DNA structure

745 views

Published on

Published in: Education
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
745
On SlideShare
0
From Embeds
0
Number of Embeds
2
Actions
Shares
0
Downloads
6
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

DNA structure

  1. 1. DNA Structure<br />1950s – James Watson & Francis Crick use molecular modeling to determine that DNA is a double helix<br />
  2. 2. DNA Structure<br />Each strand of DNA is made of linked nucleotides<br />Each nucleotide contains:<br />a phosphate group<br />a five-carbon sugar (deoxyribose) <br />a nitrogen-<br /> containing base<br />
  3. 3. Nitrogen-containing Bases<br />Adenine<br />Guanine<br />Thymine<br />Cytosine<br />Purines<br />(double ring)<br />Pyrimidines<br />(single ring)<br />
  4. 4.
  5. 5. What would happen if G paired up with A on the double helix?<br />Lumpy DNA! <br />The G and A are larger than the T and C because they are both double ring structures. A purine and a pyrimidine bond to one another for a uniform connection between the two strands of DNA. <br />
  6. 6. What is the complement to the sequence below:<br />ATTCGCTAATATATACCGCCG<br />TAAGCGATTATATATGGCGGC<br />
  7. 7. DNA Replication<br />One strand serves as a template, or pattern, on which the other strand is built<br />

×