Your SlideShare is downloading. ×
  • Like
Biology final exam review
Upcoming SlideShare
Loading in...5
×

Thanks for flagging this SlideShare!

Oops! An error has occurred.

×

Now you can save presentations on your phone or tablet

Available for both IPhone and Android

Text the download link to your phone

Standard text messaging rates apply

Biology final exam review

  • 1,077 views
Published

 

Published in Technology
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Be the first to comment
No Downloads

Views

Total Views
1,077
On SlideShare
0
From Embeds
0
Number of Embeds
2

Actions

Shares
Downloads
9
Comments
0
Likes
1

Embeds 0

No embeds

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
    No notes for slide

Transcript

  • 1. Biology Final Exam Review Good Luck!!
  • 2. Chapter 8 Karyotypes• Examine, determine sex, normal or not and justify why!
  • 3. Karyotype
  • 4. Chapter 9 Genetics• Punnett Squares: set one up, complete it and determine ratios and percents.• Genotype of Parents:• Heterozygous: Aa• Phenotype of Parents:• Dominant• Offspring Ratios:• ¼ AA, 2/4 Aa, ¼ aa• Homozygous Dominant• Heterozygous• Homozygous Recessive
  • 5. Chapter 9 vocabulary• Genotype: genetic make-up, example: Rr, BB• Phenotype: physical appearance, Round, blue• Homozygous: 2 alleles are the same: BB• Heterozygous: 2 alleles are different: Rr• Dominant: allele masks the presence of another (capital letter). Only have to have one to exhibit the trait.• Recessive: is masked by the presence of another allele (lower case). Need to have two to exhibit the trait (homozygous)
  • 6. Chapter 10DNA: Deoxyribonucleic Acid RNA: Ribonucleic Acid• 2 Strands • 1 strand• Twisted ladder • mRNA: straight• Double helix (messenger)• A-T and C-G • tRNA: hairpin (transfer)• Codes for amino acid • rRNA: globular (ribosomes) sequence (instructions for building proteins) • A-U and C-G• Never leaves nucleus • Carries directions from DNA• Discovered by Watson and in Nucleus out to cell Crick
  • 7. Chapter 10• Codons: code for amino acids, sequence of 3 nucleotides of mRNA• AACUUGCAUGGUACCGGUAUCCUA• Use table to find amino acid sequence (codon bingo)
  • 8. Ch. 12 Pedigrees• Fully shaded: Has disorder• Half shaded: Carries allele for trait (or has it if the trait is dominant)• Unshaded: Does not have trait• Use info to construct Punnett Squares• Marriage, cousins, siblings, generations, etc.
  • 9. Ch. 12 Sex-linked inheritance• Hemophilia: blood clotting disorder• Carried on X chromosome.• Phenotypes and Genotypes• Why is it rare for females to have hemophilia?
  • 10. Ch. 12 Sex-linked Inheritance• Notation for Sex-linked traits use Sex Chromosomes XX or XY.• Muscular Dystrophy, Color Blindness are SL.
  • 11. Ch. 12 Genetic Disorders• Non-disjunction: copies of chromosomes do not properly separate during meiosis.• Result: gametes (egg or sperm) have either an extra copy of a chromosome or are missing a chromosome.
  • 12. Ch. 12 Genetic Disorders• Extra copy of a chromosome = Trisomy• Examples of Trisomy: Trisomy 21 = Down syndrome, XXY Klinefelter’s Syndrome• Missing copy of a chromosome = Monosomy• Example of Monosomy: X _ = Turner’s Syndrome
  • 13. Ch. 13. DNA Fingerprints• Investigators use them because EVERYONE (except identical twins) have unique DNA.• DNA fingerprints are the pattern of bands made up of specific fragments from an individuals DNA.• DNA fingerprints are collected by first collecting CELLS left at the crime scene by the suspect, DNA is in the nucleus of the CELLS!!
  • 14. Ch. 14 Biogenesis vs. Spontaneous GenerationRedi’s Experiment proved maggots from fliesControl Experimental
  • 15. Ch. 14 Biogenesis vs. Spontaneous Generation• Spallanzani killed the “vital force”• Control• Experimental
  • 16. Pasteur credit for disproving S.G.
  • 17. Ch. 14 Early Earth• Early ancestors of cyanobacteria (first autotrophic cells) put oxygen into atmosphere.• Performed photosynthesis.• First cells on Earth were prokaryotic and heterotrophic• Prokaryotic = single celled, small, no nucleus• Heterotrophic = eat for energy
  • 18. Ch. 15 Evolution• Darwin’s Finches: size and shape of beak related to food they eat.• Natural Selection: organisms with most successful traits survive, reproduce, pass favorable trait on to offspring. Number of members of population with favorable trait increase each generation.
  • 19. Chapter 16 Evolution Cont.• Speciation: process of species forming• Geographic Isolation: physical separation of member of a population, gene flow stops, each evolve into different species because pressures are different in each area.• Reproductive Isolation: barriers to successful breeding between population groups in the same area.
  • 20. Chapter 17 Amino Acid Sequences and Evolutionary Relationships• The greater the similarity between amino acid sequences (more in common) of two species the more closely related the two species are evolutionarily.• The longer the 2 species have been diverging (V) from a common ancestor, the greater the differences in sequences (less in common)
  • 21. Ch. 19 Environmental Issues• Global Warming: rise in average high temperatures around the world.• Greenhouse Effect: gases in the atmosphere (water vapor, carbon dioxide, methane) reflect heat and direct it back to Earth.
  • 22. Ch. 19 Environmental Issues• Hole in the Ozone: Ozone is needed to block UV Radiation from the sun. Hole leads to more cases of cancer. Discovered in 1985. Ban on use of ozone destroying chemicals like.• CFC’s (chloroflourocarbons)
  • 23. Ch. 19 important vocabulary• Abiotic Factor: non-living components in ecosystem. Examples: temperature, precipitation, landscape, minerals in soil, rocks.• Biotic Factor: living components in ecosystem.• Agricultural Revolution: increased, steady food supply lead to explosion of human population. Later medical advances and sanitation also contributed.
  • 24. Ch. 21• Competition (-,-)• Competitive Exclusion: 1 species is eliminated from a community because of competition for same limited resource. Example?• Resource Partitioning: when similar species co- exist, each uses only part of the available resource. Example?• Character Displacement: evolution of physical differences that reduce competition between similar species. Example?
  • 25. Ch. 21• Parasitism (+,-)• Parasite (+): Organism obtains nutrition at the expense of another organism. Example:• Host(-): organism that is being hurt or fed off of.
  • 26. Ch. 21• Predation (+,-)• Predator (+): obtains energy by eating another organism (plant or animal)• Prey (-): organism being eat by the predator.
  • 27. Ch. 21• Mutualism (+,+)• Interaction in which both species benefit.• Commensalism (+,0)• Interaction in which one species benefit and another is not affected.
  • 28. Ch. 21• Primary Succession: No soil exists, nothing growing, pioneer species grow, then herbs, then shrubs, then trees, then a mature forest.• Secondary Succession: Soil exists, climax community, disaster destroys ecosystem, pioneer species, herbs, shrubs, trees, mature forest.
  • 29. Ch. 22• Consumers are heterotrophs.• Carnivore eat meat. (secondary, tertiary)• Herbivore eat plants. (primary)• Omnivore eat both meat and plants. (secondary)• Producers: autotrophs, plants, produce own food with energy from the sun, perform photosynthesis.
  • 30. Ch. 22• Food webs: examine and determine relationships and domino effect
  • 31. Ch. 22• Biomes/Ecosystems: know characteristics• Tundra: cold, low biodiversity, found at poles.• Tiaga: south of poles, evergreen trees, less rain than here, colder.• Temperate Deciduous Forest: here, 4 seasons, trees lose leaves.• Grassland: less rain than here, 4 seasons, Nebraska.
  • 32. Ch. 22• Desert: Cold at night, little rain, hot daytime, found in interior of continents.• Savanna: Warm, wet and dry seasons, grasses• Tropical Rain Forest: year long growing season, steady rain, HIGHEST biodiversity, found near equator.
  • 33. Ch. 22 Biome Location
  • 34. Biodiversity• Highest in Tropical Rainforest.• Lowest in Tundra• Traveling from Equator to Tundra = to traveling up a mountain (peak like Tundra).
  • 35. Ethical• 1. pertaining to or dealing with morals or principles of morality; pertaining to right and wrong in conduct.• 2. being in accordance with the rules or standards for right conduct or practice, especially the standards of a profession: It was not considered ethical for physicians to advertise.• Think of it in terms of science and conducting research, experiments, studies.