La genética molecular
Upcoming SlideShare
Loading in...5
×

Like this? Share it with your network

Share
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Be the first to comment
    Be the first to like this
No Downloads

Views

Total Views
4,283
On Slideshare
2,531
From Embeds
1,752
Number of Embeds
5

Actions

Shares
Downloads
32
Comments
0
Likes
0

Embeds 1,752

http://hablamosdeciencias.blogspot.com 1,107
http://www.hablamosdeciencias.blogspot.com 342
http://hablamosdeciencias.blogspot.com.es 239
http://www.hablamosdeciencias.blogspot.com.es 60
http://hablamosdeciencias.blogspot.mx 4

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
    No notes for slide

Transcript

  • 1. La genética
  • 2.  
  • 3. El ADN: el secreto de la vida Para conocer el ADN tenemos que saber: Su composición Su estructura Cómo se expresa su información Cómo se transmite la información de generación en generación
  • 4. LA COMPOSICIÓN DEL ADN
  • 5. Composición del ADN
    • El ADN se compone de unas unidades denominadas nucleótidos .
    • En el ADN existen 4 tipos de nucleótidos distintos
    • El ADN está constituido por muchos miles de nucleótidos
    • Lo que diferencia a unos ADN de otros es el orden de los miles de nucleótidos que lo forman .
  • 6. ¿De qué se compone un nucleótido?
    • Un nucleótido se compone de tres moléculas que aparecen unidas:
      • Grupo fosfato
      • Azúcar
      • Base nitrogenada Pueden ser :
    Guanina Citosina Timina Adenina Nucleótido
  • 7. Las cadenas de nucleótidos
    Los nucleótidos se unen entre sí formando largas cadenas, además dos cadenas se asocian para formar una molécula de ADN . . . .
  • 8. LA SECUENCIA DE NUCLEÓTIDOS
    • .
    El orden en que se unen unos nucleótidos con otros se denomina secuencia y tiene una gran importancia, pues contiene la información que después se expresará en forma de proteínas T-C-A-G-.............................
  • 9. LA ESTRUCTURA DEL ADN
  • 10. LA ESTRUCTURA DEL ADN
    • En 1953 Watson y Crick determinaron cómo era la estructura tridimensional de esta molécula.
    • Cada molécula de ADN está formada por dos cadenas de nucleótidos enrolladas formando una doble hélice
  • 11.
      • el pasamanos lo constituiría la parte invariable, formada por la sucesión de fosfatos y ribosas
      • los peldaños la parte variable, donde se encuentran las bases nitrogenadas
    La estructura de la doble hélice recuerda a una escalera de caracol
  • 12. La estructura del ADN
    • Cada peldaño está constituido por dos bases nitrogenadas, una de cada cadena, unidas entre sí mediante enlaces.
    • Siempre se une: Adenina con Timina y Guanina con Citosina,
  • 13. La estructura del ADN
    • Como las bases siempre se emparejan de la misma manera, decimos que son complementarias.
    • Sabiendo la secuencia de bases de una cadena podemos deducir la otra.
    ATGGCTTAACAATCCCGGGTACGTA TACCGAATTGTTAGGGCCCATGCAT
  • 14. La estructura del ADN El ADN constituye largas cadenas. Cada molécula de ADN forma, junto a otras moléculas denominadas histonas, una sustancia denominada cromatina, durante la división celular la cromatina se condensa y forma los cromosomas ¿Cuántas moléculas de ADN hay en cada célula de un ser humano? 46
  • 15. Expresión de la información genética
  • 16. Expresión de la información genética.
    • Los genes contienen información que debe ser expresada
    • La información contenida en el ADN se expresa a través
    • de las proteínas .
    • Un gen es un fragmento de ADN que contiene la
    • información para la síntesis de una proteína.
  • 17. Expresión de la información genética
    • Las proteínas son macromoléculas formadas por la
    • sucesión de moléculas más pequeñas llamadas
    • aminoácidos.
    • Las proteínas contienen 20 aminoácidos diferentes
    • que se ordenan y repiten en función de la información
    • contenida en el ADN
  • 18. Expresión de la información genética. Uno de los científicos que contribuyó a descubrir como se realizaba esta traducción fue Severo Ochoa. Su trabajo en este campo le valió el Premio Nobel.
  • 19. Expresión de la información genética
    • ¿ Cómo se expresa la información contenida en el ADN en las
    • proteínas?
    1.- La información contenida en el ADN se transcribe a una molécula de ARN (ácido ribonucleico) que una vez formada abandona el núcleo para dirigirse al citoplasma. 2.- La información genética se traduce al lenguaje de las proteínas en los ribosoma.Cada cadena de ARN dará lugar a una proteína
  • 20. Expresión de la información genética. La transcripción ADN ARN ACCGGTACTGACAGTACTTCC TGGCCATGACTGTCATGAAGG Molécula de ADN
  • 21. Expresión de la información genética. La transcripción. ACCGGTACTGACAGTACTTCC TGGCCATGACTGTCATGAAGG UGGCCAUGACUGUCAUGAAGG
    • Las dos cadenas
    • de ADN se separan
    • Una de ellas sirve de
    • patrón para la síntesis
    • de una cadena de ARN.
    • A esta molécula de
    • ARN se le denomina
    • ARN mensajero
  • 22. Expresión de la información genética. La transcripción. Características del ARN:
    • Está constituido por una sola cadena
    • Contiene ribosa en vez de desoxiribosa.
    • Las bases nitrogenadas que contiene son:
      • ADENINA
      • GUANINA
      • CITOSINA
      • URACILO (en vez de timina)
  • 23. Expresión de la información genética. La traducción ARN Proteínas Se traduce un lenguaje con cuatro signos (las cuatro bases nitrogenadas) a un lenguaje con veinte signos (los veinte aminoácidos que componen las proteínas)
  • 24. Expresión de la información genética. La traducción AUG CCU CAU AGU GGC UAA Tiene lugar en los ribosomas, donde el ARNm lleva la información del ADN ARN Ribosoma Aminoácido Proteína en formación Los aminoácidos son conducidos al ribosoma por el ARNt, y unidos según indica la secuencia de nucleótidos del ARNm
  • 25. Expresión de la información genética. La traducción AUG CCU CAU AGU GGC UAA ARN
  • 26. Expresión de la información genética. La traducción AUG CCU CAU AGU GGC UAA ARN
  • 27. Expresión de la información genética. La traducción AUG CCU CAU AGU GGC UAA ARN
  • 28. Expresión de la información genética. La traducción AUG CCU CAU AGU GGC UAA ARN
  • 29. Expresión de la información genética. La traducción Aquí se observa como varios ribosomas trabajan a la vez para conseguir varias copias de la proteína.
  • 30. Expresión de la información genética. El código genético establece la relación que hay entre los tripletes de bases y los aminoácidos de las proteínas
  • 31. Expresión de la información genética. Deduce la secuencia de aminoácidos AUG CCU CAU AGU GGC UAA
  • 32. 3.-La replicación del ADN
    • La información genética debe ser transmitida de un individuo a
    • otro o, simplemente, de una célula a otra.
    • ¿Qué proceso celular garantiza que cada célula hija resultante
    • de una división celular recibe la misma información genética?
    • ¿Qué tiene que ocurrir previamente para que esto pueda
    • ocurrir?
    • ¿En qué fase del ciclo celular ocurre?
  • 33. La replicación del ADN
    • Es un proceso que tiene lugar durante la interfase
    • de la vida de la célula.
    • Es posible gracias a la complementariedad de bases
    • Ocurren dos acontecimientos claves:
      • Las dos cadenas que forman la molécula de ADN se
      • separan.
      • Cada una de las cadenas sirve de molde para la
      • formación de una nueva cadena
    ACCGTTAC TGGCAATG ACCGTTAC TGGCAATG TGGCAATG ACCGTTAC
  • 34. La replicación del ADN
  • 35. 4.-Las mutaciones
  • 36. Las mutaciones
  • 37. Las mutaciones