1. Cryptosporidium Detection
Using a LAMP Method
Emily Wessling

2. PCR vs. LAMP
Method of Method of
amplifying amplifying DNA
DNA, using a using a uniform
change in temperature and
temperature to specialized DNA
separate and polymerase
anneal the primers It requires six
It requires one different primers
forward and one More specific
reverse primer

3. PCR vs. LAMP
Denaturation Constant
5’ 3’
5’ 3’ Temperature:
3’ 5’
3’ 5’
Annealing Looping of DNA for
5’ 3’
replication via
3’ 5’
multiple primers
Elongation
5’ 3’
3’ 5’
(see next few slides)

4. How does LAMP work?
First Primer binds
and DNA
polymerase
generates new
strand
Next Primer binds and displaces
the new DNA. DNA polymerase
generates new strand in the place
of the previously created one,
which dissociates
Note: the teal denotes the same
DNA sequence as the pink, just
another copy of it
Figure from EikenLAMP webpage: http://loopamp.eiken.co.jp/e/lamp/anim.html

5. How does LAMP work?
Now a similar thing
happens with the backward
primers.
Note: the newly created
strand is now the template
strand
The strands then separate and the
primers that were coded on the
ends anneal to themselves,
creating the start of the
LOOP STRUCTURE.
Figure from EikenLAMP webpage: http://loopamp.eiken.co.jp/e/lamp/anim.html

6. How does it work?
The process then repeats, generating longer
and longer chains of the target gene linked
together by the loop primers
Figure from EikenLAMP webpage: http://loopamp.eiken.co.jp/e/lamp/anim.html

7. How does it work?
Amplified
Forward Loops Amplified
Back Loops
 The process continues to repeat itself
generating longer chains of the target
gene, linked together by the loop
primer Multiple copies of
The Target Gene
Figure from EikenLAMP webpage: http://loopamp.eiken.co.jp/e/lamp/anim.html

8. Research Goal
To develop a method to detect parasites
that can be easily changed for any given
target parasite.
Initial target: Cryptosporidium

9. Cryptosporidium
Eukaryotic parasite
Infects the human gastrointestinal tract
Causes diarrhea
transmission stage in water is the oocyst
Especially dangerous for immune-
compromised individuals

10. Primers for Target Pathogen
 The 6 primers were named for the organism they they were
detecting and their position in the LAMP. They were ordered from
Invitrogen™.
 primers sequences were described in Momoda et al. (2009)
 CryFIP: forward initiating primer
 tacttaactcattccaattagaaaacccagggaggtagtgacaag
 CryBIP: back initiating primer
 ataaacccctttacaagtatcaatttatacgctattggagctgg
 CryF3: Forward separating primer
 gcgcaaattacccaatcc
 CryB3: Back separating primer
 actacgagctttttaactgc
 CryLF: Loop forward
 ccaaaaagtcctgtattg
 CryLB: Loop back
 gagggoaagtctggtg
Momoda et al. Sensitive and Rapid Detection of Crypto and Giardia by LAMP.
Journal of Japanese Society on Water Environment. 32.6.(321-324)

11. Two Modifications to
ThermoPol II (TP) Published Reagents Isothermal
Amplification (IA)
Isothermal Amplification Buffer:
ThermoPol II Reaction Buffer:
Reagents were altered due to availability 20 mMTris-HCl
20 mMTris-HCl
10 mM (NH4)2SO4
10 mM (NH4)2SO4 in USA. Red denotes deviations from the 50 mMKCl
10 mMKCl
0.1% Triton X-100 Momoda et al. paper. 2 mM MgSO4
0.1% Tween-20
Momoda et al. Sensitive and Rapid Detection of Crypto and Giardia by LAMP.
Journal of Japanese Society on Water Environment. 32.6.(321-324)

12. Results
 The one positive from TP is likely an unknown strain
of Cryptosporidium. The other two samples were
both C. parvum. 100 BP
Ladder
 Further research TP-1
needed to determine if TP-2
TP-3
TP is useful in
detecting specific TP-4 (-)
strains of IA-1
Cryptosporidium, as IA-2
opposed to IA which IA-3
IA-4 (-)
appears to detect a 100 BP
broader spectrum. Ladder
50 BP
Ladder

13. Results: 1st Restriction Digest
Restriction Enzyme Where it Cuts Did it Cut?
Xba I Outside target region on the gene No
Rsa I Outside target region on the gene No
Alu I Within target region Yes
Bst NI Within target region Yes
A restriction digest was performed to
determine if the entire 18S RNA Gene or only
part of it was amplified.

14. Results: Restriction Digest
created by
50 BP
AluI indicates that Ladder
the entire gene 100 BP
was not amplified Ladder
500 BP
indicate an Ladder
incomplete
digest Uncut
BstNI resembles Xba I
both the
and a
Rsa I
.
Alu I
Xba I and Rsa I
both match the Bst NI
uncut banding
pattern
Future Work: Digest for longer or with a greater enzyme : DNA ratio

15. Future Work
 EtBr is often used for visualization
 EtBr is carcinogenic
 its disposal in the field is difficult
In order to streamline LAMP for field
research, I sought out alternative
visualization methods. These methods are
the next step in establishing LAMP as a field
safe method of detection of parasites.

16. Field-Safe Visualization
SYBR® Safe via blue light (470 nm)
Safe Imager™ Poly Stylus
The Poly Stylus will be used as a small,
cost-conscious, portable alternative to the
Safe Imager™
Left Image from invitrogent.com: Right Image from newegg.com:
Safe Imager™ 2.0 Blue Light Transilluminator Item#: 9SIA06L0564887

17. Field-Safe Visualization
Field Spectrophotometer: another
detection method to test.
A field safe spectrophotometer
has the potential to detect the
turbidity of the sample in the
field, and thus is a more
expensive, but feasible
solution to field detection
Image from SelectScience.net:
DR 2800 Portable Spectrophotometer
from Hatch Company

18. Conclusions
 Isothermal Amplification buffer is better for
the detection of a wide range of strains of
Cryptosoporidium than ThermoPol III buffer
 Where to go from here?
 Detection threshold spectrophotometer and
SYBR® Safe visualization
 Concentration gradient for detection
Find minimum detection level
 Attempt with fecal extraction/water recovery

19. A Special Thanks to:
The Bowman Lab
of Cornell University