA 2replication, P14 enhances translation of the 5-proximal genes of RNA 2. To determineif P14 can alter translational activity outside of the context of a viral infection, the P14ORF was inserted between the 35S promoter and nopaline synthase transcriptionterminator of pMJD82 to produce pMJD-P14 (Fig. 6). As a null control, a similarconstruct was prepared containing the P14 ORF from which 98 residues had beendeleted (pMJD-P14∆1). A series of reporter plasmids (Fig. 6) was also constructed inwhich different potential translation control sequences (the 5-noncoding regions ofBNYVV RNA 2, 3 or 4) were placed between a 35S promoter and the luciferase (LUC)gene. A previously described (Turner et al., 1994) reporter plasmid (pRT2-SYN-LUC)containing the 35S promoter plus a synthetic polylinker upstream of the LUC gene (Fig.6) was also tested. Equimolar amounts of the P14 expression plasmid and a reporterplasmid were introduced into leaf tissue of C. quinoa or N. tabacum by microprojectilebombardment (Twell et al., 1989) and LUC activity was measured 24 hr later.Bombardment of either plant with the P14 expression vector pMJD-P14 and any of theaforesaid reporter plasmids produced a 2.4-4.5 fold stimulation of reporter gene activity(Table 2) compared to values obtained for bombardment with the same reporter plasmidplus the empty expression vector, pMJD82. Substitution of the wild-type P14 gene inthe expression vector by the P14 deletion mutant construct pMJD-P14∆1 did not elicit 87
  • 91. Résultats______________________________________________________________________elevated LUC activity (Table 2), indicating that the stimulatory effect is related to thepresence of full-length P14. It is not yet known if P14 enhances reporter gene expression at the level oftranscription or acts post-transcriptionally. It is evident, however, that there areimportant differences in the behavior of P14 in the transient expression system and in aviral infection. In particular, the stimulation of reporter gene expression provoked byP14 is sequence nonspecific and is significantly lower than P14 stimulation of capsidprotein synthesis during viral infection, which we estimate to be at least ten-fold andprobably more. These differences may indicate that the RNA 2 5-noncoding sequenceincluded in pRT2-BN2-LUC does not contain the putative signal recognized by P14 tospecifically enhance RNA 2 translation in viral infections and that the observedsequence-nonspecific stimulation shown in Table 2 is a secondary effect. Alternatively,other features of a viral infection (e.g, the presence of additional viral-coded proteins orcompartmentalization of the viral RNAs and proteins) may be required to obtain a large,RNA 2-specific enhancement. Nevertheless, the stimulation observed in the transientexpression experiments provides independent evidence that P14 can interact with andmodify the behavior of nucleic acids in vivo. 88
  • 92. Publication n°2______________________________________________________________________ DISCUSSION P14 belongs to a group of small cysteine-rich proteins that are encoded by 3-proximal genes of furo- (Shirako and Wilson, 1993; Herzog et al., 1994) hordei-, tobra-and carlaviruses (Morozov et al., 1989). Although there is no significant sequencesimilarity among these proteins, they display weak but statistically significant similarityto various other nucleic acid binding proteins: the E6 protein of the papillomaviruses, inthe case of P14 of BNYVV (Koonin et al., 1991). Of the various small cysteine-rich proteins, the 17 kDa γb protein of barley stripemosaic hordeivirus (BSMV), which is the 3-proximal gene on BSMV γ RNA, has beenmost extensively studied (Petty et al., 1990a, 1990b; Petty et al., 1994; Donald andJackson, 1994). Null mutations in the γb gene are not lethal but have effects onpathogenicity, cell-to-cell movement and viral gene expression. In particular, nullmutations in γb significantly attenuate synthesis of the two other BSMV genomecomponents, RNAs α and ß (Petty et al., 1990a) and provoke an even more dramaticattenuation of expression of the two most 5-proximal genes on RNA ß, the viral coatprotein gene, and the neighboring gene for ßb, the first protein of the TGB (Petty et al.,1990a). The regulatory action of γb on coat protein translation resembles the trans-acting stimulatory effect of P14 on BNYVV coat protein levels. Although we have nodirect evidence that P14 also regulates expression of the BNYVV TGB proteins, thedecrease in local lesion size upon infection of leaves with the P14 mutants (Gilmer etal., 1992) is consistent with such an effect. There are other features, however, where thesimilarity between the BSMV γb protein and P14 breaks down. In particular, the BSMVγb protein does not regulate accumulation levels of γ RNA itself and γb null mutationscan be complemented in trans (Petty et al., 1990a). The requirement for P14 for efficient synthesis of BNYVV RNA 2 also has aparallel in the situation with the cowpea mosaic virus (CPMV) 58K protein, encoded byCPMV M-RNA. Mutations in the 58K protein inhibited synthesis of M-RNA but not B-RNA, which encodes the core viral RNA replicase (Van Bokhoven et al., 1993; 89
  • 93. Résultats______________________________________________________________________Wellink et al., 1994). Furthermore, the 58K mutants could not be complemented bysupplying wild-type P58 in trans from wild-type M-RNA included in the inoculum. Figure 7 illustrates schematically our current model for the regulation of BNYVVRNA 2 replication and translation by P14. It should be remarked that in the very earlystages of the viral infection cycle, prior to the onset of RNA 2 minus-strand synthesis,no P14 will be produced in the infected cell because the subgenomic RNA responsiblefor P14 synthesis is not encapsidated (authors unpublished observations). Consequently,the capacity of the RNA 2 delivered in the inoculum to direct synthesis of coat proteinwill be attenuated. This may be a mechanism to ensure that the infection cycle is notaborted by premature encapsidation of the parental viral RNAs before replication canoccur. It is noteworthy that, except for the carlaviruses, the other viruses which encodesmall cysteine-rich proteins also have their coat protein genes situated at the 5-extremityof a genomic RNA and may require a similar mechanism for turning off coat proteinsynthesis early in the infection cycle. Because of the absence of P14, RNA 2 minus-strand synthesis will initially occuronly at very low levels. Once synthesized, however, the RNA 2 minus-strand can serveas template for production of the P14 subgenomic RNA which will in turn lead to P14production, further stimulation of RNA 2 minus-strand synthesis, etc. This positivefeedback cycle should lead by a simple mass-action effect to increased accumulation ofthe other RNA 2 subgenomic RNAs and RNA 2 plus-strand although we do not rule outthe possibility that P14 may intervene directly to activate their synthesis. We suggest that the P14 synthesized in the early stages of the aforesaid cycle isprimarily channeled to the viral replication machinery devoted to RNA 2 minus-strandsynthesis. The mechanism by which this channeling occurs is not known but itpresumably involves coupling between replication and translation, perhaps based onphysical proximity of the various components in a large complex. Our inability tocomplement in trans the effect of P14 mutations on RNA 2 replication would be aconsequence of this coupling. As P14 accumulates in the cell in the course of theinfection, it will also trigger coat protein synthesis from RNA 2. A time course study of 90
  • 94. Publication n°2______________________________________________________________________the accumulation of P14 and coat protein in infected protoplasts reveals that coat proteinbegins to appear slightly later than P14 (unpublished observations). Possibly, theprecociously synthesized P14 is (mostly) sequestered by replication complexes and onlyonce these sites have been saturated does free P14 become available to potentiate coatprotein synthesis. In conclusion, while the foregoing model accounts for our principal observationsconcerning the effects of P14 on RNA 2 replication and translation, it should beconsidered as a starting point which probably will require modification as additionalevidence becomes available. Characterization of the viral protein composition ofBNYVV RNA replication complexes would be a useful means of testing some of thepredictions of the model. It would also be of interest to locate the putative targetsequence on RNA 2 which is recognized by P14 during activitation of coat proteintranslation.Acknowledgements. A. H. was the recipient of a FEBS Summer Fellowship. Theplasmid pMJD82 was a gift of M. J. Dowson Day. 91
  • 95. Résultats______________________________________________________________________ TGB P75 P14 RNA 2 P21 4423 4043 wild-type 4078 t4003 GGU U GA UGC 4148 t3992 UGG U AA UUG 1143 2077 RNA 2-FFigure 1. Genome organization of BNYVV RNA 2 and structure of the RNA 2 mutants.The black rectangle in the map of wild-type P14 indicates the position of a putative Zn-finger motif (Niesbach-Klösgen et al., 1990). The sequence in the vicinity of thepremature stop codons (underlined) in the P14 mutants 2-4003 and 2-3992 is given. Thedeletion in RNA 2-F is symbolized by slanted lines. Numbering refers to nucleotideposition in full-length RNA 2. TGB = Triple Gene Block. 92
  • 96. Publication n°2______________________________________________________________________Figure 2. BNYVV-related RNAs in transcript-infected protoplasts detected by Northernhybridization. C. quinoa protoplasts were inoculated with RNA 1 (t1) plus wild-typeRNA 2 transcripts (t2) (lane 1), RNA 1 plus RNA 2-F transcripts (lane 2), RNA 1 plus2-4003 transcipts (lane 3), RNA 1 plus RNA 2-F transcripts plus 2-4003 transcripts(lane 4), RNA 1 plus wild-type RNA 2 transcripts plus B3rep14 transcripts (lane 5) andRNA 1 plus 2-4003 transcripts plus 3Brep14 transcripts (lane 6). RNA was extractedfrom 133,000 protoplasts 48 hr post-inoculation and transferred to nitrocellulosefollowing agarose gel electrophoresis under denaturing conditions. BNYVV-relatedRNA species were detected by hybridzation with RNA 1-, 2- and 3-specific 32P-labeledantisense RNA probes. 93
  • 97. Résultats______________________________________________________________________Figure 3. Accumulation of P21, P75 and P14 in transcript-infected C. quinoaprotoplasts. Protoplasts were mock-inoculated (lane 1) or inoculated with RNA 1 (t1)plus RNA 2 transcripts (t2) (lane 2), RNA 1 plus 2-4003 transcripts (lane 3), RNA 1plus RNA 2 plus B3rep14 transcripts (lane 4) and RNA 1 plus 2-4003 plus B3rep14transcripts (lane 5). Total protein was extracted from 35,000 protoplasts 48 hr post-inoculation, separated by PAGE and transferred to nitrocellulose. Capsid proteins wereimmunodetected using an anti-virus serum (Panel A). P14 was detected (Panel B) usingserum raised against a P14-fusion protein expressed in bacteria (Niesbach-Klösgen etal., 1990). Bars to the left indicate the positions of 94, 67, 43, 30, 20 and 14 kDamolecular weight markers. The more slowly migrating bands in Panel B are probablymultimers of P14. 94
  • 98. Publication n°2______________________________________________________________________Figure 4. Immunodetection of the RNA 3 product P25 in C. quinoa protoplasts. Totalprotein was extracted from 100,000 protoplasts which had been inoculated with RNAfrom isolate Stras12, containing only RNA 1 and 2 (Quillet et al., 1989) (lane 1), mock-inoculated (lane 2), or inoculated with RNA 1, RNA 2 and RNA 3 transcripts (lane 3) orwith RNA 1, 2-4003 and RNA 3 transcripts (lane 4). P25-specific antiserum (Niesbach-Klösgen et al. 1990) was used to detect P25 expression in Panel A. The position andsize (in kDa) of molecular weight markers are given to the left. Panel B showsimmunodetection of capsid proteins in a duplicate gel loaded with protein from 35,000protoplasts as described in the Figure 3 legend. 95
  • 99. Résultats______________________________________________________________________Figure 5. Effect of mutation in P14 on the accumulation of BNYVV RNA 1 and 2minus-strands. RNA was extracted from 130,000 protoplasts 36 hr followinginoculation with Stras12 viral RNA (lane 1), mock-inoculation (lane 2), inoculation withRNA 1 plus wild-type RNA 2 transcripts (lane 3) or inoculation with RNA 1 plus 2-4003 transcripts (lane 4). Duplicate Northern blots were hybridzed with probes specificfor either minus-strand (Panel A) or plus-strand (Panel B) RNAs 1 and 2. The bandsmarked with asterisks in Panel A are the size of the RNA 2 subgenomic species RNA2suba and RNA 2subb (Gilmer et al., 1992). 96
  • 100. Publication n°2______________________________________________________________________ SYN pRTS2-LUC 35 S 5 Luciferase 35 S 3 Xho I Nco I RNA 2 pRTBN2-LUC 35 S 5 Luciferase 35 S 3 1 145 pMJD 82 35 S 5 ž NOS 3 Nco I Sma I pMJD-P14 35 S 5 ž P14 NOS 3Figure 6. Structure of vectors employed in transient expression experiments (not toscale). For each construct, only the inserted genes (LUC or P14 and flanking controlelements (cauliflower mosaic virus 35S promoter and terminator and the nopalinesynthase terminator) are shown. The thick line labeled SYN represents a polylinker andthe thin line labelled RNA 2 represents the BNYVV RNA 2 5-noncoding sequence(residues 1-145). Constructs pRTBN3-LUC and pRTBN4-LUC (not shown) wereidentical to pRTBN2-LUC except that they contained the 5-noncoding region of RNA 3(residues 1-442) and RNA 4 (residues 1-377), respectively, in place of the RNA 2sequence. Constructs pMJD2 and pMJD-P14 also contain the tobacco mosaic virus 5-noncoding sequence omega (Gallie et al., 1987). 97
  • 101. Résultats______________________________________________________________________ P75 P21 P14 P21 RNA 2 (+) Translation RNA 2 (-) level (in trans) Replication 2 subc level P14 ( in cis) P14Figure 7. Model illustrating the effects of P14 on replication and translation of BNYVVRNA 2. The rectangles represent ORFs on RNA 2 and the ovals symbolize the RNA 2translation products P21 and P75. P14 is represented by shaded circles. 2subc is thesubgenomic RNA which is thought to direct P14 synthesis (Gilmer et al., 1992). OtherRNA 2-derived subgenomic RNAs are not shown. 98
  • 102. Publication n°2______________________________________________________________________ Table 1: Effect of null mutations in P14 on accumulation of RNA 1 and RNA 2. Accumulation (relative to wild type) Experiment Mutant RNA 1 RNA 2 1 2-4003 1,20 0,13 2-3992 1,50 0,14 2-3722a 0,42 0,02 2 2-4003 0,58 0,02 2-3992 0,38 0,07 3 2-4003 0,64 0,05 4 2-4003 0,37 0,02a The P14 frameshift mutant 2-3722 has been described previously (Gilmer et al., 1992) 99
  • 103. Résultats______________________________________________________________________Table 2: Luciferase transient expression in leaves of C. quinoa or N. tabacum afterbombardment with microprojectiles coated with different P14 expressing plasmids andlucerferase-expressing reporter gene constructs. Reporter Number of P14 construct Construct Plant experiments Stimulation a pMJD-P14 SYN-LUC C. quinoa 4 3.14 ± 0.84 SYN-LUC N. tabacum 2 2.4 pMJD-P14²1 SYN-LUC C. quinoa 1 1.19 pMJD-P14 BN2-LUC C. quinoa 4 2.8 ± 0.45 BN2-LUC N. tabacum 2 2.8 pMJD-P14²1 BN2-LUC C. quinoa 1 0.65 pMJD-P14 BN3-LUC C. quinoa 2 4.5 BN3-LUC N. tabacum 1 3.0 pMJD-P14 BN4-LUC C. quinoa 2 3.27 BN4-LUC N. tabacum 2 3.8 pMJD-P14²1 BN4-LUC C. quinoa 1 0.72 a Luciferase activity (measured in light units emitted in 10 sec) in tissue bombarded with a reporter plasmidplus pMJD-P14 or pMJD-P14²1 divided by the luciferase activity in the same weight of tissue bombardedwith the same reporter plasmid plus pMJD 82. Standard deviations are given for the experiments where n=4.Luceriferase activity for tissue displaying stimulation ranged between 10 5 to 106 in different experiments.Background levels for extracts from nonbombarded leaves were between 1000-3000. 100
  • 104. Publication n°2______________________________________________________________________ REFERENCESBOUZOUBAA, S. and SCHEIDECKER, D. (1990). Infection of protoplasts with beet necrotic yellow vein virus RNA. Proceedings of the First Symposium of the International Working Group on Plant Viruses with Fungal Vectors. pp16-20; ed. Koenig, R. Verlag Eugen Ulmer, Stuttgart.BOUZOUBAA, S., ZIEGLER, V., BECK, D., GUILLEY, H., RICHARDS, K., and JONARD, G. (1986). Nucleotide sequence analysis of beet necrotic yellow vein virus RNA-2. J. Gen. Virol. 67, 1689-1700.BOUZOUBAA, S., QUILLET, L., GUILLEY, H., JONARD, G. and RICHARDS, K. (1987). Nucleotide sequence of beet necrotic yellow vein virus RNA-1. J. Gen. Virol. 68, 615-626.DE VARENNES, A. and MAULE, A. J. (1985). Independent replication of cowpea mosaic virus bottom component RNA: in vivo stability of the viral RNAs. Virology 144, 495-501.DONALD, R. G. K. and JACKSON, A. O. (1994). The barley stripe mosaic virus γb gene encodes a multifunctional cysteine-rich protein that affects pathogenesis. Plant Cell 6, 1593-1606.DOWSON DAY, M. J., ASHURST, J. L., and DIXON, R. A. (1994). Plant expression cassettes for enhanced translatonal efficiency. Plant Mol. Biol. Reporter 12, 347-357.GALLIE, D. R., SLEAT, D. E., WATTS, J. W., TURNER, P. C., and WILSON, T. M. A. (1987). The 5-leader of tobacco mosaic virus RNA enhances the expression of foreign transcripts in vitro and in vivo. Nucl. Acids Res. 15, 3257-3273.GILMER, D., BOUZOUBAA, S., HEHN, A., GUILLEY, H., RICHARDS, K., and JONARD, G. (1992). Efficient cell-to-cell movement of beet necrotic yellow vein virus requires 3 proximal genes located on RNA 2. Virology 189, 40-47.HAEBERLE, A. M., STUSSI-GARAUD, C., SCHMITT, C., GARAUD, J. C., RICHARDS, K. E., GUILLEY, H., and JONARD, G. (1994). Detection by immunogold labelling of P75 readthrough protein near an extremity of beet necrotic yellow vein virus particles. Arch. Virol. 134, 195-203. 101
  • 105. Résultats______________________________________________________________________HERZOG, E., GUILLEY, H., MANOHAR, S. K., DOLLET, M., RICHARDS, K., FRITSCH, C., and JONARD, G. (1994). Complete nucleotide sequence of peanut clump virus RNA 1 and relationships with other fungus-transmitted rod-shaped viruses. J. Gen Virol. 75, 3147-3155.JUPIN, I., RICHARDS, K., JONARD, G., GUILLEY, H., and PLEIJ, C. W. A. (1990). Mapping of sequences required for productive replication of beet necrotic yellow vein virus RNA 3. Virology 178, 273-280.JUPIN, I., TAMADA, T., and RICHARDS, K. (1991). Pathogenesis of beet necrotic yellow vein virus. Seminars in Virol. 2, 121-129.KOONIN, E.V., BOYKO, V. P., and DOLJA, V. V. (1991). Small cysteine-rich proteins of different groups of plant RNA viruses are related to different families of nucleic- acid binding proteins. Virology 181, 395-398.KUNKEL, T. A., ROBERTS, J. D., and ZAKOUR, R. A. (1987). Rapid and efficient site-specific mutagenesisi without phenotypic selection. Methods Enzymol. 154, 367- 382.LAEMMLI, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685.LEMAIRE, O., MERDINOGLU, D., VALENTIN, P., PUTZ, C., ZIEGLER-GRAFF, V., GUILLEY, H., JONARD, G., and RICHARDS, K. (1988). Effect of beet necrotic yellow vein virus RNA composition on transmission by Polymyxa betae.Virology 162, 232-235.MOROZOV, S. Y., DOLJA, V. V., and ATABEKOV, J. G. (1989). Probable reassortment of genomic elements among elongated RNA-containing plant viruses. J. Mol. Evol. 29, 52-63.NIESBACH-KLÖSGEN, U., GUILLEY, H., JONARD, G., and RICHARDS, K. (1990). Immunodetection in vivo of beet necrotic yellow vein virus encoded proteins. Virology 178, 52-61. 102
  • 106. Publication n°2______________________________________________________________________PETTY, I. T. D., FRENCH, R, JONAES, R. W. and JACKSON, A. O. (1990a). Identification of barley stripe mosaic virus genes involved in viral RNA replication and systemic movement. EMBO J. 9, 3453-3457.PETTY, I. T. D., EDWARDS, M. C., and JACKSON, A. O. (1990b). Systemic infection of an RNA plant virus determined by a point substitution in a 5 leader sequence. Proc. Natl. Acad. Sci., U..S.A. 87, 218-226.PETTY, I. T. D., DONALD, R. G. K. and JACKSON, A. O. (1994). Multiple genetic determinants of barley stripe mosaic virus influence lesion phenotype on Chenopodium amaranticolor. Virology 198, 218-226.QUILLET, L., GUILLEY, H., JONARD, G., and RICHARDS, K. (1989). In vitro synthesis of biologically active beet necrotic yellow vein virus RNA. Virology 172, 293-301.RICHARDS, K. E. and TAMADA, T. (1992) Mapping functions on the multipartite genome of beet necrotic yellow vein virus. Annu Rev. Phytopath. 30, 291-313.SCHMITT, C., BALMORI, E., JONARD, G., RICHARDS, K. E., and JONARD, G. (1992). In vitro mutagenesis of biologically active transcripts of beet nrecrotic yellow vein virus RNA 2: evidence that a domain of the 75-kDa readthrough protein is important for efficient virus assembly. Proc. Natl. Acad. Sci., U..S.A. 89, 5715-5719.SCOTT, K. P., KASHIWAZAKI, S., REAVY, B., and HARRISON, B. D. (1994) The nucleotide sequence of potato mop-top virus RNA 2: A novel type of genome organization for a furovirus. J. Gen. Virol. 75, 3561-3568.SHIRAKO, Y. and WILSON, T. M. A. (1993). Complete nucleotide sequence and organization of the bipartite RNA genome of soil-borne wheat mosaic virus. Virology 195, 16-32.TAMADA, T. and KUSUME, T. (1991). Evidence that the 75K readthrough protein of beet necrotic yellow vein virus RNA-2 is essential for transmission by the fungus Polymyxa betae. J. Gen Virol. 72, 1497-1504. 103
  • 107. Résultats______________________________________________________________________TAMADA, T., SHIRAKO, Y., ABE, H. SAITO, M., KIGUCHI, T., and HARADA, T. (1989) Production and pathogenicity of isolates of beet necrotic yellow vein virus with different numbers of RNA components. J. Gen. Virol. 70, 3399-3409.TURNER, R., BATE, N., TWELL, D., and GOSTER, G. D. (1994). In vivo characterisation of a translation enhancer upstream from the coat protein open reading frame of potato virus S. Arch. Virol. 137, 123-132.TWELL, D., KLEIN, T. M., FROMM, M. E., and McCORMICK, S. (1989). Transient expression of chimeric genes delivered into pollen by microparticle bombardment. Plant Physiol. 91, 1270-1274.VAN BOKHOVEN, H., LE GALL, O., KASTEEL, D., VERVER, J., WELLINK, J., and VAN KAMMEN, A. (1993).Cis - and trans-acting elements in cowpea mosaic virus RNA replication. Virology 195, 377-386.VEIDT, I., BOUZOUBAA, S. E., LEISER, R. M., ZIEGLER-GRAFF, V., GUILLEY, H., RICHARDS, K.,and JONARD, G. (1992). Synthesis of full-length transcripts of beet western yellows virus RNA: messenger properties and biological activity in protoplasts. Virology 186, 192-200.WELLINK, J., VAN BOKHOVEN, H., LE GALL, O., VERVER, J., and VAN KAMMEN, A. (1994). Replication and translation of cowpea mosaic virus RNAs are tightly linked. Arch. Virol. (Suppl) 9, 381-392.ZIEGLER, V., RICHARDS, K., GUILLEY, H., JONARD, G., and PUTZ, C. (1985). Cell-free translation of beet necrotic yellow vein virus: readthrough of the coat protein cistron. J. Gen. Virol. 66, 2079-2087.ZIEGLER-GRAFF, V., BOUZOUBAA, S., JUPIN, I., GUILLEY, H., JONARD, G., and RICHARDS, K. (1988). Biologically active transcripts of beet necrotic yellow vein virus RNA-3 and RNA-4. J. Gen. Virol. 69, 2347-2357.ZOLLER, M. J. and SMITH, M. (1982). Oligonucleotide-directed mutagenesis using M13-derived vectors: an efficient and general procedure for the production of point mutations in any fragment of DNA. Nucl. Acids Res. 10, 6487-6500. 104
  • 108. Publication n°2______________________________________________________________________ 105
  • 109. CHAPITRE 3 : DES RNA 2 DEFECTIFS SONT CAPABLES DINHIBER LA REPLICATION DU BNYVV Avant de décrire lutilisation de RNA défectifs interférant avec la réplication duBNYVV, je voudrais rappeler brièvement quelques stratégies couramment utilisées dansla lutte antivirale par transgénose.I-Rappel sur les stratégies de lutte antivirale par transgénose : expression deséquences dérivées du pathogène. De nombreux résultats concernant lobtention de plantes transgéniques exprimantdes séquences virales ont déjà été décrits dans la littérature et les différentes stratégiesutilisées ont une efficacité qui varie en fonction du virus étudié (pour revue, voirWilson, 1993).
  • 110. Chapitre 3______________________________________________________________________ a-Expression constitutive de protéines structurales. Powell-Abel et collaborateurs ont obtenu dès 1986 des tabacs exprimant laprotéine de coque du TMV et résistant à une infection par ce virus. Le processusimpliqué dans cette résistance nest pas bien établi. Il semblerait cependant que laprotéine de coque exprimée dans ces plantes transgéniques inhibe la décapsidation duvirus. Ces travaux ont été les premiers dune longue série faisant appel à la stratégiecapside et, à lheure actuelle, de nombreux cas de plantes transgéniques exprimant la CPde différents phytovirus sont décrits dans la littérature (pour revue voir Beachy et al,1990 ; Hull & Davies, 1992). Cette stratégie ne confère en général quune résistancepartielle contre linfection du virus, résistance caractérisée par un retard dans lapparitiondes symptômes qui sont moins sévères ainsi quune concentration moindre du virus. b-Résistance liée à lexpression dun RNA dorigine virale non traduit. Dans certains cas, lexpression de la protéine CP nest pas nécessaire à linductionde la résistance. Ainsi, Smith et collaborateurs (1994) ont introduit, dans des tabacs, legène muté de la protéine de capside du potato virus Y (ou PVY) et ont obtenulaccumulation du transcrit correspondant. Dans ce cas, les plantes infectées par du PVYprésentent une résistance beaucoup plus importante que celle développée par des plantestransgéniques exprimant constitutivement la protéine de coque du virus. Des résultatsanalogues ont été obtenus avec le tobacco etch virus (ou TEV) (Silva-Rosales et al,1994). Dans ce cas, les plantes présentent une résistance homologue à une infection parle TEV alors que les plantes exprimant la protéine de coque développent une résistancepartielle hétérologue contre le TEV, mais aussi contre le PVY, un autre potyvirus. Pourexpliquer cette résistance spécifique liée à la présence de RNA seul, les auteurssuggèrent quil existe un système de régulation de la transcription du transgène dans lacellule végétale. Lorsquun certain seuil de concentration du transcrit est atteint dans lacellule, un système de régulation négatif à la fois cytoplasmique et nucléaire se met enplace, réprimant ainsi la synthèse de transcrits et pouvant éventuellement engendrer leurdégradation. Ce système spécifique activé pourrait agir dès les premiers instants dune 107
  • 111. Résultats______________________________________________________________________infection par un virus donné (Smith et al, 1994) mais présente un inconvénient. En effet,il a été démontré que des plantes transgéniques génétiquement identiques exprimant detelles séquences pouvaient réagir de manière différente face à une infection virale. Ainsi,une plante peut être totalement résistante alors quune autre sera sensible, cettedifférence étant liée à des modifications épigénétiques comme la méthylation parexemple (Dougherty et al, 1994 ; Wasseneger et al, 1994). c-La séquence virale exprimée interfère avec la réplication virale. Ce type de résistance a été obtenue en utilisant soit des RNA satellites soit desRNA défectifs interférants. -Les RNA satellites. Les RNA satellites sont de petites molécules de RNA incapables de se répliquerseules dans une cellule végétale ; ils nécessitent la présence dun virus assistant à la foispour la réplication et lencapsidation. Ils ne présentent pas dhomologie significativeavec les RNA viraux à lexception de quelques nucléotides 5 et 3 terminaux (Franki,1986) et peuvent aggraver ou atténuer les symptômes (Jacquemond & Lot, 1981).Lassociation dun RNA satellite avec un isolat viral plutôt quun autre, ou lamodification de quelques nucléotides au niveau du satellite suffit pour modifier dans unsens ou dans lautre les effets dus au virus lors de linfection dun hôte (Baulcombe,1990). Le RNA satellite le plus étudié à lheure actuelle est le satellite du cucumbermosaic virus ou CMV (pour revue voir Yie & Tien, 1993). Lutilisation des RNA satellites dans le cadre dune lutte antivirale partransgénose permet dinduire une résistance à linfection par le CMV (Baulcombe et al,1986 ; Tien et al, 1987 ; Montasser et al, 1991). Cette résistance peut être augmentéelorsque les plantes transgéniques expriment à la fois la séquence satellite et la protéinecapsidaire (Yie et al, 1992). Cependant, cette stratégie présente un risque majeur, àsavoir des mutations ponctuelles transformant les RNA satellites non nécrogènes enRNA satellites nécrogènes avec toutes les conséquences néfastes connues (Baulcombe, 108
  • 112. Chapitre 3______________________________________________________________________1990). 109
  • 113. Résultats______________________________________________________________________ Complexe de réplication RNA A B Figure III-1 : Représentation schématique du "copy-choice" pour la synthèse de RNA Défectifs Interférants (daprès Lazzarini et al, 1981). Deux possibilités : (A) intermoléculaire (B) intramoléculaire ( indique un saut de la réplicase) 110
  • 114. Chapitre 3______________________________________________________________________ -Les RNA défectifs interférants. Ce sont de petits RNA obtenus par délétions internes au sein de RNA viraux(Roux et al, 1991). Ils conservent donc les séquences 5 et 3 terminales essentielles à lareconnaissance par le complexe de réplication, mais nécessitent la présence dun RNAassistant pour se répliquer. Ces RNA DI peuvent apparaître de façon naturelle lors depassages successifs du virus sur lhôte et leur effet DI est probablement lié à unecompétition pour la réplicase virale. Cette compétition entraîne une chute du taux deréplication virale et atténue les symptômes. Des RNA DI naturels ont été décrits dans denombreux cas de virus de plantes comme le tomato bushy stunt virus ou TBSV(Hillman et al, 1987), le cymbidium ringspot virus ou CyRSV (Burgyan et al, 1989), leturnip crinkle virus ou TCV (Li et al, 1989), le clover yellow mosaic virus ou CYMV(White et al, 1991) et le tomato spotted wilt virus ou TSWV (De Oliveira Resende et al,1991). Le mécanisme moléculaire lié à lapparition de ces molécules de RNA DI nestpas encore élucidé à lheure actuelle : ils pourraient être issus dun épissage incontrôlédes RNA génomiques ; ils pourraient également être obtenus à la suite dune erreur lorsde la réplication des RNA génomiques selon le modèle "copy-choice" décrit parLazzarini et collaborateurs (1981) (figure III-1). Dans ce modèle, le complexe deréplication initierait normalement la synthèse du RNA génomique, puis, par unmécanisme encore inconnu, continuerait sur une autre région du RNA génomique, voiresur une autre molécule de RNA, ce qui aurait pour conséquence une délétion plus oumoins importante du génome. Des molécules défectives interférantes ont été utilisées avec succès dans la luttecontre lafrican cassava mosaic virus (ACMV), un géminivirus. En effet des tabacstransgéniques exprimant un DNA viral délété dérivé du composant B génère unerésistance vis à vis de lACMV. Ces plantes restent cependant sensibles à une infectionpar un autre géminivirus appartenant au même sous groupe : le tomato golden mosaicvirus ou TGMV (Stanley et al, 1990). Une telle résistance induite par des RNA DI aégalement été décrite pour le CyRSV, un tombusvirus (Kolar et al, 1993). Enfin, en 111
  • 115. Résultats______________________________________________________________________1991, Marsh et ses collaborateurs ont été en mesure de construire par mutagénèsedirigée des RNA DI à partir du RNA 2 du brome mosaic virus (ou BMV). 112
  • 116. Chapitre 3______________________________________________________________________RNA 1 P237 A 221 6562RNA 1 a A 435 6562RNA 1 b A P75 RNA 2 CP P13 P14 A P42 270 4482 RNA 2 a A 499 4482 RNA 2 b A 637 4482 RNA 2 c A 1142 4482 RNA 2 d A 3789 269 RNA 2 e A RNA 3 P25 A RNA 4 P31 A 381 1470 404 1334 RNA 3A ² ES A RNA 45-R4 A Figure III-2 : Organisation génétique du BNYVV et localisation des délétions réalisées dans les différents RNA génomiques. 113
  • 117. Résultats______________________________________________________________________ Dans le cas du BNYVV, il nexiste pas de RNA DI naturel. Cest pourquoi, dansloptique de la mise au point dune stratégie de lutte antivirale dirigée contre le BNYVV,nous avons entrepris la construction de telles molécules à partir des clones cDNAcorrespondant aux différents RNA du BNYVV.II-Obtention de RNA défectifs artificiels du BNYVV : leur effet sur la réplication duvirus. 1-Obtention de RNA défectifs. Pour construire des RNA DI potentiels, nous avons délété une grande partie desrégions codantes présentes sur les différents RNA et ceci en utilisant des sites derestriction présents sur les copies cDNA double brin correspondant à ces RNA. Lesdélétions ont été effectuées en conservant les extrémités 5 et 3 terminales impliquées encis dans la réplication (cest à dire les 310 premiers et 70 derniers nucléotides pour leRNA 3 par exemple) (Jupin et al, 1990). Les différents mutants obtenus sont décrits surla figure III-2. Les délétions introduites éliminent de 64 % (dans le cas du RNA 2d)jusquà 93 % (dans le cas du RNA 1a) de linformation génétique du RNA viral. 2-Seules les délétions introduites dans le RNA 2 produisent des RNA ayant un effet Défectif Interférant. Afin de tester leurs propriétés biologiques, nous avons transcrit ces différentesconstructions puis nous les avons inoculés à des protoplastes en présence de RNAassistant représenté par les RNA 1 et 2 de lisolat Stras 12. Les expériences ont étéréalisées dans les conditions où les RNA délétés sont en excès dun facteur 30 (en poids)par rapport aux RNA viraux génomiques. Après 48 heures de culture, nous avons extraitclassiquement les RNA totaux et nous les avons analysés par hybridation moléculaire enutilisant les sondes ribonucléiques spécifiques des RNA 1 et 2. Les résultats que nousavons obtenus (publication 3, figures A et B) montrent que seuls les mutants de délétiondu RNA 2 (RNA 2a à RNA 2e) sont en mesure dinhiber la réplication des RNA 1 et 2 114
  • 118. Chapitre 3______________________________________________________________________génomiques. Pour les mutants de délétion préparés à partir des RNA 1, 3 et 4, aucuneffet sur le taux de réplication des RNA 1 et 2 na pu être détecté. 3-Analyse de leffet DI en fonction de la quantité de RNA DI utilisée et du temps. a-En fonction de la quantité Pour essayer de mieux comprendre les raisons de cet effet inhibiteur nous avonsréalisé dautres expériences en utilisant essentiellement le RNA 2a qui provoque leseffets inhibiteurs les plus sévères. Afin de voir si la quantité de RNA DI utilisée avaitune influence sur le degré dinhibition de la réplication, nous avons coinoculé lisolatStras 12 avec des quantités croissantes de RNA mutant (dun facteur 1 à 30 en poids, cequi correspond à 30 jusquà 300 fois plus de molécules de RNA DI que de RNA 1 et 2 ).Lorsque lon analyse les RNA génomiques extraits de protoplastes inoculés dans cesconditions, on constate que leur synthèse est totalement inhibée pour des quantités deRNA 2a en excès de 10 fois (publication 3, figure 3, piste 6). Cette inhibition estspécifique : en effet, lorsquon coinocule du RNA Stras 12 avec un excès dun facteur 30de RNA totaux extrait de C. quinoa sain, on nobserve pas de diminution du taux deréplication des RNA viraux génomiques (publication 3, figure 3, piste 4). Bien aucontraire, les signaux correspondant aux RNA 1 et 2 sont souvent légèrement plus fortsceci étant probablement dû à un effet protecteur vis à vis de nucléases cellulaires. Enfin, on ne peut mettre en évidence de signal correspondant au RNA DI etindiquant une réplication efficace de cette molécule (voir publication 3, figure 3, pistes5 à 8). Pour expliquer cela, plusieurs hypothèses sont envisageables : (1) on peutimaginer que le RNA DI ne se réplique que très faiblement et nest donc pas détectable.Ceci apparaît dautant plus plausible que lORF VI est totalement éliminée ou bien que lasynthèse de RNA subgénomique correspondant est probablement inhibée (cas duRNA 2e) ; or on sait maintenant que la protéine P14 agit en cis dans la réplication. (2)On peut également imaginer que la délétion introduite a éliminé une séquencenécessaire à lencapsidation de ces RNA qui seraient alors la cible de nucléasescellulaires. 115
  • 119. Résultats______________________________________________________________________ A B C Figure III-3 : Effet des RNA DI 2a et 2e coinoculés avec lisolat Stras 123. A- Isolat Stras 123 B- Isolat Stras 123 + RNA 2a C- Isolat Stras 123 + RNA 2e 116
  • 120. Chapitre 3______________________________________________________________________ b-Cinétique de la réplication du virus en présence et en labsence du RNA 2a. Pour déterminer à quel moment du cycle de réplication viral se faisait "leffetDI", nous avons réalisé une cinétique dinfection de protoplastes en coinoculant lisolatStras 12 avec un large excès de RNA DI 2a. Lorsque lon extrait les RNA totaux 1 heureaprès lélectroporation, les RNA génomiques ne peuvent être observés quel que soit lecas (publication 3, figure 4, pistes 1 et 2). La réplication na pas encore atteint un tauxsuffisamment important pour que les RNA viraux puissent être détectés par la techniqueutilisée. Par contre, on peut observer une bande résiduelle correspondant au RNA DIprovenant de linoculum. Si on peut déjà détecter un signal très faible correspondant auxRNA 1 et 2 7 heures après linfection (publication 3, figure 4, piste 4), en revanche, cesRNA 1 et 2 ne peuvent être mis en évidence quand ces protoplastes sont coinoculés aveclisolat Stras 12 et le RNA DI et ceci même 48 heures après linfection (publication 3,figure 4, piste 11). Cette cinétique nous permet donc de conclure que leffet DI est unévénement précoce dans le cycle de réplication du virus. 4-Analyse dans les plantes de leffet DI des différents mutants du RNA 2. Il nous restait à confirmer leffet inhibiteur des RNA 2 DI au niveau de la plante.Pour cela, nous avons infecté des feuilles de C. quinoa avec lisolat Stras 123 (constituédes RNA 1, 2 et 3 sauvages) en présence et en labsence de RNA 2a ou 2e. Comme onpeut le constater sur la figure III-3, lisolat Stras 123 provoque des lésions chlorotiquessévères tandis que les plantes inoculées avec lisolat Stras 123 et les RNA 2 DI nedéveloppent pas de symptômes. Cela est confirmé par lanalyse des RNA totaux extraitsdes feuilles qui révèle une diminution importante de la quantité de RNA viraux. On notedautre part un très léger signal correspondant aux RNA 2a et 2e qui pourrait en faitnêtre quun résidu dinoculum (publication 3, figure 5, piste 2 et 3). 117
  • 121. Résultats______________________________________________________________________III-Conclusions et perspectives. Ces expériences préliminaires nous ont donc permis de générer des mutants dedélétion du RNA 2 capables dinhiber la réplication des RNA génomiques viraux. Cesrésultats rejoignent les observations faites par Marsh et collaborateurs (1991) qui ontégalement pu construire des RNA défectifs interférants à partir du RNA 2 du BMV. On peut penser que cet effet DI est associé à une affinité plus grande des RNADI pour le complexe de réplication qui, ainsi piégé, ne sera plus disponible pour laréplication des RNA viraux. Pour expliquer lefficacité des RNA défectifs dérivés du RNA 2 par rapport auxautres RNA, on peut imaginer que ces RNA DI ont perdu leur site dencapsidation. Dece fait, nétant pas encapsidés, ils pourront rester accessibles au complexe de réplicationet donc interférer avec la réplication des RNA génomiques. Ces résultats vont maintenant être exploités pour construire des plantestransgéniques exprimant constitutivement lun des RNA 2 DI. Cependant, comme on apu le constater, le problème majeur qui se posera dans cette approche est la nécessitédobtenir une forte synthèse de RNA DI pour inhiber la réplication virale. 118
  • 122. Chapitre 3______________________________________________________________________ 119
  • 123. Publication n°3ARTIFICIAL DEFECTIVE INTERFERING RNAs DERIVED FROM RNA 2 OF BEET NECROTIC YELLOW VEIN VIRUS A. Hehn, S. Bouzoubaa, G. Jonard, H. Guilley and K. Richards. Archives of Virology (135, 143-151) (1994)
  • 124. Publication n°3______________________________________________________________________ 121
  • 125. Résultats______________________________________________________________________ 122
  • 126. Publication n°3______________________________________________________________________ 123
  • 127. Résultats______________________________________________________________________ 124
  • 128. Publication n°3______________________________________________________________________ 125
  • 129. Résultats______________________________________________________________________ 126
  • 130. Publication n°3______________________________________________________________________ 127
  • 131. Résultats______________________________________________________________________ 128
  • 132. Publication n°3______________________________________________________________________ 129
  • 133. CHAPITRE 4 : MISE EN EVIDENCE DUNE ACTIVITE PROTEOLYTIQUE ASSOCIEE A LA PROTEINE P237 CODEE PAR LE RNA 1 DU BNYVV. Ces travaux préliminaires concernant la maturation de la protéine P237 codéepar le RNA 1 du BNYVV font suite à une étude informatique de comparaison deséquences réalisée par Koonin et Dolja en 1993. Outre les domaines consensus déjàdécrits, à savoir les domaines méthyltransférase (MTR), hélicase (HEL) et polymérase(POL) (Poch et al, 1989), Koonin & Dolja ont également montré que la protéine P237renfermait un domaine protéase de type papaïne (PRO). Cette observation suggère quela protéine P237 est donc probablement maturée lors du cycle dinfection virale. Commeon peut le voir dans le tableau IV-1, cette stratégie est utilisée par de nombreux virusvégétaux ou animaux pour exprimer leur information génétique.
  • 134. Chapitre 4______________________________________________________________________ ______________________________________________________ Famille de virus Protéase virale Protéase cellulaire ______________________________________________________ Virus animaux Picornaviridae Enterovirus Ser*, Ser* Rhinovirus Ser*, Ser* Togaviridae Alphavirus Cys, Ser Oui Rubivirus Cys Oui Coronaviridae Cys, Ser Flaviviridae Flavivirus Ser Oui Retroviridae Asp Oui Virus végétaux Potyviridae Potyvirus Ser, Cys, Ser* Baymovirus Cys, Ser* Comoviridae Ser* Nepoviridae Ser* Furoviridae Cys ? Tymoviridae Cys Caulimoviridae Asp ______________________________________________________ Tableau IV-1 : Exemples de virus nécessitant la maturation dune polyprotéine virale au cours de la réplication. Ser : protéase à sérine, Ser * : protéase sérine like, Cys : protéase à cystéine, Asp : protéase à acide aspartique. le "?" signifie quil ny a pas encore de preuve biochimique de lappartenance de la protéase à telle ou telle classe (Dougherty & Semler, 1993). 131
  • 135. Résultats______________________________________________________________________I-Les protéases dorigine virale et leurs caractéristiques 1-Généralités sur les protéases. Il existe 2 types de protéases : les exoprotéases et les endoprotéases. Lesexoprotéases catalysent lélimination, de manière récurrente, des acides aminésterminaux. Les endopeptidases, par contre, permettent le clivage dune liaisonpeptidique entre 2 acides aminés spécifiques au sein dune protéine donnée (Barrett,1986). Quatre classes dendoprotéases ont été décrites : -Les métalloprotéases, les protéases à sérine, les protéases à cystéine et lesprotéases acides. Les métalloprotéases nécessitent pour être actives la présence dun iondivalent, en général un ion Zn2+ et à lheure actuelle, ces protéases nont pas encore étédécrites dans le cas de maturation de protéine virale. -Les protéases à sérine sont caractérisées par la présence dune "triadecatalytique" composée par une sérine, une histidine et un acide glutamique ou aspartiqueau niveau du site actif. Lors de la réaction enzymatique, il se forme un intermédiaireenzyme-substrat covalemment lié entre le groupement hydroxyl de la sérine du sitecatalytique et le groupement carbonyle de la liaison peptidique (Sprang et al, 1987). -Il existe 2 types de protéases à cystéine : (1) celles qui disposent dune diadecatalytique composée dune cystéine et dune histidine, ce sont des protéases à cystéinepapaïn-like. (2) Les protéases caractérisées par une triade catalytique analogue à celledes protéases à sérine où le résidu sérine est remplacé par une cystéine : cest le cas desenzymes de type chymotrypsine. Le processus catalytique des protéases à cystéine passepar la formation dun intermédiaire enzyme-substrat sétablissant grâce à une liaisoncovalente entre le groupement thiol de la cystéine du site actif et le groupementcarbonyle de la liaison peptidique. -Enfin, les protéases à acide aspartique, ou protéases acides, contiennent 2 acidesaspartiques au niveau de leur site catalytique. Le mécanisme réactionnel des protéases132
  • 136. Chapitre 4______________________________________________________________________M-RNA transport et protéines de réplication structure Vpg 58 k/ 48 k VP 37 VP 23 AAA 105 k 95 k 58 k 60 k 48 k 60 k VP 37 VP 23B-RNA régulation de la Vpg protéase polymérase maturation Vpg 32 k 58 k 24 k 87 k AAA 200 k 32 k 170 k 84 k 87 k 60 k 110 k 58 k Vpg 24 k 87 k Figure IV-1 : Schéma général de lorganisation génétique du CPMV. La taille des protéines obtenues après maturation des polyprotéines P105, P95 et P200 est également représentée. 133
  • 137. Résultats______________________________________________________________________ AA Traduction Maturation cotraductionnelle 87 kDa 121 kDa 6 kDa 49 kDa 88 kDa ou Maturation post- traductionnelle 54 kDa P1 HC-PRO Protéine de Hélicase, Vpg NIa Réplicase ? Mouvement ? NTPase protéase capside ? 35 kDa 51 kDa 50 kDa 71 kDa 21 kDa 27 kDa 58 kDa 30 kDa Figure IV-2 : Représentation schématique de lorganisation génétique du RNA du Tobacco Etch Virus (ou TEV) et des différentes étapes de la maturation de la polyprotéine de 346 kDa.134
  • 138. Chapitre 4______________________________________________________________________acides et des métalloprotéases nest pas clairement établi mais il semblerait quil ny aitpas formation dun intermédiaire enzyme-substrat lié de façon covalente.2-Exemples de protéines virales présentant une activité protéasique De nombreux virus expriment leur information génétique sous forme depolyprotéines qui sont maturées en cis ou en trans par une ou plusieurs protéasesvirales. Le tableau IV-1 rassemble quelques exemples répertoriés chez les virus animauxet végétaux. Nous allons, dans la suite de ce chapitre, nous limiter à une descriptionsommaire de lun ou lautre de ces cas. a-Une seule activité protéase est responsable de la maturation des polyprotéines du Cowpea Mosaic Virus (CPMV): La protéinase unique permettant la maturation des 2 polyprotéines synthétiséespar le cowpea mosaic virus (CPMV), un virus picorna-like, a un poids moléculaire de 24kDa et fait partie intégrante de la polyprotéine de 200 kDa codée par le B-RNA(Wellink et al, 1986, 1987 ; Peters et al, 1992) (voir figure IV-1). Il existe un cofacteurde 32 kDa, localisé à lextrémité N-terminale de la protéine B, qui permet une régulationpositive ou négative de la maturation des polyprotéines B et M (Vos et al, 1988 ; Peterset al, 1992). Des études par mutagénèse dirigée ont permis de mettre en évidencelimportance des résidus histidine (His40), cystéine (Cys166) et acide glutamique (Glu76)au niveau du site actif (Dessens & Lomonossof, 1991) : la protéine de 24 kDa est doncune protéase à cystéine de type chymotrypsine (Gorbalenya et al, 1989). b-Trois activités protéases sont nécessaires pour maturer la polyprotéine codée par le Tobacco Etch Virus (TEV), un potyvirus : Pour le TEV, 3 protéases sont nécessaires pour mener à terme la maturation de lapolyprotéine synthétisée à partir du RNA génomique unique (voir figure IV-2). Ainsi, laprotéase P1 de 35 kDa catalyse son automaturation. Cest une protéase à sérinecaractérisée par sa triade catalytique composée dune histidine (His214), dun résiduacide aspartique (Asp223) et dune sérine (Ser256) (Verchot et al, 1992). La protéine HC- 135
  • 139. Résultats______________________________________________________________________Pro présente des homologies de séquence avec des protéases de type papaïne et a donc,de ce fait, été classée dans la catégorie des protéinases à cystéine (Gorbalenya et al,1991). Son site catalytique est composé par une cystéine (Cys649) et une histidine(His722). Comme la protéase P1, HC-PRO catalyse sa propre maturation. Enfin, laprotéase NIa de 49 kDa est responsable des 5 autres clivages de la polyprotéine codéepar le TEV (Carrington & Dougherty, 1987 ; Riechmann et al, 1992). Elle a été classéedans la catégorie des protéases à cystéine chymotrypsine-like car son site catalytique estcomposé dune triade histidine (His 234), acide aspartique (Asp 269) et cystéine (Cys 339)(Dougherty et al, 1989). c-Exemple de lactivité protéase associée à la polyprotéine P206 codée par le Turnip Yellow Mosaic Virus (TYMV), un virus sindbis-like. La maturation de la protéine P206 du TYMV nécessite la présence dun domaineprotéase papaïn-like caractérisé par une cystéine et une histidine au niveau du sitecatalytique. La maturation permet de générer une protéine N-terminale de 150 kDa etune protéine C-terminale de 70 kDa (Bransom & Dreher, 1994). Il a été démontré quelactivité catalytique se faisait en cis car aucune complémentation nest possible in vitro.Dautre part, des mutations ponctuelles substituant les résidus acides aminés du sitecatalytique (la cystéine 783 ou lhistidine 869) engendrent une inhibition de laréplication du virus dans les protoplastes de Brassica rapa.II-Cas du BNYVV. 1-Comparaison de séquences avec des domaines protéases dautres phytovirus. Une étude informatique réalisée par Koonin et Dolja, en 1993, a permis demettre en évidence des homologies de séquences entre un certain nombre de virus et leBNYVV. Ces homologies concernent notamment une séquence consensus de protéasede type136
  • 140. Chapitre 4______________________________________________________________________BNYVV CADFYNLVSRPNNCLVVAISECLGVT...77... SDGHFIAAPLSSRubV RASTRGGELDPNTCWLRAAANVAQAA..105 ...PTGHFVCAVGGGHEV FCCFMKWLGQECTCFLQPAEGAVGDQ...91....PERHNLSFDASQTEV LNEEKMYIANEGYCYMNIFFALLVNV...57....KTMHVLDSYGSRPVY GDSEMLYIAKQGYCYINVFLAMLINI...57....QTCHVVDSFGSQ C@U H& Figure IV-3 : Séquences consensus de protéases papaïn-like virales. Ces protéases sont caractérisées par la présence de résidus cystéine et histidine au sein du site catalytique. @ désigne un résidu aromatique (F, Y, W, L), & un résidu hydrophobe (aliphatique ou aromatique) et U un résidu aliphatique (I, L, V, M). RubV = Rubi virus, HEV = hepatitis E virus, TEV = tobacco etch virus, PVY = potato virus Y(Koonin and Dolja, 1993) 137
  • 141. Résultats______________________________________________________________________ n n u e res res n n es n n es mi mi he rheu eu mi mi eur mi mi eur 20 40 1 2 4h 20 40 4h 20 40 4h237 kDa 237 kDa 237 kDa160 kDa 160 kDa 160 kDa 60 kDa Α Β C Figure IV-4 : Analyse par électrophorèse en gel de polyacrylamide 8% des produits de traduction de lisolat Stras 12 dans le système de réticulocytes de lapins. A. Cinétique dapparition du produit de maturation P160. B. Mise en évidence du produit de maturation N-terminal par une expérience de chasse en présence dédéine et de méthionine froide. C. Caractérisation du produit de maturation C-terminal. La méthionine radioactive et lédéine ont été rajoutées au milieu après 20 minutes de traduction.138
  • 142. Chapitre 4______________________________________________________________________papaïne (figure IV-3) et plus précisément une cystéine et une histidine appartenant ausite catalytique potentiel. Les résidus acides aminés concernés chez le BNYVV seraientla cystéine 1280 et lhistidine 1370 de la protéine P237 codée par le RNA 1, ce quipermet de localiser le domaine protéase entre les domaines hélicase et polymérase de lapolyprotéine. 2-Mise en évidence dune activité protéase associée à la protéine P237. a-Cinétique de la traduction. Pour confirmer les prédictions informatiques concernant la maturation de laprotéine P237 du BNYVV, nous avons entrepris de traduire lisolat Stras 12 du BNYVVdans le système de réticulocytes de lapins. Les traductions ont été effectuées à 30 °C enprésence de méthionine radiomarquée au 35S et stoppées par laddition dun volume detampon de charge décrit dans le chapitre matériel et méthodes. Les résultats que nousavons obtenus (voir figure IV-4) révèlent lapparition dune protéine ayant un poidsmoléculaire approximatif de 160 kDa. Cette protéine apparaît après 2 heures detraduction et nengendre pas une diminution notable de la quantité de protéine P237.Cette approche na cependant pas permis de mettre en évidence le peptidecomplémentaire qui devrait avoir approximativement un poids moléculaire de 80 kDa. b-Mise en évidence du peptide renfermant le domaine N-terminal de la protéine P237. Afin de déterminer si le produit de maturation de 160 kDa observéprécédemment correspond à lextrémité N-terminale ou C-terminale de la protéine P237,nous avons réalisé une expérience de "chasse". Le principe de la méthode consiste àinitier la traduction en présence de méthionine radiomarquée. Après 15 minutes detraduction, on rajoute de lédéine (pour inhiber linitiation) au milieu réactionnel ainsiquune grande quantité de méthionine non marquée. Seuls les produits de traductionprovenant de lextrémité N-terminale seront donc radioactifs. Comme on peut le 139
  • 143. Résultats______________________________________________________________________constater sur la figure IV-4-B, la protéine P160 est très nettement visible ce qui prouveque ce peptide correspond à lextrémité N-terminale de la protéine P237. c-Mise en évidence du produit de maturation renfermant lextrémité C-terminale de la protéine P237. Cette méthode consiste à initier la traduction de la protéine P237 en présence deméthionine non radioactive. Après 15 minutes de traduction, le milieu est additionnédédéine et dun large excès de méthionine radiomarquée ce qui a pour conséquence demarquer les protéines uniquement à leur extrémité C-terminale. Grâce à cette technique,nous avons pu visualiser sur la figure IV-4-C le peptide complémentaire du produit dematuration P160 décrit plus tôt. Cette protéine a un poids moléculaire approximatif de60 kDa. Sur la même figure, nous pouvons observer la présence des protéines P237 etP160.III-Conclusions : Les observations de Koonin et Dolja (1993) basées sur des études decomparaison de séquence et prédisant la présence dun domaine protéase dans laprotéine P237 sont donc confirmées. En effet, les études que nous avons initiées sur lasynthèse de la protéine P237 révèlent une maturation in vitro qui génère au moins 2protéines, lune de PM 160 kDa et lautre de PM 60 kDa environ. Lappartenance à laclasse des protéases papaïn-like na pour linstant pas encore été démontrée. Il sagit à présent de déterminer si cette activité protéasique est auto catalytiqueou si elle nécessite la présence dautres protéines virales. Il faudra également caractériserles sites actifs et les sites de clivage. Enfin, une étude plus détaillée des produits detraduction du RNA 1 permettra de savoir si les protéines P160 et P60 représentent lesseuls produits de maturation de la protéine P237. Pour répondre à ces questions, nous envisageons, dans un premier temps, laconstruction dun clone plus petit renfermant le domaine protéase et permettant une140
  • 144. Chapitre 4______________________________________________________________________analyse plus facile de la maturation dans le système de traduction. Cela nous permettrade caractériser plus facilement les sites catalytiques et les sites de clivages de cetteprotéase. Nous envisageons également de cloner le RNA 1 dans un vecteur dexpressionbactérien inductible par lIPTG, puis danalyser les produits de maturation obtenus invivo. Une telle approche a été utilisée par Kadaré et collaborateurs (1995) pour étudier lamaturation de la polyprotéine P206 codée par le RNA du TYMV. 141
  • 145. CONCLUSION Les travaux réalisés dans le cadre de cette thèse nous ont amenés à aborder sur leplan moléculaire certains aspects de la virologie végétale tels que le mouvement decellule à cellule, la réplication, la maturation dune polyprotéine et la lutte antivirale parlutilisation de RNA DI. Ainsi dans le cadre dune étude par mutagénèse dirigée des fonctions des gènes 3proximaux du RNA 2, nous avons démontré que les protéines codées par les ORF III, IVet V étaient nécessaires à une diffusion efficace de linfection virale. Dautres phytoviruscomme le white clover mosaic virus (WClMV) et le barley stripe mosaic virus (BSMV)ayant une organisation génétique analogue requièrent également la présence des 3protéines du triple gene block (TGB) pour assurer le mouvement de cellule à cellule. Side nombreuses études ont déjà été effectuées sur des virus nécessitant une seule protéinevirale pour le mouvement, par contre aucun mécanisme na encore été proposé pourexpliquer comment un complexe de 3 protéines pouvait intervenir dans ce phénomène.Aussi, pour essayer de comprendre leur mode daction, on peut envisager dobtenir desrésultats précieux en utilisant le "two-hybrid system" qui permet de détecter in vivo desinteractions protéine-protéine (Hope & Struhl, 1986 ; Keegan et al, 1986 ; Ma &Pasthne, 1987).
  • 146. Conclusion______________________________________________________________________ Létude de la protéine P14, un polypeptide riche en cystéine, nous a permis demontrer quelle intervient dune part dans la stimulation en cis de la réplication du RNA2 et dautre part dans la régulation en trans de la synthèse de la protéine de coque. Il fautnoter que dautres virus disposent dun gène analogue localisé en 3 dun RNAgénomique et qui dirige la synthèse dune protéine riche en cystéine : cest le cas duBSMV et du tobacco rattle virus (TRV) dont le gène de capside est aussi situé en 5 dunRNA génomique. Il est donc possible que ces différents virus aient adopté un systèmede régulation analogue pour la synthèse de protéine de coque. Cette stratégie estdifférente de celle des virus qui expriment la protéine de coque à partir dun RNAsubgénomique ou encore à partir dune polyprotéine. Nous avons montré dautre part que la protéine P14 avait des propriétés defixation des acides nucléiques et quelle renfermait probablement une structure en doigtde zinc, structure qui semble être impliquée directement dans leffet sur la réplication duRNA 2 et (ou) sur la synthèse de la protéine de coque. Nous envisageons à présent dedéterminer si ces 2 phénomènes sont liés. Pour cela, dans un premier temps, nous avonsconstruit des mutants permettant de déstabiliser cette structure en "doigt de zinc" enremplaçant les cystéines par des alanines. Les résultats montrent que ces mutationsentraînent une diminution du taux de réplication des RNA viraux dans les plantesinoculées. Dans un second temps, les protéines correspondant aux différents mutantsalanine et possédant une cage histidine, seront exprimées dans un systèmeprocaryotique, purifiées par chromatographie daffinité sur une colonne Ni-NTA, puisutilisées dans des expériences de Northwestern pour tester leur capacité à fixer ou nonles acides nucléiques. Dans des expériences préliminaires visant à développer une stratégie de lutteantivirale, nous avons pu montrer que la construction de RNA défectifs pouvaitdéboucher sur une inhibition de la réplication virale. Cependant, dans loptique dunelutte par transgénose efficace, il faut impérativement que ces RNA DI soient exprimés à 143
  • 147. Conclusion______________________________________________________________________un taux élevé car nous avons montré quun large excès de RNA DI était nécessaire pourque linhibition soit effective. Enfin, nous avons montré que la protéine P237 est en fait une polyprotéinerenfermant un domaine protéase qui entraîne lapparition dau moins 2 produits dematuration de 160 et 60 kDa environ. Pour confirmer lappartenance de la protéase à laclasse des protéases papaïn-like (Koonin & Dolja, 1993), lanalyse de la maturation invivo de la protéine P237 exprimée à partir dun vecteur dexpression procaryotique ainsique lutilisation dinhibiteurs spécifiques semblent être les 2 approches les plusappropriées.144
  • 148. Conclusion______________________________________________________________________ 145
  • 149. MATERIEL ET METHODESA-AMPLIFICATION, EXTRACTION ET MODIFICATIONS DE DNAPLASMIDIQUE.I-Souches bactériennes, vecteurs de clonage ou dexpression et milieux de culture. 1-Souches bactériennes -BL21 (DE3) pLysS (Studier et al, 1990). Ces bactéries ont été utilisées essentiellement pour la surexpression de protéines àpartir du vecteur pET décrit dans le paragraphe A-I-2. Leur déficience en protéasespermet la stabilisation de ces protéines. Cette souche est lysogène pour le phage DE3, un dérivé du phage λ. Celui-cicontient dans son génome le gène lac I codant pour le répresseur du promoteur delopéron lactose ainsi que le gène de la T7 RNA Polymérase qui est placé sous ladépendance du promoteur lac UV5 inductible par lIPTG. La souche dispose également du plasmide pLysS qui confère la résistance auchloramphénicol. Ce plasmide code pour le lysozyme du phage T7 qui forme uncomplexe avec la T7 RNA polymérase, inhibant ainsi une activité transcriptionnelle quiserait due à une expression basale de la T7 RNA polymérase avant linduction parlIPTG (Moffatt & Studier, 1987). Cependant, le faible taux de lyzozyme produitninterfère pas avec lactivité de la T7 RNA polymérase après induction.
  • 150. Matériel et méthodes______________________________________________________________________ -BW313 (dut- ung-) (Kunkel et al, 1987). Cette souche est mutée dans le gène dut, ce qui entraîne lapparition deconcentrations élevées de dUTP dans la cellule par manque de désoxyuridylasefonctionnelle. Il en résulte une incorporation de façon statistique de dUTP à la place dedTTP dans les chaînes de DNA néosynthétisées. Ces erreurs dincorporation ne sont pasréparées car lenzyme N-glycosylase permettant la réparation nest pas présente (ung -). Ces souches ont été utilisées pour préparer les formes simple brin des plasmidesutilisés lors des expériences de mutagenèse dirigée. -MC1022 (Casadaban & Cohen, 1980) Ces bactéries sont couramment utilisées dans de nombreux laboratoires debiologie moléculaire à cause de leur capacité à fournir beaucoup de DNA plasmidique.Cette souche permet de faire une α-complémentation avec la partie N-terminale de la ß-galactosidase exprimée par les vecteurs de type pUC. -NM522 (Gough & Murray, 1983). Cette souche est utilisée lors des amplifications de plasmides recombinants. Ellepossède lépisome F nécessaire à la conjugaison bactérienne et à linfection par lesphages filamenteux (M13, f1). Ces bactéries sont mutées dans lopéron lactose etexpriment une ß-galactosidase inactive qui peut être rendue fonctionnelle par α-complémentation en utilisant un vecteur de clonage de type pUC ou pBS. En effet, cesplasmides disposent de la partie complémentaire de la ß-galactosidase. Cettecomplémentation intercistronique permet une sélection des clones recombinants par lacouleur en présence dun substrat de la ß-galactosidase, le 5-bromo-4-chloro-3-indolyl-ß-D-galactoside, ou X-gal. -Sure cells (Greener, 1990) [Stratagene]. 147
  • 151. Matériel et méthodes______________________________________________________________________ Cette souche na pas la capacité de réparer le DNA et de réaliser desrecombinaisons homologues. Dautre part, elle possède une faible activitéendonucléasique, ce qui permet dobtenir un DNA de bonne qualité lors dune extractionpar minipréparation. Elle dispose de lépisome F et est résistante à la tétracycline et à lakanamycine. Toutes ces souches bactériennes sont stockées à -80 °C en présence de 15%glycérol. 2-Vecteurs -Le Bluescribe [Stratagene] Ce plasmide polyfonctionnel dérive du pUC 19 et possède, de part et dautre de lacassette de clonage, les séquences promotrices de la transcription des phages T7 et T3.Ces promoteurs permettent de synthétiser in vitro, en présence de la RNA polymérasedu phage correspondant, des RNA ayant la polarité de lun ou de lautre des brins duDNA cloné au niveau du polylinker. La linéarisation du vecteur en aval de linsertpermet de limiter la transcription au seul DNA cloné. origine f1(+) r Amp Eco RI lac Z Sac I pBS +/- Kpn I T7 Sma I 3,2 kb MCS Bam HI T3 Xba I Sal I Pst I Sph I Hind III col E1 ori Ce plasmide possède la région intergénique du bactériophage M13, responsable dela formation du DNA simple brin et de son encapsidation. Une infection, par le phagehelper M13K07 modifié dans sa région intergénique, de bactéries contenant un plasmide148
  • 152. Matériel et méthodes______________________________________________________________________recombinant Bluescribe et un épisome nécessaire à la formation des F pilis, conduit àune synthèse et une encapsidation préférentielle du DNA simple brin recombinant(Vieira & Messing, 1987). Suivant lorientation de la région intergénique sur le plasmide(pBS+ ou pBS-), lencapsidation de lun ou lautre des brins est possible. Par exemple, leplasmide pBS+ permet lencapsidation du brin possédant la phase codante du gène de laß-galactosidase. Le phage helper M13K07 possède de plus le gène de résistance à la kanamycine etconfère une résistance à cet antibiotique aux bactéries quil infecte. En présence dekanamycine, seules les bactéries infectées se multiplieront. -Vecteurs pET (Studier et al, 1990). Bam HI Nco I Terminateur T7 Promoteur T7 pET 3d 4,6 kb r Amp. Les plasmides pET (pour plasmid for expression by T7 RNA polymerase) sontutilisés pour surexprimer des protéines dans E. coli. Ils confèrent la résistance àlampicilline. Dans les plasmides pET 1 à 9, le gène dintérêt est cloné en aval dupromoteur Φ10 (promoteur du gène 10 du phage T7) reconnu par la T7 RNApolymérase. 149
  • 153. Matériel et méthodes______________________________________________________________________ -Le vecteur pMJD-82. (Dowson Day et al, 1994) Ce vecteur a essentiellement été employé pour lexpression transitoire dans desplantes et dans des protoplastes.Afin doptimiser lefficacité dexpression du gène inséré au niveau de la cassette declonage, ce vecteur dispose des séquences "enhancer" du promoteur de la transcription35S du CaMV suivi du promoteur 35S proprement dit. Ces 2 éléments assurent unebonne transcription du gène dintérêt. Vient ensuite la séquence Ω du TMV, uneséquence qui stimule la traduction des gènes clonés en aval. Enfin, ce vecteur disposeégalement des séquences de terminaison de la transcription de la nopaline synthase. enhancer 35 S promoteur 35 S Nco I Pst I pMJD 82 ž Sal I Xba I 4,3 kb Bam HI Sma I Kpn I Sac I Amp r terminateur nos -Le vecteur pRT2-syn-LUC (Turner et al, 1994) promoteur Xho I 35 S x2 Sal I Pst I Not I cassette de Spe I pUC 19 Eco RV clonage Sac II pRT2-syn-LUC Nco I 5,4 kb luciférase terminateur 35 S150
  • 154. Matériel et méthodes______________________________________________________________________ Comme le plasmide précédemment décrit, pRT2-syn-LUC dispose de la séquencepromotrice de la transcription du CaMV, le promoteur est placé en amont du gènecodant pour la luciférase. Enfin, en aval de ce gène, on trouve la séquence terminatricede la transcription du RNA 35S du CaMV. 3-Milieux. Les bactéries sont cultivées à 37°C en milieu liquide ou solide LB (bactotryptone1%, extraits de levure 0,5%, NaCl 0,5%). Il peut être rendu solide par addition dagar[Difco] 1 %. Ce milieu est autoclavé durant 30 min à 110°C puis légèrement refroidi etadditionné de 50 µg/ml dampicilline. Lors des expériences de préparation de DNA plasmidique simple brin, lesbactéries sont cultivées dans le milieu 2xYT (bactotryptone 1,6%, extraits de levure 1%,NaCl 0,5%).II-Transformation des souches bactériennes et mise en culture. 1-Utilisation de Chlorure de Calcium. a.Préparation des bactéries compétentes. Un litre de milieu LB est ensemencé par une pré culture de 24 heures de bactériespuis incubé à 37°C sous agitation jusquà ce que la culture atteigne une DO570nm de 0,6.Elle est ensuite refroidie puis sédimentée par une centrifugation de 10 min à 3000 rpm.Les culots sont mis en suspension dans 330 ml de tampon Tris-CaCl2 (Tris-HCl 0,1 mMpH 7,5, CaCl2 50 mM), suspension qui est recentrifugée et dont le culot est repris par200 ml de ce même tampon. Les bactéries sont gardées un jour à 4°C puis récoltéescomme précédemment et remises en suspension dans 40 ml de Tris-CaCl2, en présencede glycérol 15%. Les bactéries ainsi rendues compétentes sont gardées à -20°C pendant1h30 puis stockées à -80°C. 151
  • 155. Matériel et méthodes______________________________________________________________________ b.Transformation. Après décongélation dans la glace, 50 µl de bactéries compétentes sont incubées à0°C pendant 30 min en présence de 150 µl de CaCl2 50 mM, 7 µl de TEN x5 (Tris-HCl50 mM pH 7,8, EDTA 5 mM, NaCl 500 mM) et 10 µl de mélange de ligation contenant2 à 100 ng dADN plasmidique. Les bactéries sont ensuite soumises à un choc thermiquede 2 min à 42°C puis 1 ml de milieu LB est ajouté. Après 30 min dincubation à 37°C,les bactéries ainsi transformées sont étalées sur milieu LB gélosé additionnédampicilline (50 µg/ml). Après une nuit à 37°C les colonies apparues sont analysées parla technique décrite dans le paragraphe A-II-3. 2-Transformation par électroporation a.Préparation des bactéries. Un litre de milieu LB est ensemencé par une pré culture bactérienne. Les bactériessont multipliées sous agitation à 37°C jusquà ce que la culture atteigne une DO570nm de0,2 à 0,4. La culture est refroidie puis sédimentée par centrifugation pendant 15 minutesà 4000 rpm. Le culot est lavé par 500 ml deau bidistillée stérile froide, centrifugé 15min à 4000 rpm, puis repris dans 20 ml de glycérol 10%. Finalement, les bactéries sontrécoltées comme précédemment, remises en suspension dans 2 à 3 ml de glycérol 10%et congelées, par fractions aliquotes, à -20°C avant dêtre stockées à -80°C . b.Transformation. La transformation est effectuée dans une cuve à électrodes espacées de 0,2 cm. LeDNA plasmidique (2 à 100 ng) est mis en présence de 40 µl de suspension bactérienneet incubé au froid environ 1 min. La cuve est placée dans lélectroporateur [BioRad] decapacité 25 µF et de résistance 200 Ω et une impulsion électrique de 12,5 kV/cm estappliquée avant dajouter 1 ml de milieu LB. Après 30 min dincubation à 37°C lesbactéries sont étalées sur milieu LB gélosé, additionné dampicilline (50 µg/ml). Aprèsune nuit à 37°C les colonies obtenues sont analysées par les techniques décrites dans leparagraphe A-II-3.152
  • 156. Matériel et méthodes______________________________________________________________________ 3-Caractérisation des clones par hybridation in situ. Les clones obtenus sont analysés par hybridation in situ suivant le protocole décritpar Maas en 1983. Les colonies sont repiquées sur milieu LB gélosé puis transférées surune membrane de nitrocellulose. Les bactéries sont lysées en plaçant la nitrocellulosedans une solution SDS 10% pendant 3 min suivi dun traitement dénaturant par uneseconde solution lysante 0,5 M NaOH et 1,5 M NaCl pendant 3 min. La nitrocelluloseest ensuite placée dans une solution neutralisante Tris-HCl M pH 7,5, NaCl 1,5 M etfixée par une irradiation UV à 254 nm de 120 mJ. Le papier est pré hybridé durant 10min dans 10 ml de tampon SSC x6 renfermant du Denhardts x1 (voir Tableau M-7) etdu DNA de sperme de hareng 0,1 mg/ml. Lhybridation est réalisée en rajoutant la sonderadioactive constituée par un oligonucléotide phosphorylé en présence dATP(γ) 32P(voir paragraphe A-V-4). Après 4 à 16 heures dhybridation à la température de fusionde loligonucléotide diminuée de 15°C, la nitrocellulose est lavée 3 fois dans du SSC x6à cette même température afin déliminer lexcès de sonde radioactive. La membrane estfinalement séchée et placée sous autoradiographie.III-Extraction et analyse de DNA plasmidique. 1-Minipréparation et maxipréparation Lextraction plasmidique est réalisée selon la méthode de Maniatis et al (1982)dont le protocole est résumé dans le Tableau M-1. Le DNA plasmidique peut être purifié sur gradient de chlorure de césium enprésence de bromure déthidium (BET) (Radloff et al, 1967) dans les conditionssuivantes : le DNA plasmidique en suspension dans 4,3 ml de Tris-HCl 10 mM pH 7,5,EDTA 1 mM est additionné de 4,7 g de chlorure de césium et de 50 µl de BET à10 mg/ml. Le DNA est ensuite centrifugé 4h à 65000 rpm dans un rotor verticalBeckman Vti 65 à 15°C (la centrifugation peut aussi se faire 16h à 55000 rpm). Labande la plus dense, qui correspond au DNA plasmidique, est récoltée sous lumière UV,diluée dans deux volumes deau et une partie du BET est éliminée en mélangeant cette 153
  • 157. Matériel et méthodes______________________________________________________________________solution avec un volume disopropanol. Après agitation et une courte centrifugation, laphase inférieure est récupérée et précipitée en présence dalcool. Après sédimentation, leDNA est redissous dans 400 µl de TNE puis est soumis à deux extractions phénoliques,suivies dun lavage à léther. Le DNA est ensuite précipité à léthanol et après lavage etséchage, il est ajusté à une concentration voisine de 1 µg/µl après lecture de laDO260nm. Minipréparation Maxipréparation Composition des solutions culture 2ml 250 ml bactérienne centrifugation 1 min à 10 000 rpm 5 min à 5000 rpm solution I Tris HCl 25 mM pH 8 + 100 µl 5 ml EDTA 10 mM agitation Glucose 50 mM solution II 200 µl 10 ml NaOH 200 mM Agitation douce et incubation pendant 1 min à température SDS 1 % ambiante solution III Acétate de K 3 M 150 µl 7,5 ml + agitation Acide acétique 5 M Centrifugation 2 min à 10 000 rpm 10 min à 4800 rpm filtration sur Miracloth précipitation avec 0,6 vol disopropanol culot repris dans 500 µl de Tris HCl 10 mM tampon TE EDTA 1 mM Extraction au phénol-chloroforme (v/v) centrifugation 5min à 10 000 rpm précipitation par 2 vol déthanol centrifugation 10 min à 10 000 rpm lavage à léthanol 70 % reprise du 4 ml culot dans du 150 µl éventuelle purification sur tampon TE gradient de Chlorure de césium Tableau M-1 : Méthode dextraction de DNA plasmidique154
  • 158. Matériel et méthodes______________________________________________________________________ 2-Analyse. a-Sur gel dagarose. Ces gels sont utilisés de manière analytique pour fractionner les fragments deDNA et pour déterminer leur taille. Le pourcentage dagarose varie de 0,8 à 4% suivantla taille des fragments à séparer. Lélectrophorèse a lieu en présence de tampon Tris-borate 100 mM pH 8,3 EDTA 2 mM (encore appelé TBE x1). Avant leur dépôt sur gel,les échantillons sont additionnés de tampon de charge encore appelé Blue Juice (0,04%LMP. agarose, Tris 50 mM pH 7,5 ; EDTA 100 mM pH 7,5 ; 10% glycérol ; 0,05%Bleu de Bromophénol). b-Sur gel de polyacrylamide après séquençage. Ces gels sont utilisés pour séparer les produits obtenus lors des réactions deséquençage de DNA ou de RNA. Le rapport acrylamide-bisacrylamide est de 19 pour 1et ces gels sont polymérisés en présence durée 7 M. La concentration de ces gels estgénéralement de 6% à 8% et leur composition est décrite dans le Tableau M-2. pourcentage 6% acrylamide 3,42 g bisacrylamide 0,18 g urée (8,3 M final 30 g eau distillée qsp 54 ml TBE x10 6 ml filtration millipore 0,22 µm persulfate dammonium 500 µl 10 % TEMED 50 µl Tableau M-2 : Composition des gels de séquence Les fragments de DNA sont chauffés 2 min à 90°C en présence de formamide80%, TBE x1 et des deux indicateurs de migration (à savoir le bleu de xylène cyanol et 155
  • 159. Matériel et méthodes______________________________________________________________________le bleu de bromophénol) avant dêtre refroidis rapidement dans la glace et chargés surgel. La migration seffectue à 55 W en présence de tampon TBE x1.156
  • 160. Matériel et méthodes______________________________________________________________________ U Bactéries BW313 U U dut- , ung- U U Infection par des phages M13 KO7 U U Hybridation avec un U oligonucléotide mutagène U U U Elongation U U Transformation de U Sure cells Figure M-1 : Principe de la mutagénèse dirigée selon Kunkel. 157
  • 161. Matériel et méthodes______________________________________________________________________IV-Préparation de DNA plasmidique simple brin uridylé et mutagénèse dirigéeselon la méthode de Kunkel (Figure M-1). 1-Culture. 200µl dune culture bactérienne BW313 contenant le plasmide recombinant sontutilisés pour inoculer 2 ml de milieu 2xYT additionné de 100µg/ml dampicilline etduridine à 25 µg/ml. Quand la culture entre en phase exponentielle de croissance,(DO550nm~0,5), 10 µl de phage helper M13K07 à 1011 phages/ml sont ajoutés à laculture placée sous forte agitation pendant 1 heure à 37°C. De cette culture, on prélève40µl pour ensemencer 10 ml de milieu 2xYT supplémenté dampicilline (100 µg/ml), dekanamycine (70 µg/ml) et duridine (0,25 µg/ml). La culture est ensuite placée une nuit à37°C sous forte agitation. 2-Purification du DNA simple brin. Les bactéries sont éliminées par deux centrifugations successives à 15000 rpm. LeDNA simple brin encapsidé est précipité durant 15 min à température ambiante enprésence dune solution de PEG 6000 à 5%, NaCl 0,625 M final puis il est sédimenté parune centrifugation de 15 min à 15000 rpm. Le DNA est remis en suspension dans 200 µlde tampon TE (Tris-HCl 10 mM pH 7,5 ; EDTA 1 mM) puis soumis à deux extractionsphénoliques suivies dun lavage à léther. Le DNA simple brin est alors précipité pardeux volumes déthanol en présence dacétate de sodium 0,3 M. Après centrifugation, leculot est lavé, séché et repris dans 20 µl de TE. La concentration en DNA simple brinest déterminée par mesure de la densité optique à 260 nm puis ajustée à 1 µg/µl. 3-Mutagénèse dirigée en utilisant des oligonucléotides modifiés (Zoller & Smith, 1982). Cette méthode permet dintroduire des modifications très précises sur unemolécule de DNA ; ces modifications peuvent être des délétions, des insertions ou desremplacements de nucléotides. Cette technique nécessite du DNA simple brin circulairedont lobtention a été décrite au paragraphe précédent.158
  • 162. Matériel et méthodes______________________________________________________________________ La première étape de la mutagenèse passe par la synthèse dun DNA hétéroduplexcirculaire. Pour cela, nous avons utilisé les conditions suivantes : oligonucléotide (20 à 30 nt) 10 pmoles DNA simple brin uridylé 5 pmoles tampon dhybridation x10 1 µl Tris HCl pH 7,5 200 mM MgCl2 200 mM NaCl 500 mM DTT 10 mM H2O qsp 10 µl 5 min à 37 °C Mix dhybridation 10 µl tampon délongation x10 1 µl Tris HCl pH 7,5 200 mM MgCl2 100 mM DTT 100 mM dNTP 10 mM 1 µl ATP 10 mM 1 µl T4 DNA ligase 1 unité T4 DNA polymérase 3 unités H2O qsp 20 µl 2 heures à 37 °C Le milieu de mutagénèse est utilisé tel quel pour transformer par électroporationdes bactéries Sure cells. Ces bactéries vont amplifier préférentiellement le brin nonuridylé de lhétéroduplex contenant la mutation introduite par lamorce. Les coloniesobtenues sont ensuite analysées par la méthode dhybridation in situ décrite auparagraphe A-II-3 en utilisant comme sonde loligonucléotide mutagéniqueradiomarqué.V-Techniques de sous clonage par lutilisation denzymes. 1-Digestion enzymatique. Les enzymes de restriction sont des enzymes bactériennes qui reconnaissentspécifiquement des séquences particulières sur le DNA. Elles coupent au niveau ou àproximité du site de reconnaissance en générant des extrémités franches ou cohésives 5ou 3 sortantes. Pour digérer 1 µg de DNA nous avons utilisé les conditions suivantes : 159
  • 163. Matériel et méthodes______________________________________________________________________ DNA à 1 µg/µl 1 µl Tampon x10 spécifique de lenzyme 2 µl Enzyme à 1 unité/µl 1 µl H2O qsp 20 µl La réaction seffectue en général pendant 1h à 37°C. Les résultats de la digestionsont visualisés sur gel dagarose et il est possible dextraire les fragments intéressants enréalisant une électroélution (paragraphe A-VII-1) ou en utilisant de lagarose à bas pointde fusion (LMP) (paragraphe A-VII-2). Lors de digestions de solutions de DNAcontenant des RNA totaux bactériens ou du RNA entraîneur, une addition de RNase A à10 µg/ml est préférable pour, par la suite, pouvoir visualiser de manière correcte leproduit des digestions. 2-Obtention dextrémités franches. Il est possible que le vecteur et linsert utilisé aient des extrémités incompatiblespour la réaction de ligation. Il est alors nécessaire de les rendre franches soit en ajoutantdes nucléotides complémentaires à une extrémité 5 sortante, soit en délétant lesnucléotides excédentaires dune extrémité 3 sortante. a-Cas dune extrémité 5 sortante. Lenzyme utilisée est le fragment de Klenow, obtenu après clivage protéolytiquede la DNA polymérase I dE. coli par la subtilisine (Jackobsen et al, 1974). Les activitéspolymérasique 5-3 et exonucléasique 3-5 sont conservées mais lactivitéexonucléasique 5-3 a été éliminée (Derbyshire et al, 1988). Cette enzyme est aussicouramment utilisée dans les expériences de clonage pour synthétiser le brincomplémentaire du cDNA. Les conditions que nous avons utilisées sont décrites ci-dessous : DNA 1 µg Tampon x10 5 µl Tris-HCl 200 mM pH 7,5 MgCl2 100 mM DTT 10 mM NaCl 500 mM160
  • 164. Matériel et méthodes______________________________________________________________________ dNTP 2 mM 1 µl Enzyme Klenow à 1 unité / µl 1 µl H2O qsp 50 µlLincubation se fait pendant 30 min à 37°C lorsque lon veut remplir un site derestriction.Lenzyme fonctionne dans une large gamme de températures de 15 à 37°C et dans lestampons habituels denzymes de restriction. b-Cas dune extrémité 3 sortante. Lenzyme utilisée est la T4 DNA polymérase qui possède une activité 3-5exonucléasique en absence de désoxyribonucléotides triphosphates et une activité 5-3polymérase en présence de désoxyribonucléotides triphosphates (Lehman, 1974). Lesconditions dutilisation de cette enzyme sont résumées ci-dessous : DNA 1 µg Tampon x10 1 µl Tris-acétate 330 mM pH 7,9 Mg-acétate 100 mM K-acétate 660 mM DTT 5 mM H20 qsp 10 µl T4 DNA Pol 3 u/µl 1 µlLincubation est effectuée 5 min à 20°C puis 1 µl dune solution 10 mM dNTP est ajoutéet la réaction poursuivie pendant 10 min à 37°C afin de déplacer léquilibre dans le sensde lincorporation. Il en résulte une création dextrémités franches. 3-Déphosphorylation. Cette technique permet de favoriser linsertion dun fragment de DNA enempêchant le vecteur de se refermer sur lui-même lors de létape de ligation. Lenzyme,la phosphatase alcaline dintestin de veau, élimine les phosphates 5 et 3 terminaux. Elleest thermostable et ne présente pas de spécificité étroite de tampon dutilisation, ce quirend son utilisation possible en même temps que lenzyme de restriction. Dans lesconditions de déphosphorylation, lenzyme est incubée 1 h à 37°C en présence de 161
  • 165. Matériel et méthodes______________________________________________________________________lenzyme de restriction puis 1h à 55°C à raison de 0,05 unités par µg de DNA. Lenzymeest éliminée par extraction phénolique. 4-Phosphorylation. Cette étape permet dajouter un phosphate (radioactif ou non) aux extrémités 5 delinsert. Elle est indispensable pour que la ligation ait lieu en présence dun vecteurdéphosphorylé. Lenzyme, la T4 polynucléotide kinase, utilise lATP comme cosubstrat. DNA 1 µg Tampon x10 5 µl Tris HCl 700 mM pH 7,5 MgCl2 100 mM DTT 50 mM ATP 5 mM T4 polynucléotide kinase 4 unités H2O qsp 50 µl La réaction se fait à 37°C pendant 30 min et est stoppée par extraction phénolique. Lorsquon désire préparer des sondes radioactives en utilisant desoligonucléotides, 10 ng sont marqués par 10 µCi dATP γ32P en présence de 10 unitésdenzyme dans un volume réactionnel de 10 µl pendant 30 min à 37°C avant dêtreutilisés tels quels dans les expériences dhybridation in situ. 5-Ligation. Lenzyme, la T4 DNA ligase, catalyse la formation dune liaison phosphodiesterentre les extrémités 3 OH et 5 P de molécules de DNA. Les conditions dutilisation sont les suivantes : Insert 100 ng Vecteur 100 ng BSA à 2 mg/ml 1 µl ATP 30 mM 1 µl Tampon x10 2 µl Tris-HCl 200 mM pH 7,5 MgCl2 200 mM DTT 100 mM Ligase à 1 unité / µl 1 µl162
  • 166. Matériel et méthodes______________________________________________________________________ H2O qsp 20 µl Si linsert et le vecteur possèdent des extrémités cohésives, la réaction est réaliséependant 4 h à 16°C ; si les extrémités sont franches, la réaction est faite pendant 16 h à4°C.VI-Amplification dun fragment de DNA par la technique de la PCR. 1-Principe de la méthode et conditions générales. Cette technique décrite depuis 1985 (Saiki et al, 1985 ; Mullis et al, 1986 ; Mullis& Faloona, 1987) et améliorée en 1988 (Saiki et al, 1988) permet lamplification in vitrodun fragment de DNA de manière exponentielle grâce à lutilisation de la DNApolymérase thermostable isolée de Thermus aquaticus (Chien et al, 1976). Elle nécessitelutilisation de deux amorces oligodésoxyribonucléotidiques flanquant la séquence àamplifier. La réaction se déroule sous forme de plusieurs cycles incluant une étape dedénaturation à 95°C, une étape dhybridation des amorces sur lun et lautre des brinsmatrice à une température proche de leur température de fusion suivie dune élongation à72°C dont la durée dépend de la taille du fragment à amplifier. Les conditions générales damplification en utilisant la Taq DNA polymérasecommercialisée par Eurogentec sont les suivantes : DNA (0,1 ng) 10 µl Oligonucléotide #1 40 ng Oligonucléotide #2 40 ng Tampon X10 10 µl Tris HCl pH 8,8 750 mM (NH4)2SO4 200 mM MgCl2 15mM Tween 20 O,1 % dNTP 10 mM 1 µl BSA 10 mg/ml 1 µl H2O qsp 100 µl Taq DNA Polymérase 1 unités/µl 1 µl Les tubes sont recouverts dhuile de paraffine dans le but déviter toute évaporationet placés dans le "thermocycler" (Perkin-Elmer Cetus) pour une série de 25 à 30 cycles. 163
  • 167. Matériel et méthodes______________________________________________________________________Ces cycles sont constitués dune suite dincubations successives de 30 sec à 95°Ccorrespondant à létape de dénaturation, de 30 sec à Tm -1°C pour lhybridation desamorces et de N sec à 72°C pour lélongation. La température dhybridation duneamorce est donnée par la relation suivante: Tm = 69,3+0,41x(%GC)-(650/taille amorce).Le temps délongation est déterminé en utilisant un temps moyen de 30 sec pouramplifier un fragment de 500 pb. 2-Cas particulier du RNA 2 du BNYVV. Dans le cas damplification de fragment de DNA de grande taille comme le produitde ligation du RNA 2, lutilisation de DMSO à une concentration de 6% permet deminimiser les structures secondaires et ainsi doptimiser la PCR. Dautre part, nousavons utilisé une DNA polymérase plus stable, la Tth DNA polymérase [Eurogentec]. DMSO 6 µl H2O 72 µl DNA 0,2 ng 5 µl oligonucléotide 1 2µg oligonucléotide 2 2µg tampon x10 10 µl dNTP 10 mM 3 µl BSA 10 mg/ml 2 µl Tth DNA polymérase 1 µl 94 °C pendant 30 sec 50 °C pendant 30 sec 72 °C pendant 6 min avec un incrément de 5 sec par cycle Le produit PCR est ensuite soumis à 2 extractions phénol/chloroforme puisprécipité et lavé à léthanol. Le DNA peut ensuite servir de matrice pour lobtention detranscrits infectieux en utilisant le protocole décrit dans le Tableau M-5.VII-Purification sur gel dagarose dun fragment de DNA obtenu par digestionenzymatique ou par PCR. 1-Par électroélution. La bande visualisée sous lumière UV est découpée du gel puis placée dans unboudin à dialyse en présence du tampon de migration TBE x1. Le boudin à dialyse estensuite soumis à un champ électrique de 65 mA pendant 30 à 45 min puis à une164
  • 168. Matériel et méthodes______________________________________________________________________inversion de polarité de 30 secondes pour décrocher les éventuels fragments présents surla membrane à dialyser. Le tampon contenant le DNA électroélué est récupéré, soumis àune extraction phénolique suivie dune extraction au phénol-chloroforme et duneprécipitation à léthanol en présence ou non dun entraîneur (tRNA ou glycogène). 2-Par extraction dun gel LMP. Des fragments de DNA peuvent être facilement extraits de gels LMP présentant laparticularité de fondre dès 65°C. Les bandes de DNA sont découpées du gel aprèsvisualisation sous UV puis chauffées 5 min à 65°C en présence de 200 µl de Tris-HCl200 mM pH 7,5, EDTA 1 mM, NaCl 200 mM. Le DNA est extrait commeprécédemment.VIII-Séquençage selon la méthode de Sanger, modifiée pour la T7 DNA polymérase. 1-Séquençage dun DNA plasmidique. Cest une méthode enzymatique basée sur la synthèse interrompue de moléculesplus ou moins longues de DNA. La T7 DNA polymérase est capable dallongerlextrémité 3 dune amorce oligodésoxyribonucléotidique hybridée à un DNA simplebrin en présence des quatre désoxyribonucléotides triphosphates (dNTP). Elle peut aussiincorporer des didésoxyribonucléotides triphosphates (ddNTP) à la place des dNTP. CesddNTP nayant pas de groupement hydroxyl en 3 du ribose ne permettent plus laformation de la liaison phosphodiester et il sen suit un blocage de lélongation demanière statistique. Le séquençage est réalisé en deux étapes. La première consiste enun marquage des molécules néosynthétisées et la seconde permet lélongation desmolécules marquées. Le DNA double brin à séquencer provient soit de minipréparations de plasmidessoit de DNA plasmidique purifié par gradient de chlorure de césium. Le DNA est dansun premier temps dénaturé et débarrassé des éventuels RNA par traitement à la soude0,2 M finale pendant 5 min. Dans un second temps, il est passé sur une colonne de 165
  • 169. Matériel et méthodes______________________________________________________________________sépharose 6C-LB [Pharmacia] (pré-équilibrée avec du tampon Tris 10 mM pH 7 ;EDTA 1 mM) pour éliminer les molécules de petites tailles. La matrice de DNA simplebrin est ensuite hybridée à lamorce oligodésoxyribonucléotidique avant de réaliser lesétapes de marquage et délongation comme décrit dans le tableau M-3. Dénaturation DNA (5 µg) 80 µl incubation 5 min. à température ambiante NaOH 10 N 2 µl purification et neutralisation par gel filtration sur colonne de Sepharose 6 C-LB (équilibrée en tampon Tris-HCl 10 mM pH 7, EDTA 1mM) Hybridation DNA dénaturé 7 µl incubation 5 min à 37°C Amorce 20 ng/µl 1 µl Tampon dhybridation x5 2 µl Tris-HCl 200 mM pH7,5 MgCl2 100 m NaCl 250 mM Marquage Mélange dhybridation 10 µl incubation 5 min à 0°C DTT 0,1 M 1 µl dGTP, dTTP, dCTP 2 µl (1,5 µM chaque) α35 S- dATP 10 µCi/µl 1 Ci/mole 0,5 µl T7 DNA polymérase 2 µl 2 unités/µl Elongation Mélange de marquage 3,5 µl incubation 10 min à température ambiante Mélange de terminaison 2,5 µl dATP 80 µM dTTP 80 µM dGTP 80 µM dCTP 80 µM NaCl 50 mM un ddNTP 8 µM Arrêt de la par 4 µl de solution dénaturante (formamide 95%, EDTA 20 mM, réaction xylène cyanol 0,05%, bleu de bromophénol 0,05%). Les échantillons sont chauffés 2 min à 95°C avant dêtre déposés sur gel de polyacrylamide dénaturant. Tableau M-3: Protocole de séquençage166
  • 170. Matériel et méthodes______________________________________________________________________ 2-Séquençage dun produit PCR. Le produit PCR obtenu suivant le protocole décrit dans le paragraphe A-VI-1 estdans un premier temps purifié sur un gel dagarose LMP (voir paragraphe A-VII-2).Après extraction, le culot est repris dans 7 µl deau. Le DNA est mélangé avec 5 ng deloligonucléotide qui va permettre le séquençage, chauffé pendant 5 min à 95 °C,chauffage qui est suivi dune congélation instantanée dans de lazote liquide. 2 µl detampon dhybridation (Tableau M-3) sont ajoutés et le tout est laissé à décongelerlentement à température ambiante. Après cette première étape dhybridation, la réactionde séquençage continue comme décrit dans le Tableau M-3 avec le marquage.IX-Transcription in vitro. 1-Obtention de transcrits infectieux du BNYVV. La transcription est réalisée en présence de m7GpppG [Pharmacia] encore appelécap et permet donc dobtenir des transcrits néosynthétisés avec un groupementm7GpppG à leur extrémité 5. Au premier temps de la transcription, la concentration enrGTP (0,625 mM) est faible afin de favoriser lincorporation de cap (10 mM) en 5.Après 30 min de réaction, on rajoute une quantité de rGTP 10 mM analogue aux autresrNTP permettant ainsi lallongement des chaînes néosynthétisées. La transcription se faità 37°C. Les conditions que nous avons utilisées pour la synthèse de RNA coiffés ou non àleur extrémité 5 sont résumées dans le Tableau M-4. En fin de réaction, lefficacité de la transcription peut être vérifiée de différentesmanières. Les transcrits peuvent être visualisés directement en conditions natives, parélectrophorèse en gel dagarose 1% puis coloration au BET. Ils peuvent également êtreanalysés en conditions dénaturantes par la technique dhybridation moléculaire décriteau paragraphe A-X. Enfin, lanalyse peut se faire par coloration au bleu dorthotoluidine0,05% dans de lacétate de Na 1 mM, acétate de Mg 0,1 mM pH 5,5 et décoloration danslacide acétique 1%. 167
  • 171. Matériel et méthodes______________________________________________________________________ Finalement, les propriétés biologiques des transcrits sont étudiées soit parinoculation de protoplastes de C. quinoa dans les conditions décrites au paragraphe C-IV-6 soit par inoculation mécanique de feuilles de C. quinoa avec 20 µl du milieu detranscription dilué à 200 µl final avec de leau bidistillée stérile et en présence demacaloïd 0,5%. Chaque feuille est inoculée avec 50 µl de ce mélange. Sondes - Cap + Cap ribonucléiques Tampon x5 (BRL) Tris-HCl pH 8 200 mM MgCl2 50 mM DTT 50 mM 60 µl 5 µl 3 µl NaCl 50 mM BSA 250 µg/ml Spermidine 20 mM m 7G 5PPP 5G 15 mM 1 µl RNasine 40 unités/µl 4 µl 1 µl 1 µl H2O qsp 300 µl qsp 25 µl qsp 15 µl DNA linéarisé 1 mg/ml 100 µl 1 µl 1 µl ATP 10 mM 30 µl 1 µl 1 µl CTP 10 mM 30 µl 1 µl 1 µl UTP 10 mM 30 µl 1 µl GTP 10 mM 30 µl 1 µl UTP 0,5 mM 1 µl GTP 0,625 mM 1 µl 32 (α P) UTP 20 µCi/µl 2 µl RNA polymérase 50 unités/µl 10 µl 1 µl 1 µl Incubation à 37°C 2 heures 30 min 1 heure GTP 10 mM 1 µl Incubation à 37°C 2 heures DNase RNase free 10 unités/µl 2 µl +/- 1 µl 1 µl Incubation à 37°C 30 min Tableau M-4 : Conditions de transcriptions168
  • 172. Matériel et méthodes______________________________________________________________________ 2-Synthèse de sondes ribonucléiques Les sondes ribonucléiques sont obtenues par transcription in vitro des fragmentsde cDNA clonés dans le vecteur Bluescribe en présence dUTP (α32P) suivant leprotocole décrit dans le Tableau M-4. Le traitement du milieu de transcription à laDNase permet déliminer le DNA matrice afin quil ninterfère pas lors de lhybridation.X-Analyse des transcrits par hybridation in situ 1-Séparation des RNA par migration sur gel dagarose en conditions dénaturantes. Cette méthode est, elle aussi, basée sur la détection de RNA par hybridation aumoyen de sondes spécifiques radioactives, après séparation des RNA par électrophorèseet transfert sur nitrocellulose. Elle peut être appliquée à des RNA totaux de plantesinfectées et permet également danalyser la qualité des produits de transcription utiliséspour les inoculations lors des tests biologiques. Les RNA sont dénaturés et analysés parélectrophorèse en gel dagarose dans les conditions décrites dans les tableaux M-5 et M-6 (Rave et al, 1979). Agarose 1, 7 g 0, 3 g Hepes pH 7, 8 200 mM 17 ml 3 ml EDTA 10 mM H2O 125 ml 22 ml Fondre lagarose puis équilibrer la température à 50°C Formaldéhyde 36% 28 ml 4.86 ml Tableau M-5: Composition des gels dagarose dénaturants 169
  • 173. Matériel et méthodes______________________________________________________________________ Les échantillons sont dénaturés durant 5 min à 65°C avant dêtre déposés sur gelen présence de 5 µl de tampon de charge composé de glycérol 50% et de bleu debromophénol. La migration est effectuée dans du tampon Hepes 20 mM pH 8, EDTA1 mM. Les analyses sont effectuées en général sur 20 ng de transcrits ou 300 ng de RNA170
  • 174. Matériel et méthodes______________________________________________________________________Figure M-2: Schématisation de la pyramide de transfert salin utilisée lors desexpériences dhybridation moléculaire par la technique du Northern Blot. 171
  • 175. Matériel et méthodes______________________________________________________________________totaux de plante. Le transfert des RNA sur feuille de nitrocellulose (Schleicher &Schüell) est réalisé par la méthode du transfert salin dans du tampon SSC x20 durant 16h (voir figure M-2). Les acides nucléiques sont ensuite fixés irréversiblement sur lanitrocellulose par une irradiation de 120 mJ à 254 nm (UV). RNA 0, 5 µg Hepes pH 7, 8 200 mM 2, 5 µl EDTA 10 mM Formamide 12, 5 µl Formaldéhyde 36% 4 µl H2O qsp 25 µl Chauffage 5 min à 65°C Glycérol 50%, bleu de bromophénol 0, 05% 5 µl Tableau M-6: Conditions de dénaturation des RNA avant dépôt sur gel 2-Hybridation avec des sondes spécifiques radioactives. a-Préparation des sondes. (voir Tableau M-4) b-Préhybridation. La feuille de nitrocellulose préhydratée est mise à préhybrider pendant 2 h à 60°Cdans le tampon dont la composition est donnée dans le tableau M-7. c-Hybridation. Au milieu de préhybridation sont ajoutées 5 µl de sonde ribonucléique hautementradioactive et lhybridation est effectuée pendant 16 h à 55°C sous agitation. d-Lavages et autoradiographie. Après 16 h dincubation et afin déliminer toutes les hybridations aspécifiques avecles RNA ribosomiques de plante, la feuille de nitrocellulose est lavée deux fois à 65°C172
  • 176. Matériel et méthodes______________________________________________________________________avec une solution de SSC x2, SDS 0,1% puis deux fois à 65°C avec du SSC x0,2, SDS0,1%. Finalement, la feuille de nitrocellulose séchée est placée sous autoradiographie. Composition du tampon de préhybridation Volume Concentration finale Formamide 5 ml 50% SSC x20 * 2,5 ml 5x Denhardts x100 ** 0,8 ml 8x NaH 2PO4 /Na 2HPO pH 6,5 4 1M 0, 5 ml 50 mM SDS 20% 50 µl 0,1% RNA total de levure 25 mg/ml 200 µl 500 µg/ml DNA de sperme de hareng 2,5 mg/ml 1 ml 250 µg/ml Composition du tampon dhybridation Tampon de préhybridation 10 ml Sonde ribonucléotidique 5 µl * SSC x20 : Citrate de sodium 0,3 M pH 7; NaCl 3M. ** Denhardts x100 : BSA 2% ; Ficoll 2% ; Polyvinylpyrrolidone 2%. Tableau M-7 : Composition des tampons de préhybridation et dhybridationXI-Analyse de la descendance par réverse transcription. Afin danalyser la descendance de RNA transcrits inoculés à des plantes, nousavons, dans un premier temps, synthétisé le cDNA correspondant. Dans un secondtemps, ce cDNA est amplifié par la réaction de PCR (paragraphe A-VI) et finalementséquencé comme cela a été décrit dans le paragraphe A-VIII-2. Pour obtenir le cDNA,nous avons utilisé la réverse transcriptase extraite du virus de la leucémie murine deMoloney commercialisée par Promega dans les conditions suivantes : H2O 16 µl Oligonucléotide complémentaire 5 ng Tampon RT x5 5 µl Tris HCl pH 7,5 250 mM DTT 50 mM KCl 375 mM MgCl2 15 mM RNA total (0,2 mg/ml) 1 µl 15 min à 37 °C DTT 0,1 M 1 µl dNTP 10 mM 1µl RT MoMuLV (200 u/µl) 1 µl 173
  • 177. Matériel et méthodes______________________________________________________________________ 1 heure à 37 °CB-EXPRESSION IN VIVO OU TRADUCTION IN VITRO DES PROTEINES DEBNYVVI-Expression de protéines dans un système bactérien (Studier et al, 1990). Une pré culture de 2 ml de bactéries BL 21 pLys S est utilisée pour ensemencer500 ml de LB additionné dampicilline à 50 µg/ml et de chloramphénicol à 34 µg/ml.Les bactéries sont mises à croître à 28 °C jusquà ce que la culture atteigne une DO550nmde 0,6 à 1. A ce stade, la synthèse de T7 RNA polymérase est induite par de lIPTG à uneconcentration de 0,2 g/l. Cette induction va se faire pendant 2 heures à 28 °C, périodedurant laquelle il y aura une synthèse massive de la protéine désirée. Les bactéries sontensuite sédimentées par une centrifugation de 15 min à 6000 rpm. Le culot est reprisdans un tampon SB (50 mM NaH2PO4, 300 mM NaCl), puis, à 2 reprises, congelé dansde lazote liquide et décongelé à 37 °C, cette dernière étape ayant pour but de lyser lesbactéries. Le DNA libéré est fragmenté par sonication puis éliminé par centrifugation à4800 rpm pendant 15 min. Le surnageant récupéré est analysé sur gel de polyacrylamideen conditions dénaturantes comme décrit dans le paragraphe B-IV.II-Purification par chromatographie daffinité sur une colonne ZCAA (Zinc ChelateAffinity Adsorbent). La colonne ZCAA [Boehringer] est composée dune matrice dagarose surlaquelle sont fixés des ions Zinc (0,1 mg de Zn2+/ml) . Ces ions sont chélatés par unligand dacide iminoacétique lui même lié par un bras de 4 carbones au gel dagarose(Porath et al, 1975) CH2 -COOH Agarose-O-CH 2-CHOH-CH2 -O-(CH 2)4 -O-CH 2-CH-CH 2-N CH2 -COOH OH174
  • 178. Matériel et méthodes______________________________________________________________________ Les protéines déposées sur la matrice et qui ont une affinité pour le zinc restentfixées sur la colonne, tandis que les autres passent dans le volume mort. Les protéinesainsi fixées peuvent ensuite être éluées par des lavages avec des tampons ajustés à despH variables (de 8 à 5 par exemple) ou des concentrations en sels variables. Lesprotéines récupérées sont finalement analysées comme décrit dans le paragraphe B-IV.III-Traduction in vitro dans un système acellulaire de réticulocytes de lapins. 1-Préparation du lysat de réticulocytes de lapins. Le bruit de fond traductionnel dû aux messagers endogènes peut être limité entraitant le lysat à la nucléase micrococale (Pelham & Jackson, 1976). Cette enzyme dontlaction est dépendante des ions calcium peut ensuite être spécifiquement inhibée parladdition dEGTA en excès. Le lysat est ensuite supplémenté en tRNA et enaminoacides suivant les conditions résumées dans le Tableau M-8. Quantité ajoutée concentration finale Composé (µl) à 1 ml de lysat dans le milieu de traduction Hémine 1 mM 35 20 µM Créatine kinase 10 mg/ml 30 0,17 mg/ml Créatine phosphate 20 mM 90 10 mM Hepes-KOH pH 7, 5 500 mM 55 15 mM DTT 200 mM 20 2,2 mM CaCl 2 100 mM 14 0,8 mM Nucléase micrococale 1 mg/ml 14 8 µg/ml Incubation 15 min à 20°C EGTA-KOH 500 mM 12 3,25 mM tRNA foie de veau 10 mg/ml 15 83 µg/ml Amino acides sauf Met 1 mM 190 105 µM Tableau M-8 : Préparation de lysat de réticulocytes de lapins. 175
  • 179. Matériel et méthodes______________________________________________________________________ Le lysat est réparti en fractions de 100 µl immédiatement congelées dans un bainde carboglace/éthanol et conservées dans de lazote liquide. 2-Traduction des produits de transcriptions. Il reste à ajouter au lysat traité des sels de magnésium et de potassium, laméthionine radioactive et le RNA messager. Différentes concentrations dacétate demagnésium et de potassium ont été testées afin doptimiser la traduction des RNA duBNYVV. Les conditions retenues sont les suivantes : Lysat 100 µl Acétate de Mg 1 mM final Acétate de K 1,6 mM final Méthionine S35 (10 mCi/ml) 0,5 mCi/ml final (1500 Ci/mmol)9,5 µl de ce mélange de traduction sont additionnés d1 µl de RNA (0,5 à 1 mg/ml) etincubés une heure ou plus (suivant la taille de la protéine à synthétiser) à 30°C. Lesproduits de traduction sont ensuite analysés sur gel de polyacrylamide en conditionsdénaturantes (voir paragraphe B-IV).IV-Analyse. 1-Par électrophorèse en conditions dénaturantes sur gel de polyacrylamide. Les protéines obtenues par traduction in vitro ou par purification à partir decultures bactériennes sont analysées par électrophorèse sur gel de polyacrylamide enprésence de SDS. Pour cela on utilise un gel qui fait intervenir un système de tamponsdiscontinus décrit par Laemmli (1970) et qui permet de concentrer les échantillons enune bande très fine dans un "gel de concentration" puis de séparer les protéines selonleur poids moléculaire dans un "gel de séparation". Le tableau M-9 donne lacomposition des gels. Avant dépôt, les protéines sont dénaturées par addition dun volume égal detampon de charge x2 (Tris HCl pH 6,8 125 mM, SDS 5 %, Glycérol 20 %, ß176
  • 180. Matériel et méthodes______________________________________________________________________mercaptoéthanol 5 % et bleu de bromophénol 0,05 %) et chauffés à 90 °C pendant cinqminutes. Après une électrophorèse dans un tampon Tris HCl pH 8,3 25 mM ; Glycine192 mM ; SDS 0,1 % à 100 volts (20 à 30 mA), le gel est fixé dans un bain déthanol à25% et dacide acétique à 10%. Les protéines sont ensuite révélées au bleu deCoomassie (0,5 g/l dans le mélange de fixation), le gel est décoloré par de lacideacétique à 10% puis séché sous vide à 80 °C et enfin placé sous autoradiographie. gel de résolution gel de composants concentration 8% 10 % 11 % 12,5 % 15 % Acrylamide 4% 8% 10 % 11 % 12,5 % 15 % bisacrylamide 0,1 % 0,20 % 0,25 % 0,27 % 0,31 % 0,37 % Tris HCl pH 6,8 0,125 M Tris HCl pH 8,8 0,375 M 0,375 M 0,375 M 0,375 M 0,375 M SDS 0,1 % 0,1 % 0,1 % 0,1 % 0,1 % 0,1 % TEMED 8 µl 10 µl 10 µl 10 µl 10 µl 10 µl persulfate 25 % 40 µl 50 µl 50 µl 50 µl 50 µl 50 µl Tableau M-9 : Composition des gels de polyacrylamide en conditions dénaturantes 2-Par immunorévélation après transfert. a- Principe. La technique consiste à séparer les protéines dun extrait de plante virosée ou deprotoplastes sur gel de polyacrylamide dénaturant puis à les transférer sur unemembrane de nitrocellulose par électrotransfert. La révélation dune protéine particulièreest ensuite réalisée à laide danticorps spécifiques de cette protéine. b- Séparation des protéines par électrophorèse et transfert sur un support de nitrocellulose. 177
  • 181. Matériel et méthodes______________________________________________________________________ Une dizaine de lésions locales découpées à partir dune feuille viroséesont finement broyées en présence de 50 µl de tampon de charge x2 et de 50 µl deau.178
  • 182. Matériel et méthodes______________________________________________________________________ Composition du tampon délectrotransfert de protéines Tris-HCl pH 8,3 25 mM Glycine 192 mM Ethanol 20 % Figure M-3 : Schéma du système délectrotransfert de protéines sur nitrocellulose. Composition du tampon utilisé. 179
  • 183. Matériel et méthodes______________________________________________________________________ Lensemble est centrifugé 10 min à 6 000 rpm et 10 µl du surnageant sontdéposés sur un gel dénaturant 10% à 15% (voir Tableau M-9) et soumis à uneélectrophorèse à 100 volts en présence du tampon délectrophorèse. Après migration, lesprotéines sont transférées sur nitrocellulose [BA 85 Schleicher-Schüell] selon ledispositif schématisé dans la figure M-3. Le montage et le transfert (80 volts, 40 min)sont réalisés dans du tampon de transfert puis la nitrocellulose est séchée à 37°Cpendant 10 minutes. Lanalyse de protéines extraites de protoplastes se fait de manière analogue. 70000 protoplastes infectés sont sédimentés puis additionnés de 20 µl de tampon de chargeet déposés sur gel. c- Réaction immunologique (voir Tableau M-10). étape réactif tampon durée Dilution de lantisérum de PBS 2 heures à température Incubation du lapin Tween 20 1% ambiante ou une nuit à 1er anticorps dirigé contre la protéine Lait en poudre 5% 4°C étudiée (au 20000ème). PBS Lavages 3 fois 10 min Lait en poudre 5% IgG de chèvre anti IgG de lapin PBS Incubation du 2 heures à température couplées à la phosphatase Tween 20 1% 2nd anticorps ambiante alcaline (au 2000ème) Lait en poudre 5% PBS 2 fois 10 min Tween 20 1% Lavages Diéthanolamine-HCl 2 fois 10 min 0,1 M pH 9,6 B.C.I.P. 50 µg/ml Diéthanolamine-HCl 10 min à 1 heure Révélation 0,1 M pH 9,6 N.B.T. 100 µg/ml à température ambiante MgCl 2 1 mM PBS : 150 mM NaCl ; 1,5 mM KH PO ; 7,9 mM Na HPO ; 2,7 mM KCl ; pH 7,4 2 4 2 4 B.C.I.P. : 5-bromo 4-chloro 3-indolyl phosphate sel disodique N.B.T. : Nitro blue tetrazolium chlorid monohydrat180
  • 184. Matériel et méthodes______________________________________________________________________ Tableau M-10 : Immunodétection de protéines après transfert sur membrane de nitrocellulose La nitrocellulose est lavée dans du tampon PBS-Tween pH 7,4 (NaCl 150 mM,KH2PO4 1,4 mM, Na2HPO4 10 mM, KCl 2,7 mM, Tween 20 1%). Elle est ensuitetraitée comme décrit dans le tableau M-10. Les complexes antigènes-anticorps sont révélés par addition du substrat de laphosphatase alcaline, le 5-Bromo-4-Chloro-3-Indolyl-Phosphate sel dissodique (BCIP)0,005%. Lélimination du phosphate permet la formation dun complexe coloré en violetavec le Nitro Blue Tetrazolium Chlorid Monohydrat (NBT) 0,01%. Cette action de laphosphatase se fait dans du tampon diéthanolamine 100 mM pH 9,6, MgCl2 1 mM.V-Etude de lactivité fixatrice dune protéine par Northwestern. (Gramstat et al, 1990) Un extrait de protéines bactériennes ou des protéines purifiées sont séparés parélectrophorèse en conditions dénaturantes sur gel de polyacrylamide 12,5 ou 15% puistransférés sur nitrocellulose pendant 40 min à 80 V. Les protéines fixées sont renaturéespar deux lavages de la nitrocellulose pendant 15 min dans une solution durée 6 M,NP40 0,1% puis par deux immersions de 30 min dans le tampon Tris-HCl 10 mM pH 8,NaCl 50 mM, EDTA 1 mM, Denhardts x1. La membrane de nitrocellulose est ensuiteincubée dans le même tampon pendant 1 heure à 20°C avec 10 µl de RNAradiomarquée au 32P (5.105 cpm en général). Deux lavages de 30 min dans du tamponTris-HCl 10 mM pH 8, EDTA 1 mM, NaCl 200 mM sont effectués puis lanitrocellulose est séchée et autoradiographiée.C-MULTIPLICATION DU VIRUS DANS UNE PLANTE HOTE :CHENOPODIUM QUINOA.I-Plante hôte. La gamme dhôtes naturels du BNYVV est relativement restreinte (Kuszala &Putz, 1977) et est constituée principalement par des plantes appartenant à la famille des 181
  • 185. Matériel et méthodes______________________________________________________________________Chénopodiacées telles que lépinard, les betteraves ou les chénopodes. Au laboratoire,nous utilisons essentiellement Chenopodium quinoa, une plante répondant à uneinoculation mécanique par des lésions chlorotiques locales pouvant diffuser le long desnervures des feuilles.II-Préparation du virus. Linoculation est réalisée en frottant les feuilles par un broyât de feuilles virosées,broyât effectué dans du tampon KH2PO4 20 mM pH 7,5 et en présence dun abrasif, lacélite. Après huit à dix jours de virose, les feuilles inoculées sont récoltées et broyéesdans du tampon borate de sodium 100 mM pH 9 additionné de tétrachlorure de carbonedans des proportions respectives de 170 ml et 100 ml pour 100 g de feuilles. Le broyâtest ensuite clarifié par une centrifugation de 30 min à 8000 rpm et filtré sur Miracloth.Le virus est précipité par addition de 0,8% NaCl et 2% PEG 6000 pendant 5h à 4°Csous agitation douce, puis il est sédimenté par une centrifugation de 20 min à 12000 rpmet remis en suspension dans 100 ml de tampon borate de sodium 10 mM pH 9. Uneseconde précipitation PEG/NaCl est effectuée et le culot est remis en suspension dans30 ml de tampon borate de sodium 10 mM pH 9 puis ultra centrifugé à travers 7 ml duncoussin de saccharose 20% pendant 2 h à 35000 rpm. Le culot de virus est finalementremis en suspension dans 3 ml de tampon borate de sodium 10 mM pH 9. Lesrendements moyens dextraction dépassent rarement 20 µg de virus par gramme defeuilles.III-Extraction de RNA viraux à partir de feuilles de C. quinoa. 1-En présence de tampon "polysome" (Jackson & Larkins, 1976) Afin de pouvoir analyser la descendance de transcrits initialement inoculés surplante hôte, des feuilles de plantes virosées ou saines sont broyées au froid dans dutampon "polysomes" (5 ml de tampon par gramme de feuille). La forte force ionique, lepH alcalin et la présence dEGTA, un chélateur spécifique de cations divalents182
  • 186. Matériel et méthodes______________________________________________________________________permettent de garder les RNA intacts et en particulier les RNA viraux quils soientencapsidés ou non. La composition du tampon "polysome" est la suivante : Tris-HCl pH 9 200 mM KCl 400 mM MgCl2 35 mM EGTA 25 mM Saccharose 200 mM Le broyât obtenu est soumis ensuite à deux extractions phénoliques et à un lavageà léther. Les acides nucléiques totaux sont ensuite précipités par deux volumesdéthanol. Après centrifugation, le culot est repris dans lacétate de sodium 3 M pH 6afin de solubiliser le DNA et les petits RNA (tRNA et RNA 5S). Les RNA messagers,ribosomiques et viraux insolubles sont récupérés par sédimentation, remis en suspensiondans de leau bidistillée stérile et précipités une seconde fois à léthanol. Aprèscentrifugation et lavage à léthanol 70%, ils sont dissous dans de leau bidistillée stérileet quantifiés par spectrophotométrie. Lanalyse des RNA viraux est ensuite réalisée parhybridation moléculaire. 2- En présence de tampon Tris-Magnésium. Le principe de cette extraction repose sur la protection spécifique des RNA virauxencapsidés vis à vis de laction des nucléases libérées lors du broyage du matérielvégétal. Le tampon Tris-MgCl2 utilisé (encore appelé tampon TM) favorise laction desRNases. Les feuilles sont broyées au froid, à raison de 5 ml de tampon par gramme defeuille. Après élimination des débris cellulaires par une courte centrifugation, lessurnageants sont incubés à 37°C pendant 30 min pour favoriser la dégradation des RNAviraux non encapsidés. Les acides nucléiques totaux sont ensuite purifiés commeprécédemment (paragraphe C-III-2). 183
  • 187. Matériel et méthodes______________________________________________________________________IV-Préparation, inoculation et mise en culture de protoplastes. 1-Préparation des protoplastes (Veidt et al, 1992). Les protoplastes sont isolés à partir de Chenopodium quinoa âgés de quatresemaines. Seules les deuxièmes feuilles après les cotylédons sont utilisées. Afin defaciliter le contact des feuilles avec lagent désinfectant (eau de Javel), celles ci sonttrempées pendant cinq secondes dans de léthanol 70% puis stérilisées cinq minutes dansde leau de Javel 1,25%. Finalement, elles subissent trois lavages successifs de cinqminutes dans un grand volume deau stérile. Débarrassées de leau de Javel, les feuillessont alors dilacérées en fines bandelettes de 1 mm de large environ. Les lamellesobtenues sont plasmolysées dans du mannitol 0,6 M pH 5,6, CaCl2 0,1 mM (milieu A).Puis elles sont soumises à une digestion enzymatique dans le milieu A additionné decellulase 1,5 % et de macérozyme 0,3% (ce milieu est stérilisé par filtration sur filtremillipore). Cette étape permet la digestion de la paroi pectocellulosique et après 2h30 à3h dincubation à 30°C, la libération des protoplastes est vérifiée par observation aumicroscope optique. Si ce nest pas le cas, lincubation est poursuivie avec une légèreagitation. Sil apparaît des protoplastes libres, toutes les lamelles de feuilles sont récupéréesà laide dune pipette à bout large et déposées sur un filtre stérile ayant une réticulationde 100 µm. Le filtrat est centrifugé pendant 5 min à 700 rpm et le culot de protoplastesest repris par une agitation très douce dans le milieu A. Cette opération est répétée troisfois afin déliminer le maximum de débris cellulaires, chloroplastiques ainsi que le restedes enzymes de digestion. Une fraction aliquote du dernier lavage est prélevée etpermettra de dénombrer les protoplastes obtenus, le comptage se faisant grâce à unecellule de Fuchs-Rosenthal ou une cellule de Mallassez. La concentration est amenée à400 000 protoplastes/ml puis la suspension est placée à 4°C pendant quelques heures. 2-Infection des protoplastes par des acides nucléiques (RNA de BNYVV ou DNA plasmidique) et mise en culture.184
  • 188. Matériel et méthodes______________________________________________________________________ Les acides nucléiques sont introduits dans les protoplastes par la techniquedélectroporation. Deux cent mille protoplastes (0,5 ml de la suspension stock) sont misen présence de 1 µg des RNA viraux 1 et 2 (souche Stras 12), ou 10 µg de transcrits duRNA 1 et 5 µg de transcrits RNA 2, ou encore de 5 µg de DNA plasmidique. Ils sontsoumis à une décharge électrique de 450 V/cm (100 W, 125 µF) pour les RNA et de 750V/cm pour les DNA dans une cuve délectroporation ayant des électrodes distantes de0,4 cm. On récupère les protoplastes dans 1 ml de milieu A et la suspension est incubéeà 0°C pendant 20 min afin de stabiliser les membranes. Les protoplastes sont ensuitecentrifugés à 1000 rpm pendant 2 min. Le culot de protoplastes est doucement remis ensuspension dans un milieu de survie encore appelé milieu B (KH2PO4 0,2 mM, KNO31 mM, MgSO4 1 mM, CaCl2 5 mM, KI 1 µM, CuSO4 10 nM et mannitol 600 mM)additionné dun agent bactériostatique : la carbénicilline à 0,25 mg/ml. La mise enculture se fait à 24°C dans une chambre à lumière diffuse (1000 lux) avec 16h delumière et 8h dobscurité. Des cinétiques dinfection ont montré que la multiplication duvirus est maximum au bout de 48h de culture. Cependant, pour mettre en évidence lesbrins moins, nous avons aussi extrait les RNA après 36 heures de culture ; pour lesexpériences dexpression transitoire, 24 heures de culture sont suffisantes.V-Extraction des RNA viraux de protoplastes. Les protoplastes, délicatement transférés dans un tube Eppendorf, sont centrifugés2 min à 1000 rpm, puis le surnageant est éliminé et le culot congelé à -20 °C puis remisen suspension dans un tampon dextraction contenant du Tris-HCl 50 mM pH 7,5, delEDTA 1 mM, du SDS 1% et du macaloïd 0,03%. Suivent alors deux extractions auphénol-chloroforme (v/v) et le surnageant est mélangé à un volume de LiCl 4M afin deprécipiter spécifiquement les RNA. Après agitation, le tube est placé à 0°C pendant 2h.Les RNA sont sédimentés par centrifugation puis lavés à léthanol 70% et repris dans 10µl deau bidistillée stérile avant dêtre analysés par Northern Blot comme décrit dans leparagraphe A-X 185
  • 189. Matériel et méthodes______________________________________________________________________VI-Expression transitoire dans les feuilles de C. quinoa et Nicotiana tabacum. 5 µg de plasmides sont mis en présence de 25 µl dune solution de billes detungstène, 25 µl de CaCl2 1M et de 10 µl de spermidine 0,1 M. Le DNA est mis àprécipiter pendant 10 min à température ambiante, avant déliminer 25 µl du surnageant.Après une brève sonication pour homogénéiser le mélange DNA-billes de tungstène, 2µl sont bombardés à la surface de feuilles de C. quinoa agées de 3 semaines, placéesface antérieure sur le dessus dans des boites de Pétri contenant un milieu de culturegélosé. Des bombardements analogues sont effectuées sur des feuilles de Nicotianatabacum comme décrit par Twell et al (1989). Après 24 heures de culture en logette, lesfeuilles sont broyées dans du tampon dextraction (10 mM KPO4 pH 7,5, 10 mM DTT).Finalement lactivité luciférase est mesurée en présence de tampon Hepes KOH pH 7,550 mM, MgCl2 20 mM, ATP 10 mM et de luciférine 0,5 mM.186
  • 190. Publication n°4 IDENTIFICATION AND CHARACTERIZATION OF RESISTANCE TORHIZOMANIA IN AN ECOTYPE OF BETA VULGARIS SUBSP. MARITIMA. Geyl L., Garcia Heriz M., Valentin P., Hehn A. & Merdinoglu D. Sous presse dans Plant Pathology (1995)
  • 191. Annexe______________________________________________________________________188
  • 192. Publication n°4______________________________________________________________________ 189
  • 193. Annexe______________________________________________________________________190
  • 194. Publication n°4______________________________________________________________________ 191
  • 195. Annexe______________________________________________________________________192
  • 196. Publication n°4______________________________________________________________________ 193
  • 197. Annexe______________________________________________________________________194
  • 198. Publication n°4______________________________________________________________________ 195
  • 199. Annexe______________________________________________________________________196
  • 200. Publication n°4______________________________________________________________________ 197
  • 201. Annexe______________________________________________________________________198
  • 202. Publication n°4______________________________________________________________________ 199
  • 203. Annexe______________________________________________________________________200
  • 204. Publication n°4______________________________________________________________________ 201
  • 205. Annexe______________________________________________________________________202
  • 206. ABREVIATIONSAbréviations des acides aminésA : Ala : AlanineC : Cys : CystéineD : Asp : Acide aspartiqueE : Glu : Acide glutamiqueF : Phe : PhénylalanineG : Gly : GlycineH : His : HistidineI : Ile : IsoleucineK : Lys : LysineL : Leu : LeucineM : Met : MéthionineN : Asn : AsparagineP : Pro : ProlineQ : Gln : GlutamineR : Arg : ArginineS : Ser : SérineT : Thr : ThréonineV : Val : ValineW : Trp : TryptophaneY : Tyr : TyrosineAbréviations des virusACMV : African cassava mosaic virusAMV : Alfalfa mosaic virusBMV : Brome mosaic virusBNYVV : Beet necrotic yellow vein virusBSMV : Barley stripe mosaic virusBYV : Beet yellows virusBWYV : Beet western yellows virusCaMV : Cauliflower mosaic virusCMV : Cucumber mosaic virus
  • 207. Annexe______________________________________________________________________ CPMV : Cowpea mosaic virus CYMV : Clover yellow mosaic virus CyRSV : Cymbidium ringspot virus EMV : Euphorbia mosaic virus GFLV : Grapevine fanleaf virus PCV : Peanut clump virus PVM : Potato virus M PVY : Potato virus Y PVX : Potato virus X SBWMV : Soil borne wheat mosaic virus TBSV : Tomato bushy stunt virus TCV : Turnip crinkle virus TEV : Tobacco etch virus TGMV : Tomato golden mosaic virus TMV : Tobacco mosaic virus TRV : Tobacco rattle virus TSWV : Tomato spotted wilt virus TYMV : Turnip yellow mosaic virus WClMV : White clover mosaic virus Abréviations générales A : Ampère AA : Aminoacide Amp : Ampicilline ATP : Adénosine 5 triphosphate BCIP : 5-bromo-4-chloro-3-indoyl phosphate sel dissodique BET : Bromure déthidium BSA : Sérum albumine bovine cDNA : Acide désoxyribonucléique complémentaire Chl : Chloramphénicol Ci : Curie CP : protéine de coque cm : centimètre CTP : Cytosine 5 triphosphate Da : Dalton ddNTP : Didésoxyribonucléoside triphosphate (ddATP, ddCTP, ddGTP, ddTTP) DNA : Acide désoxyribonucléique204
  • 208. Abréviations______________________________________________________________________ DNase : Désoxyribonucléase dNTP : Désoxyribonucléoside triphosphate (dATP, dCTP, dGTP, dTTP) DO : Densité optique DTT : Dithiothréitol EDTA : Ethylène diamine tétraacétate de sodium EGTA : Ethylène glycol tétraacétate de sodium F : Farrad FDA : Fluoréscéine diacétate g : Gramme h : Heure Hepes : Acide N-2 hydroxy éthyl pipérazine N-2 éthane sulfonique IgG : Immunoglobuline de type G INRA : Institut national de la recherche agronomique IPTG : Isopropylthiogalactopyranoside J : Joule k : Kilo- kb : Kilobase LB : Luria Bertani LMP : Bas point de fusion M : Mole par litre min : Minute mRNA : Acide ribonucléique messager mol : Mole n : Nano- µ : Micro- NBT : Nitro blue tetrazolium chlorid monohydrat nt : Nucléotide ORF : Phase ouverte de lecture pb : paire de base PBS : Tampon phosphate salin PCR : Réaction de polymérisation en chaîne PEG : Polyéthylène glycol PVPP : Polyvinylpolypyrrolidone qsp : Quantité suffisante pour RNA : Acide ribonucléique RNase : Ribonucléase RNasin : Inhibiteur de ribonucléase rpm : Révolution par minute RT : Readthrough 205
  • 209. Annexe______________________________________________________________________ SDS : Dodécyl sulfate de sodium sec : Seconde SSC : Standard sodium citrate TBE : Tampon Tris-Borate-EDTA TE : Tampon Tris-EDTA TEMED : NNNN tétraméthyl éthylène diamine Tm : Température de fusion TNE : Tampon Tris-NaCl-EDTA Tris : Tris (hydroxyméthyl) amino méthane tRNA : Acide ribonucléique de transfert T° : Température U : Unité enzymatique UV : Ultra violet V : Volt W : Watt Ω : Ohm206
  • 210. REFERENCES BIBLIOGRAPHIQUESAllison A.V. & Shalla T.A. (1974). The ultrastructure of local lesions induced by potato virus X: a sequence of cytological events in the course of infection. Phytopathology, 64, 784-793Andino R., Rieckhof G.E., Achacoso P.L. & Baltimore D. (1993). Poliovirus RNA synthesis utilizes an RNP complex formed around the 5-end of viral RNA. Embo J., 12-9, 3587-3598.Atkins D., Hull R., Wells B., Roberts K., Moore P. & Beachy R.N. (1991). The tobacco mosaic virus 30 K movement protein in transgenic plants is localized to plasmodesmata. J. Gen, Virol., 72, 209-211.Baer M.L., Houster F., Loesch-Fries L.S. & Gehrke L. (1994). Specific RNA binding by amino-terminal peptides of alfalfa mosaic virus coat protein. Embo J, 13, 727-735.Barrett A.J. (1986). Proteinases inhibitors. Barret A.J. and Salvesen G. eds. Elseveier Science Publisher BV. 3-22.Baulcombe D., Devic M. & Jaegle M. (1990). The molecular biology of satellite RNA from cucumber mosaic virus, in recognition and response in plant-virus interactions. (Fraser RSS, ed), 263-272. Springer, Berlin.Baulcombe D., Saunder G. R., Revan M.W., Mayo M.A. & Harrison B.D. (1986). Expression of biologically active viral satellite RNA from the nuclear genome of transformed plants. Nature, 321, 446-449.Beachy R.N., Loesch-Fries S. & Tumer N.E. (1990). Coat protein mediated resistance against virus infection. Annu. Rev. Phytopathol., 28, 451-474.Beck D.L., Guilford P.J., Voot D.M., Andersen M.T., Forster R.L.S. (1991). The triple gene block proteins of white clover mosaic potexvirus are required for transport. Virology, 183, 695-702.Bouzoubaa S., Niesbach-Klösgen U., Jupin I., Guilley H., Richards K. & Jonard G. (1991). Shortened forms of beet necrotic yellow vein virus RNA-3 and -4: internal deletions and subgenomic RNA. J. Gen. Virol., 72, 259-266.
  • 211. Annexe______________________________________________________________________Bouzoubaa S. & Scheidecker D. (1990). Infection of protoplasts with beet necrotic yellow vein virus RNA. Proceedings of the first symposium of the international working group on plant viruses with fungal vectors. ed. Koenig, R. Verlag Eugen Ulmer, Stuttgart, 16-20.Bouzoubaa S., Quillet L., Guilley H., Jonard G. & Richards, K. (1987). Nucleotide sequence of beet necrotic yellow vein Virus RNA-1. J. Gen. Virol., 68, 615-626.Bouzoubaa S., Ziegler V., Beck D., Guilley H., Richards K. & Jonard G. (1986). Nucleotide sequence of beet necrotic yellow vein virus RNA-2. J. Gen. Virol., 67, 1689-1700.Bouzoubaa S., Guilley H., Jonard G., Richards K. & Putz C. (1985). Nucleotide sequence analysis of RNA-3 and RNA-4 of Beet Necrotic Yellow Vein Virus, Isolates F2 and G1. J. Gen. Virol., 66, 1553-1564.Brault V. & Miller W. A. (1992). Translational frameshifting mediated by a viral sequence in plant cells. Proc. Natl. Acad. Sci., USA, 89, 2262-2266.Bransom K.L. & Dreher T.W. (1994). Identification of the essential cysteine and histidine residues of the turnip yellow mosaic virus protease. Virology, 198, 148-154.Brunt A.A. (1991). Soil-borne wheat mosaic virus group. In Classification and nomenclature of viruses. Fifth report of the international commitee on taxonomy of viruses. (R.I.B. Francki, C.M. Fauquet, D.L. Knudson & F. Brown, Eds) Springer- Verlag, New York, 377-379.Brunt A.A. & Richards K. (1989). Biology and molecular biology of furoviruses. Adv. Virus Res., 36, 247-262.Burgyan J., Grieco F. & Russo M. (1989). A defective interfering RNA molecule in cymbidium ringspot virus infections. J. Gen. Virol., 70, 235-239.Canova A. (1966). Ricerche virologiche nella rizomania della bietola. Annali Accademia Nazionale di Agricoltura, 78, 37-46.Canova A. (1959). Appunti di patologia della barbabietola. Inf. Fitopatol., 9, 390-397.Casabadan J. & Cohen S. (1980). Analysis of gene control signals by DNA fusion and cloning in Escherichia coli. J. Mol. Biol., 138, 179-207.Carrington J.C. & Dougherty W.G. (1987). Processing of tobacco etch virus 49K- protease requires autoproteolysis. Virology, 160, 355-362.Chadefaud M. & Emberger L. (1942). Traité de botanique sytématique. Masson & Cie, Tome 1Chien A., Edgar B.D. & Trela J.M. (1976). Desoxyribonucleic acid polymerase from the extreme thermophile Thermus aquaticus. J. Bacteriol., 127, 1550-1557Citovsky V., Wong M.L., Shaw A.L., Prasad B.V.V. & Zambriski P. (1992). Vizualisation and characterization of tobacco mosaic virus movement binding to single-stranded nucleic acid. Plant Cell, 4, 397-411.208
  • 212. Références bibliographiques______________________________________________________________________Citovsky V., Knorr D., Schuster G. & Zambryski P. (1990). The P30 movement protein in tobacco mosaic virus is a single-strand binding nucleic acid binding protein. Cell, 60, 637-647.DArcy C.J. & de Zoeten G.A. (1979). Beet western yellows virus in phloem tissue of Thlaspi arvense. Phytopathology, 69, 1194-1198.Davies C., Hills G. & Baulcombe D. (1993). Subcellular localization of the 25 kDa protein encoded in the triple gene block of potato virus X. Virology, 197, 166-175.De Oliveira Resende R., de Haan P., de Avila A.C., Kitajima E.W., Kormelink R., Goldbach R. & Petrs D. (1991). Generation of envelope and defective interfering RNA mutants of tomato spotted wilt virus by mechanical passage. J. Gen. Virol., 72, 2375-2383.Deom C.M., Wolf S., Holt C.A., Lucas W.J. & Beachy R.N. (1990). Molecular characterization and biological function of the movement protein of tobacco mosaic virus in transgenic plants. Proc. Natl. Acad. Sci., USA, 87, 3284-3288.Derbyshire V., Freemont P.S., Sanderson M.R., Beese L., Friedman J.M., Joyce, C.M. & Steitz T.A. (1988). Genetic and christallographic studies of the 3, 5 exonucleolytic site of DNA polymerase I. Science, 240, 199-201.Dessens J.T. & Lomonossof G.P. (1991). Mutational analysis of the putative catalytic triad of the cowpea mosaic virus 24K-protease. Virology, 184, 738-746.De Zoeten G.A. & Gaard G. (1969). Possibilities for inter and intracellular translocation of some icosahedral plant viruses. J. Cell Biol., 40, 814-823.Ding B., Haudenshield J.H.S., Hull R.J., Wolf S. & Beachy R.N. (1992). Secondary plasmodesmata are specific sites of localization of the tobacco mosaic virus movement protein in transgenic tobacco plants. Plant Cell, 4, 915-928.Donald R.G. & Jackson A.O. (1994). The barley stripe mosaic virus γb gene encodes a multifunctional cysteine-rich protein that affects pathogenesis. The Plant Cell, 6, 1593-1606.Dougherty W.G., Lindbo J.A., Smith H.A., Parks D.T., Swanney S. & Proebsting W.M. (1994). RNA-mediated virus resistance in transgenic plants: exploitation of a cellular pathway possibly involved in RNA degradation. Mol. Plant-Microbe Interact., 7-5, 544-552.Dougherty W.G. & Semmler B.L. (1993). Expression of virus-encoded proteinases: functional and structural similarities with cellular enzymes. Microbiological Reviews. 57-4, 781-822.Dougherty W.G., Parks T.D., Cary S.M., Bazan J.F. & Fletterick R.J. (1989). Characterization of the catalytic residues of the tobacco etch virus 49 kDa proteinase. Virology, 172, 302-310.Dowson Day M.J., Ashurst, J.L. & Dixon R.A.(1994). Plant expression cassettes for enhanced translation efficiency. Plant Mol. Biol. Reptr., 12-4, 347-357. 209
  • 213. Annexe______________________________________________________________________Esau K. (1967). Anatomy of plant virus infections. Annu. Rev. Phytopathol., 5, 45-76.Franki R.I.B. (1986). Plant virus satellite. Annu Rev. Microbiol., 39, 151-174.Fujisawa I. & Sugimoto T. (1977). Transmission of beet necrotic yellow vein virus by Polymyxa betae. Ann. Phytopath. Soc. Japan, 43, 583-586.Fujisawa I. & Sugimoto T. (1976). Ecological study on rhizomania of sugar beet and its pathogen. Reprinted from the research bulletin n°115 of the Hokkaïdo National Agriculture Experiment Station. 123-131.Geyl L., Garcia Heriz M., Valentin P., Hehn A. & Merdinoglu D. (1995). Identification and characterization of resistance to rhizomania in an ecotype of Beta vulgaris subsp. maritima. Plant Pathology. In press.Gibbs A. (1976). Viruses and plasmodesmata. Intercellular communication in plants : studies on plasmodesmata (BES Gunning and AW Robards, eds) Berlin, Springer- Verlag, 149-163.Giesman-Cookmeyer D. & Lommel S.A. (1993). Alanine scanning mutagenesis of a plant virus movement protein identifies three functional domains. Plant Cell, 5, 973- 982.Gill C.C. & Chong J.J. (1975). Development of infection in oat leaves inoculated with barley yellow dwarf virus. Virology, 66, 440-453.Gilmer D., Bouzoubaa S., Hehn A., Guilley H., Richards K. & Jonard G. (1992). Efficient cell-to-cell movement of beet necrotic yellow vein virus requires 3 proximal genes located on RNA 2. Virology, 189, 40-47.Goldbach R., Rezelman G. & Van Kammen A. (1980). Independent replication and expression of B component RNA of cowpea mosaic virus. Nature, 286, 297-300.Goodwin P.B. (1983). Molecular size limit for movement in the symplast of the Elodea leaf. Planta, 157, 124-130Gorbalenya A.E., Koonin E.V. & Lai M.M.C. (1991). Putative papain-related thiol proteases of positive strand RNA viruses. Identification of rubi- and aphtovirus proteases and delineation of a novel conserved domain associated with proteases of rubi-, alfa- and coronavirus. FEBS letter, 288-2, 201-205.Gorbalenya A.E., Donchenko A.P., Blinov V.M. & Koonin E.V. (1989). Cysteine proteases of positive strand RNA viruses and chymotrypsine like serine proteases. A distinct protein family with a common structural fold. FEBS letter, 243, 103-114.Gough J. & Murray N.(1983). Sequence diversity among related genes for recognition of specific targets in DNA molecules. J. Mol. Biol., 166, 1-19Gramstat A., Courtpozanis A., Rohde W. (1990). The 12 kDa protein of potato virus M displays properties of a nucleic acid-binding regulatory protein. FEBS letter, 276, 34- 38.Greener A. (1990). E.coli SURETM strain: clone "unclonable" DNA. Strategies Mol. Biol., 3, 5-6.210
  • 214. Références bibliographiques______________________________________________________________________Haeberlé A.M. & Stussi-Garraud C. (1995). In situ localization of the non-structural protein P25 encoded by beet necrotic yellow vein virus RNA 3. J. Gen Virol., 76, 643-650.Haeberle A. M., Stussi Garaud C., Schmitt C., Garaud J. C., Richards K., Guilley H. & Jonard G. (1994). Detection by immunogold labelling of P75 readthrough protein near an extremity of beet necrotic yellow vein virus particles. Arch.Virol., 134, 195- 203.Harris K.S., Xiang W., Alexander L., Lane W., Paul A.V. & Wimmer E. (1994). Interaction of poliovirus polypeptide 3 CD pro with the 5 and 3 termini of the poliovirus genome. J. Biol. Chem., 269, 27004-27014.Hehn A., Bouzoubaa S., Bate N., Twell D., Marbach J., Richards K., Guilley H. and Jonard G. (1995). The small cysteine-rich protein P14 of beet necrotic yellow vein virus regulates accumulation of RNA 2 in cis and coat protein in trans. Virology, sous presse.Hehn A., Bouzoubaa S., Guilley H., Jonard G. & Richards K. (1994). Artificial defective interfering RNAs derived from RNA 2 of beet necrotic yellow vein virus. Arch. Virol., 135, 143-151.Hehn A., Schmitt C., Haeberlé A.M., Gilmer D., Stussi-Garaud C., Guilley H., Richards K. & Jonard G. (1993). Identification of sequences involved in beet necrotic yellow vein virus encapsidation and diffusion. Proceedings of the second symposium of international working group on plant viruses with fungal vectors, 31-34, ed. Chuji Hiruki.Herzog E., Guilley H., Manohar S.K., Dolet M., Richards K., Fritsch C. & Jonard G. (1994). Complete nucleotide sequence of peanut clump virus RNA 1 and relationships with other fungus-transmitted rod-shaped viruses. J. Gen. Virol., 75, 3147-3155.Hillman B.I., Carrington J.C. & Morris T.J. (1987). A defective interfering RNA that contains a mosaic of plant virus genome. Cell, 51, 427-433.Hope I.A. & Struhl K. (1986). Functionnal dissection of a eukariotic transcriptional protein, GNN4 of yeast. Cell, 46, 885-894.Hull R. & Davies J.W. (1992). Approaches to non conventional control of plant diseases. Critical Reviews in Plant Sciences. 11-1, 17-33.Jackson A.O., Petty I.T.D., Jones R.W., Edwards M.C. & French R. (1991). Analysis of barley stripe mosaic virus pathogenicity. Seminars in virology, 2, 107-119.Jackson A.O. & Larkins B.A. (1976). Influence of ionic strengh, pH and chelation of divalent metals on isolation of polyribosomes from tobacco leaves. Plant. Physiol., 57, 7-10 211
  • 215. Annexe______________________________________________________________________Jacobsen H., Klenow H. & Overgaard-Hansen K. (1974). The N-terminal amino-acid sequences of DNA polymerase I from E. coli and of the large and the small fragment obtained by limited proteolysis. Eur. J. Biochem., 45, 623-627.Jacquemond M. & Lot H. (1981). LARN satellite du virus de la mosaïque de la concombre. I. Comparaison de laptitude à induire la nécrose létale de la tomate dARN satellite isolés de plusieurs souches de virus. Agronomie, 1, 927-932.Jupin I., Guilley H., Richards K. & Jonard G. (1992). Two proteins encoded by beet necrotic yellow vein virus RNA 3 influence symptom phenotype on leaves. Embo J., 11, 479-488.Jupin I., Richards K., Jonard G., Guilley H. & Pleij C.W.A. (1990). Mapping of sequences required for productive replication of beet necrotic yellow vein virus RNA 3. Virology, 178, 273-280.Kadare G., Rozanov M. & Haenni A.L. (1995). Caratérisation de la protéinase du TYMV exprimée dans Escherichia coli. Cinquièmes rencontres de virologie végétale, Aussois, 23-27 janvier 1995.Kasteel D., Wellink J., Verver J., Van Lent J., Goldbach R. & Van Kammen A. (1993) The involvement of cowpea mosaic virus M-RNA encoded proteins in tubule formation. J. Gen. Virol., 74, 1721-1724.Keegan L., Gill G. & Ptashne M. (1986). Separation of DNA binding from the transcription-activating function of a eucaryotic regulatory protein. Science, 231, 699-704.Keskin B. (1967). Polymyxa betae (Plasmodiophoraceae) Vegetative Vermerhung in Wurtzelhaar der Zuckerrübe. In W. G. (Eds.), Enceclopeadia cinematographica, 1-8.Keskin B. (1964). Polymyxa betae n. sp. ein parasit in den wurzeln von beta vulgaris tournefort, besonders wähsend der Jugendentwickling der zuckerrübe. Arch. Microbiol., 49, 348-374.Kim K.S. & Lee K.W. (1992). Geminivirus-induced macrotubules and their suggested role in cell-to-cell movement. Phytopathology, 82, 664-669.Koenig R. & Burgermeister W. (1989). Mechanical inoculation of sugarbeet roots with isolates of beet necrotic yellow vein virus having different RNA composition. J. Phytopath., 124, 249-255.Koenig R., Burgermeister W., Weich H., Sebald W. & Kothe C. (1986). Uniform RNA patterns of beet necrotic yellow vein virus in sugar beet roots, but not in leaves from several plant species. J. Gen. Virol., 67, 2043-2046.Kolar A., Dalmay T. & Burgyan J. (1993). Defective interfering RNA mediated resistance against cymbidium ringspot tombusvirus in transgenic plants. Virology, 193, 313-318.212
  • 216. Références bibliographiques______________________________________________________________________Koonin E.V. & Dolja V.V. (1993). Evolution and taxonomy of positive strand RNA viruses: implication of comparative analysis of amino acid sequences. Critical Reviews in Biochemestry and Molecular Biology, 28-5, 375-430.Koonin E.V., Boyko V.P. & Dolja V.V. (1991). Small cysteine-rich proteins of different groups of plant viruses are related to different families of nucleic acids-binding proteins. Virology, 181, 395-398.Kormelink R., Storms M., Van Lent J., Peters D. &Goldbach R. (1994). Expression and subcellular location of the NSm protein of tomato spotted wilt virus (TSWV), a putative viral movement protein. Virology, 200, 56-65.Kozak M. (1989). The scanning model for translation: an update. J. Cell Biol., 108, 229-241.Kunkel T.A., Roberts J.D. & Zakour R.A. (1987). Rapid and efficient site specific mutagenesis without phenotypic selection. Methods in Enzymology, 154, 367-382.Kuszala M. & Putz C. (1977). La rhizomanie de la betterave sucrière en Alsace : gamme dhôtes et propiétés biologiques du "Beet Necrotic Yellow Vein Virus". Ann. Phytopathol., 9, 435-446.Kyte J. & Doolitle R.F. (1982). A simple method for displaying the hydropathic character of a protein. J. Mol. Biol., 157, 105-132.Lamberti C., Morrissey L.C., Grossman S.R. & Androphy E. (1990). Transcriptional activation by the papillomavirus E6 zinc finger protein. Embo J., 9, 1907-1913.Laemmli U.K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 227, 680-685.Lazzarini R.A., Keene J.D. & Schubert M. (1981). The origins of defective interfering particles of the negative strands RNA viruses. Cell, 26, 145-154.Lehman I. R. (1974). T4 DNA polymerase. Methods Enzymol., 29, 46-53.Lemaire O., Merdinoglu D., Valentin P., Putz C., Ziegler-Graff V., Guilley H., Jonard G. & Richards K. (1988). Effect of beet necrotic yellow vein virus RNA composition on transmission by Polymyxa betae. Virology, 162, 232-235.Leonard D.A. & Zaitlin M. (1982). A temperature-sensitive strain of tobacco mosaic virus defective in cell-to-cell movement generates an altered virus coded protein. Virology, 117, 416-442.Li G.P. & Rice C.M. (1993). The signal for translational readthrough of a UGA codon in sindbis virus RNA involves a single cytidine residue immediately downstream of the termination codon. J. Virol., 67, 5062-5067.Li X.H., Heaton L.A., Morris T.J. & Simon A.E. (1989). Turnip crinckle virus defective interfering RNA intensify viral symptoms and are generated de novo. Proc. Natl. Acad. Sci., USA, 86, 9173-9177.Ma J. & Ptashne M. (1987). A new class of yeast transcriptionnal activators. Cell, 51, 113-119. 213
  • 217. Annexe______________________________________________________________________Maas R. (1983). An improved colony hybridization method with significantly increased sensitivity for detection of single genes. Plasmid, 10, 296-298.Mc Mullen C.R., Gardner W.S. & Myers G.A. (1977). Ultrastructure of cell-wall thickenings and paramural bodies induced by barley stripe mosaic virus. Phytopathology, 67, 462-467.Maniatis T., Fritsch E.F. & Sambrook J.L. (1982). Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory.Margis R., Viry M., Pinck M. & Pinck L. (1991). Cloning and in vitro characterization of the grapevine fanleaf virus proteinase cistron. Virology, 185, 779-787.Marsh L.E., Pogue G.P., Szybiak U., Connell J.P. & Hall T C. (1991). Non-replicating deletion mutants of brome mosaic virus RNA-2 interfere with viral replication. J. Gen. Virol., 72, 2367-2374.Meshi T., Watanabe Y., Saito T., Sugimoto A., Maeda T. & Okada Y. (1987). Function of the 30 kd protein of tobacco mosaic virus: involvement in cell-to-cell movement and dispensibility for replication. Embo J, 6 2557-2563.Moffatt B.A. & Studier F.W. (1987). T7 lysozyme inhibits transcription by T7 RNA polymerase. Cell, 49, 221-227.Montasser M.S., Toussignant M.E. & Kaper J.M. (1991). Satellite-mediated protection of tomato against cucumber mosaic virus: I. greenhouse experiments and simulated epidemic conditions in field. Plant Dis., 75, 86-92.Morozov S.Y., Dolja V.V. & Atabekov J.G. (1989). Probable reassortment of genomic elements among elongated RNA-containing plant viruses. J. Mol. Biol., 29, 52-62.Moser O., Gagey M.J., Godefroy-Colburn T., Stussi-Garraud C., Ellwart M., Nitshko H. & Mundry K.W. (1988). The fate of the transport protein of tobacco mosaic virus in systemic and hypersensitive tobacco hosts. J. Gen. Virol., 69, 1367-1373.Mullis K. & Faloona F. (1987). Specific synthesis of DNA in vitro via a polymerase catalysed chain reaction. Methods Enzymol., 155, 335.Mullis K., Faloona F., Scharf S., Saiki R., Horn G. & Erlich H. (1986). Specific enzymatic amplification of DNA in vitro : the polymerase chain reaction. Cold Spring Harbor Symp. Quant Biol., 51, 263Niesbach Klösgen U., Guilley H., Jonard G. & Richards K. (1990). Immunodetection in vivo of beet necrotic yellow vein virus encoded proteins. Virology, 178, 52-61.Pelham H.R.B. & Jackson R.J. (1976). An efficient mRNA-dependent translation system from reticulocyte lysate. Eur. J. Biochem., 67, 247-256.Pelletier J. & Sonnenberg N. (1988). Internal initiation of translation of eukaryotic mRNA directed by a sequence derived from poliovirus RNA. Nature, 334, 320-325.Peters S.A., Voohorst W.G.B., Wery J., Wellink J. and Van Kammen A. (1992). A regulatory role for the 32 k-protein in proteolytic processing of cowpea mosaic virus polyproteins. Virology, 191-1, 81-89.214
  • 218. Références bibliographiques______________________________________________________________________Petty I.T.D., French R., Jones R.W. & Jackson A.O. (1990). Identification of barley stripe mosaic virus genes involved in viral RNA replication and systemic movement. Embo J., 9, 3453-3457.Poch O., Sauvaget I., Delarue M. & Tordo N. (1989). Identification of four conserved motifs among the RNA-dependent polymerase encoding elements. Embo J., 8, 3867- 3874.Pogue G.P. & Hall T.C. (1992). The requirement for a 5 stem-loop structure in brome mosaic virus replication supports a new model for viral positive-strand RNA initiation. J. Virol., 66, 674-684.Porath J., Carlsson J., Olsson I. & Belfrage G. (1975). Metal chelate affinity chromatography, a new approach to protein fractionation. Nature, 258, 598-599.Powell-Abel P.A., Nelson R.S., De B., Hoffmann N., Rogers S.G., Fraley R.T. & Beachy R.N. (1986). Delay of desease development in transgenic plants that express the tobacco mosaic virus coat protein gene. Science, 232, 738-743.Putz C. (1977). Composition and structure of beet necrotic yellow vein virus. J. Gen. Virol. 35, 397-401.Putz C. & Vuittenez A. (1974). Observation de particules virales chez les betteraves présentant en Alsace des symptômes de rhizomanie. Ann. Phytopathol., 6, 129-138.`Putz C., Pinck L., Pinck M. & Fritsch C. (1983). Identification of the 3 end of beet necrotic yellow vein virus RNAs. Presence of poly-A sequences. FEBS letters, 156, 41-56Quadt R. & Jaspars E.M.J. (1990). Purification and characterization of brome mosaic virus RNA-dependent RNA polymerase. Virology, 178, 189-194.Quillet L., Guilley H., Jonard G. & Richards K. (1989). In vitro synthesis of biologically active beet necrotic yellow vein virus RNA. Virology, 172, 293-301.Radloff R., Bauer W. & Vinograd J. (1967). A dye-buoyant density method for the detection and isolation of closed circular duplex DNA : the closed circular DNA in HeLa cells. Proc. Natl. Acad. Sci. USA, 57, 1514-1521.Rave N., Crkvenjakov J. & Boedtker H. (1979). Identification of procollagen mRNAs transfered to diazo-benzylomethyl paper from formaldehyde agarose gels. Nucleic Acids Res., 6, 3559-3567.Rezelman G., Franssen H.J., Goldbach R.W. & Van Kammen A. (1982). Limits of the independence of the bottom component RNA of cowpea mosaic virus. J. Gen. Virol., 60, 335-342.Richards K., Jonard G., Guilley H., Ziegler V. & Putz C. (1985). In vitro translation of beet necrotic yellow vein virus RNA and studies of sequence homology among the RNA species using cloned cDNA probes. J. Gen. Virol., 66, 345-350.Riechmann J.L., Lain S. & Garcia J.A. (1992). Highlights and prospects of potyvirus molecular biology. J. Gen. Virol., 73, 1-16. 215
  • 219. Annexe______________________________________________________________________Ritzenthaler C., Schmit A.C., Michler P., Stussi-Garraud C. & Pinck L. (1994). Grapevine fanleaf nepovirus P38 putative movement protein is involved in tubule formation in vivo. Molecular Plant microbe Interactions. SoumisRobards A.W. & Lucas W.J. (1990). Plasmodesmata. Annu. Rev. Plant. Physiol. Plant Mol. Biol., 41, 369-419.Roux L., Simon A.E. & Holland J.J. (1991). Effects of defective interfering viruses on virus replication and pathogenesis. Adv. Virus Res., 40, 181-211.Rozanov M.N., Drugeon G. & Haenni A.L. (1995). Papaïn-like proteinase of turnip yellow mosaic virus: a prototype of a new viral proteinase group. Arch. Virol., 140, 273-288.Saiki R.K., Scharf S., Faloona F., Mullis K.B., Horn G.T., Erlich H.A. & Arnheim N. (1985). Enzymatic amplification of ß globine genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science, 230, 1350-1354.Saiki R.K., Gelfand D.H., Stoffel S., Scharf S, Higuchi R., Horn G., Mullis K.B. & Erlich H.A. (1988). Primed-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science, 238, 487-491.Schmitt C., Balmori E., Jonard G., Richards K. & Guilley H. (1992). In vitro mutagenesis of biologically active transcripts of beet necrotic yellow vein virus RNA 2: Evidence that a domain of the 75-kDa readthrough protein is important for efficient virus assembly. Proc. Natl. Acad. Sci.,USA, 89, 5715-5719.Scott K. P., Kashiwazaki S., Reavy B.& Harrison B. D. (1994) The nucleotide sequence of potato mop-top virus RNA 2: A novel type of genome organization for a furovirus. J. Gen. Virol. 75, 3561-3568.Shalla T.A., Petersen L.J. & Zaitlin M. (1982). Restricted movement of temperature- sensitive virus in tobacco leaves is associated with a reduction in number of plasmodesmata. Virology, 60, 355-358.Silva-Rosales L., Lindbo J.A. & Dougherty W.G. (1994). Analysis of transgenic tobacco plants expressing a truncated form of a potyvirus coat protein nucleotide sequence. Plant. Mol. Biol., 24, 929-939.Smith H.A., Swaney S.L., Parks, T.D., Wernsman E.A. & Dougherty W.G. (1994). Transgenic plant virus resistance mediated by untranslatable sense RNAs: expression, regulation, and fate of nonessential RNAs. The Plant Cell, 6, 1441-1453.Sprang S., Standing T., Fletterick R.J., Stroud R.M., Finer-Moore J., Xuong N.H., Hamin R., Rutter W.J. & Craik C.S. (1987). The three-dimensional structure of asn 102 mutant of trypsin: role of asp 102 in serine protease catalysis. Science, 237, 905-909.Stanley J., Frischmuth T. & Ellwood S. (1990). Defective viral DNA ameliorates symptoms of geminivirus infection in transgenic plants. Proc. Natl. Acad. Sci., USA, 87, 6291-6295.216
  • 220. Références bibliographiques______________________________________________________________________Studier F.W., Rosenberg A.H., Dunn J.J. & Dubendorff J.W.(1990). Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol. 185, 60-89.Stussi Garraud C., Haeberlé A.M., Ritzenthaler C., Rohfritsch O. & Lebeurier G. (1994). Electron microscopy of plant viruses. Biology of the cell. 80, 147-153.Tamada T., & Kusume T. (1991). Evidence that the 75K readthrough protein of beet necrotic yellow vein virus RNA-2 is essential for transmission by the fungus Polymyxa betae. J. Gen. Virol., 72, 1497-1504.Tamada T. & Abe H. (1989). Evidence that beet necrotic yellow vein virus RNA-4 is essential for efficient transmission by the fungus Polymyxa betae. J. Gen. Virol., 70, 3391-3398.Tamada T. & Baba T. (1973). Beet necrotic yellow vein virus from rhizomania affected sugar beet in Japan. Ann. Phytopath. Soc. Japan, 39, 325-332.Tien P., Zhang X.H., Qiu B.S., Qin B.Y. & Wu G.S. (1987). Satellite RNA for the control of plant viral disease. Ann. Appl. Biol., 111, 143-152.Tomenius K., Clapham D. & Meshi T. (1987). Localization by immunogold cytochemistry of the virus-coded 30 K-protein in plasmodesmata of leaves infected with tobacco mosaic virus. Virology, 160, 363-371.Tucker E.B. (1982). Translocation in the staminal hairs of Setcreasea purpurea I: study of cell ultrastructure and cell-to-cell passage of molecular probes. Protoplasma, 113, 193-201.Turner R., Bate N., Twell D. & Foster G.D. (1994). In vivo characterisation of a translational enhancer upstream from the coat protein open reading frame of potato virus S. Arch. Virol., 137, 123-132.Twell D., Klein T.M., Fromm M.E. & Mc Cormick S. (1989). Transient expression of chimeric genes delivered into pollen by microprojectile bombardment. Plant Physiol., 91, 1270-1274.Van Bokhoven H., Le Gall O., Kasteel D., Verver J., Wellink J. & Van Kammen A. (1993). Cis and trans acting elements in cowpea mosaic virus RNA replication. Virology, 195, 377-386.Van Lent J., Storms M., Van der Meer F., Wellink J. & Goldbach R. (1991). Tubular structures involved in movement of cowpea mosaic virus are also formed in infected cowpea protoplasts. J. Gen. Virol., 72, 2615-2623.Van Lent J., Wellink J. & Goldbach R. (1990). Evidence for the involvment of the 58 K and 48 K-proteins in the intercellular movement of cowpea mosaic virus. J. Gen. Virol., 71, 219-223.Veidt I., Bouzoubaa S., Leiser R.M., Ziegler-Graff V., Guilley H., Richards K. & Jonard G. (1992). Synthesis of full-Length transcripts of beet western yellows virus RNA: Messenger properties and biological activity in protoplasts. Virology, 186, 192-200. 217
  • 221. Annexe______________________________________________________________________Verchot J., Handon K.L. & Carrington J.C. (1992). Mutational analysis of the tobacco etch potyviral 35 kDa proteinase: Identification of essential residues and requirements for autoproteolysis. Virology, 190, 298-306.Vieira J. & Messing J. (1987). Production of single stranded plasmid DNA. Methods Enzymol., 153, 3-11.Vos P., Verver J., Jaegle H., Wellink J., Van Kammen A. & Goldbach R. (1988). Two viral proteins involved in the proteolytic processing of the cowpea mosaic virus polyproteins. Nucleic Acids Research, 16, 1967-1985.Wasseneger M., Heimes S., Riedel L & Sänger H.L. (1994). RNA directed de novo methylation of genomic sequences in plants. Cell, 76, 567-576.Wellink J., Van Bokhoven H., Le Gall O., Verver J. & Van Kammen A. (1994). Replication and translation of cowpea mosaic virus RNAs are tightly linked. Arch. Virol., [suppl] 9, 381-392.Wellink J., Van Lent J., Verver J., Sijen T., Goldbach R. & Van kammen A. (1993). The cowpea mosaic virus M-RNA encoded 48 kDa protein is responsible for the induction of tubular structures in protoplasts. J. Virol., 67, 3660-3664.Wellink J., Jaegle M., Prinz H., Van Kammen A. & Goldbach R. (1987). Expression of the middle component RNA of cowpea mosaic virus in vivo. J. Gen. Virol., 68, 2577- 2585.Wellink J., Rezelman G., Goldbach R. & Beyreuther K. (1986). Determination of the proteolytic processing sites in the polyprotein encoded by the bottom-component RNA of cowpea mosaic virus. J. Virol., 59, 50-58.White K.A., Bancroft J.B., & Mackie G.A. (1991). Defective RNAs of clover yellow mosaic virus encode nonstructural/coat protein fusion products. Virology, 183, 479- 486.Wilson T.M.A. (1993). Strategies to protect crop plants against viruses: pathogen- derived resistance blossoms. Proc. Natl. Acad. Sci., USA, 90, 3134-3141.Wolf S., Deom C.M., Beachy R.N. & Lucas W.J. (1989). Movement protein of tobacco mosaic virus modifies plasmodesmatal size exclusion limit. Science, 246, 377-379Yie Y. & Tien P. (1993). Plant virus satellite RNAs and their role in engineering resistance to virus diseases. Seminars in virology, 4, 363-368.Yie Y., Zhao F., Zhao S.Z., Liu Y.Z., Liu Y.L. & Tien P. (1992). Transgenic commercial tobacco cultivar G-140 with high resistance to cucumber mosaic virus conferred by expressing satellite RNA and coat protein. Mol. Plant-Microbe Interact., 5, 460-465.Ziegler V., Richards K., Guilley H., Jonard G. & Putz C. (1985). Cell-free translation of beet necrotic yellow vein virus: Readthrough of the coat protein cistron. J. Gen. Virol., 66, 2079-2087.218
  • 222. Références bibliographiques______________________________________________________________________Zoller M.J. & Smith M. (1982). Oligonucleotide-directed mutagenesis using M13- derived vectors: an efficient and general procedure for the production of point mutations in any fragment of DNA. Nucl. Acids Res., 10, 6487-6500. 219

×