2012 10-24 - ngs webinar

  • 100 views
Uploaded on

 

  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Be the first to comment
    Be the first to like this
No Downloads

Views

Total Views
100
On Slideshare
0
From Embeds
0
Number of Embeds
0

Actions

Shares
Downloads
1
Comments
0
Likes
0

Embeds 0

No embeds

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
    No notes for slide

Transcript

  • 1. Sample & Assay Technologies GeneRead DNAseq Targeted Exon Enrichment & GeneRead Library Quantification System for Next Generation Sequencing Shankar Sellappan, Ph.D. Global Product Manager Shankar.Sellappan@QIAGEN.com 1
  • 2. Sample & Assay Technologies Pathway-Focused Analysis Tools 2
  • 3. Sample & Assay Technologies GeneRead DNAseq & Library Quant NGS System Agenda  Introduction  Targeted Enrichment  Workflow  Principles  Data Analysis  Pathway Content  Performance Data  Application Example  Library Quantification  Workflow  Application Example  Summary 3
  • 4. Sample & Assay Technologies Individual participants Cell cycle P53 MDM2 Cyclins CDKs Biological Markers Define Biological Processes Angiogenesis VEGF bFGF ANGPT PDGF Inflammation IL8 TLR IFNγ TNFβ 4
  • 5. Sample & Assay Technologies Complete Biological Story Built on Pathway / Network Analysis Angiogenesis Inflammation Pathway Cell cycle 5
  • 6. Sample & Assay Technologies Patient sample = Wild-type = Determining DNA Differences ATGCCATCTGGGACGGGTCAGTAG ATGCCATCTGTGACGGGTCAGTAG How could that SINGLE base difference make the person sick? Let’s look at the amino acids that are translated in both samples: Patient sample DNA = Amino Acid Sequence = ATG CCA TCT GGG ACG GGT CAG TAG Met P S G T G Q Stop Valine Glycine Compare the two amino acid sequences: Patient sample AA Sequence = Wild-Type AA Sequence = Met P S G T G Q Stop Met P S V T G Q Stop If the wild-type protein, with the Valine positioned here, looked like: and in the patient sample, it is a Glycine, and it looks like: Well….the protein just won’t work. 6
  • 7. Sample & Assay Technologies What is NGS (Next Generation Sequencing)? Massively Paralleled Sequencing Instead of sequencing a DNA sequence from Sequence many small pieces at the same time 7
  • 8. Sample & Assay Technologies When doing NGS analysis, what are you looking for? Easy-to-use workflow and Data output Detection of Low Prevalence Somatic Mutation in FFPE Lung Adenocarcinoma Sample Human Lung Cancer GeneRead DNASeq Gene panel was used to enrich 20 genes in genomic DNA isolated from three FFPE lung adenocarcinoma and one FFPE normal lung samples. Sequencing data was analyzed using QIAGEN NGS Data Analysis Web Portal and high quality variants were filtered. 8
  • 9. Sample & Assay Technologies Your NGS research needs  Identify low frequency DNA mutation variants  Work with low quality DNA samples, such as FFPE samples  Focus efforts on a focused set of genes important to their research  Simple methodology to make variant calls  Selective sequencing saves sequencing capacity 9
  • 10. Sample & Assay Technologies Traditional NGS Workflow Isolate DNA Library Prep & Quantification NGS Sequence Analysis & Variant ID • Whole genome analysis • Too much irrelevant data • Poor quality reads / coverage 10
  • 11. Sample & Assay Technologies New NGS Workflow with Targeted Enrichment 80 ng Achieve more sensitive mutation detection with 1 additional step • Focused on your genes of interest • Why look at all 20,000 genes in the human genome when you are interested in only a few? • Enables deep sequencing to ID low frequency mutation / rare variants • Integrated controls to assess target enrichment 11
  • 12. Sample & Assay Technologies Target Enrichment: Principles Multiplex PCR-enabled enrichment of gene of interest We provide primer sets that produce overlapping PCR products • For any gene or set of genes in the human genome Division of non-adjacent gene primer sets into 4 tubes increases amplification specificity. 12
  • 13. Sample & Assay Technologies Targeted Enrichment: Details ~ 150 bp PCR products 13
  • 14. Sample & Assay Technologies Complete Analysis Workflow With integrated controls to assess sample quality / TE process 14
  • 15. Sample & Assay Technologies NGS Sequence Analysis and Variant ID Software  FREE Complete & Easy to use Data Analysis with Web-based Software 15
  • 16. Sample & Assay Technologies Read Mode: Paired End vs Single End Goal: Increased # of Reads / Amplicon Sequence of Interest: TACGCATCGATGCGGTAACTGCTGATCGTCGTAGTGCTAGCTGA Single End Sequencing: TACGCATCGATGCGGTAACTGCTGATCGTCGTAGTGCTAGCTGA Paired End Sequencing (both ends are sequenced): TACGCATCGATGCGGTAACTGCTGATCGTCGTAGTGCTAGCTGA AGTCGATCGTGATGCTGCTAGTCGTCAATGGCGTAGCTACGCAT
  • 17. Sample & Assay Technologies How Genes on Panels Are Selected  Comprehensive Cancer Panel (124 genes)  Disease Focused Gene Panels (20 genes)  Breast cancer Liver cancer  Colon Cancer Lung Cancer  Gastric cancer Ovarian Cancer  Leukemia Prostate Cancer  Genes with High Relevance  Biologically relevant gene content  Clinically relevant: Published association with the disease state – Multiple Publically accessible databases – Text mining tools – Manually curated  Genes Involved in Disease ALSO AVAILABLE: Custom Panels from ANY GENE or COLLECTION OF GENES in Human Genome Technically relevant gene content  Most frequently mutated genes  Specific feedback from the thought leaders 17
  • 18. Sample & Assay Technologies Targeted Enrichment: Panel Information
  • 19. Sample & Assay Technologies Targeted Enrichment: Panel Information
  • 20. Sample & Assay Technologies NGS Target Enrichment Design Strategy Commonly encountered issues solved by GeneRead Algorithm • Design Coverage • How much of the gene is covered by your amplicons • Sequence Coverage Uniformity • How much ease base pair is covered: Ideally, it should be uniform • Specificity • % of reads mapped back to your sequence of interest 20
  • 21. Sample & Assay Technologies GeneRead DNAseq Gene Panel: Performance data % Covered by Design Design coverage GeneRead DNAseq Custom Panel GeneRead DNAseq Lung Cancer Panel GeneRead DNAseq Comprehensive Cancer Panel Discover more potential variants by covering more exons for genes of interest in assay design 21
  • 22. Sample & Assay Technologies GeneRead DNAseq Gene Panel: Performance data Sequence coverage uniformity GeneRead DNAseq Custom Panel GeneRead DNAseq Lung Cancer Panel GeneRead DNAseq Comprehensive Cancer Panel More bases sequenced above minimum read depth, generating more high-quality consensus calls. 22
  • 23. Sample & Assay Technologies GeneRead DNAseq Gene Panel: Performance data Specificity (% on-target reads) Specificity (On-target reads)* GeneRead DNAseq Custom Panel GeneRead DNAseq Lung Cancer Panel GeneRead DNAseq Comprehensive Cancer Panel No wasting of sequencing capacity * On-Target Reads= Number of reads on target out of total number of reads per run 23
  • 24. Sample & Assay Technologies DNAseq Gene Panel Application Data KRAS:G12V is present in all three FFPE lung adenocarcinomas Detection of Low Prevalence Somatic Mutation in FFPE Lung Adenocarcinoma Sample Human Lung Cancer GeneRead DNASeq Gene panel was used to enrich 20 genes in genomic DNA isolated from three FFPE lung adenocarcinoma and one FFPE normal lung samples. Sequencing data was analyzed using QIAGEN NGS Data Analysis Web Portal and high quality variants were filtered. NOTE: KRAS mutations confirmed by either Pyro or ARMS mutation assays (qBiomarker Somatic Mutation PCR Array) 24
  • 25. Sample & Assay Technologies Next-generation sequencing workflow Where does Library Quantification fit within the NGS workflow? Purification and amplification Sample enrichment Library preparation Next generation sequencing run Result verification (Optional) GeneRead (DNAseq) Library Quantification and QC System Why do you want to: 1. quantify their NGS DNA libraries 2. know the quality of their NGS DNA libraries?  You have to, in order to ensure high quality reads  Sequencing runs are expensive and time consuming, therefore, you want to ensure that downstream sequencing analyses are performed on samples of adequate quality for NGS technology. 25
  • 26. Sample & Assay Technologies Your needs Potential problems in NGS if library not quantified NGS methodology needs  Too much DNA  Mixed signals and un-resolvable data  Too little DNA  Reduced sequencing coverage  Reduced read depth  Empty runs  Increase cost per run  Wasted time Your needs  Simple and easy to perform method, with convenient and highthroughput format  Fast  Reliable and accurate quantification of sequencing targets  Unmet need: Assess quality of target enriched DNA  Efficient use of NGS capacity Potential methods for library QC  qPCR  Bioanalyzer  Qubit 26
  • 27. Sample & Assay Technologies Why choose qPCR for NGS Library Quantification? 1. BioAnalyzer measures total nucleic acids - Why is this a problem? 2. Low limit of detection 3. Consistency of results - For each technology, the greater the concentration of each sample (X-axis), the greater the # of clusters - This should be a linear relationship - Only qPCR provides this 27
  • 28. Sample & Assay Technologies NGS Library Quantification Made Easy Adapters can be quantified with qRT-PCR Step 1: You have your DNA (whole genome or target enriched) Step 2: You prepare the DNA library for NGS by adding (via ligation) NGS platformspecific adapters  NOTE: The adapters are short pieces of DNA Step 3: We provide you 2 reagents: 1. Pre-aliquoted dilutions of the standard 2. qPCR Primer Assays that detect the adapters Step 4: You perform qPCR with your sample. It should fall between our standard curve created with 5 sequential 10-fold dilutions. THAT is your library concentration to use in preparing your NGS analysis. 28
  • 29. Sample & Assay Technologies NGS Library Quantification Made Easy Adapters can be quantified with qRT-PCR Step 1: You have your DNA (whole genome or target enriched) Step 2: You prepare the DNA library for NGS by adding (via ligation) NGS platformspecific adapters  NOTE: The adapters are short pieces of DNA Step 3: We provide you 2 reagents: 1. Pre-aliquoted dilutions of the standard 2. qPCR Primer Assays that detect the adapters Step 4: You perform qPCR with your sample. It should fall between our standard curve created with 5 sequential 10-fold dilutions. THAT is your library concentration to use in preparing your NGS analysis. 29
  • 30. Sample & Assay Technologies GeneRead Library Quantification System NGS library quantification for any sequencing application , Ion Proton 30
  • 31. Sample & Assay Technologies GeneRead DNAseq & LQ System: Summary  Focused:  Biologically relevant content selection enables deep sequencing on relevant genes and identification of rare mutations  Flexible:  Mix and match any gene of interest  NGS platform independent:  Functionally validated for IT PGM, MiSeq/HiSeq  Integrated controls:  Enabling quality control of prepared library before sequencing  Free, complete and easy of use data analysis tool 31
  • 32. Sample & Assay Technologies GeneRead DNAseq Panel & Library Quant System for NGS Questions? Contact Technical Support: 9 AM – 6 PM M – F ET Contact: 1-800-742-4368 OR support@SABiosciences.com Shankar Sellappan, Ph.D. (Global Product Manager) Shankar.Sellappan@QIAGEN.com Ph.D. Trained Application Scientists  Available Before, During, and After Your Experiments for Consultation / Help 32