• Share
  • Email
  • Embed
  • Like
  • Save
  • Private Content
DNA structure
 

DNA structure

on

  • 646 views

 

Statistics

Views

Total Views
646
Views on SlideShare
646
Embed Views
0

Actions

Likes
0
Downloads
5
Comments
0

0 Embeds 0

No embeds

Accessibility

Categories

Upload Details

Uploaded via as Microsoft PowerPoint

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

    DNA structure DNA structure Presentation Transcript

    • DNA Structure
      1950s – James Watson & Francis Crick use molecular modeling to determine that DNA is a double helix
    • DNA Structure
      Each strand of DNA is made of linked nucleotides
      Each nucleotide contains:
      a phosphate group
      a five-carbon sugar (deoxyribose)
      a nitrogen-
      containing base
    • Nitrogen-containing Bases
      Adenine
      Guanine
      Thymine
      Cytosine
      Purines
      (double ring)
      Pyrimidines
      (single ring)
    • What would happen if G paired up with A on the double helix?
      Lumpy DNA!
      The G and A are larger than the T and C because they are both double ring structures. A purine and a pyrimidine bond to one another for a uniform connection between the two strands of DNA.
    • What is the complement to the sequence below:
      ATTCGCTAATATATACCGCCG
      TAAGCGATTATATATGGCGGC
    • DNA Replication
      One strand serves as a template, or pattern, on which the other strand is built