Brachybio!

Tiffany Fleming, Boyce Thompson Institute Charles Bender, Guilderland High School Kim LaCelle, Wheatland-Chili Central School Tom Brutnell, Associate Scientist, BTI Amanda Romag, Research Technician Hugues Barbier, Postdoctoral Associate Ying Rong, Research Technician BRACHYBIO! LINKING TEACHERS, STUDENTS AND SCIENTISTS IN PLANT RESEARCH

BrachyBio! Linking Teachers, Students and Scientists in Plant Research
BrachyBio! Goals:
Bring real scientific research to science classrooms using plants
Create a mutually-beneficial partnership where all groups are able to learn with and from one another to advance scientific understanding of plants
Demonstrate to students and teachers that scientific inquiry is relevant and can be used to solve important social and environmental problems

BrachyBio! Goals Bring real scientific topics to the classroom Students can understand the importance of plant science by relating to the roles that plants play in their daily lives as sources of food and energy. Maize Wheat Rice Barley

BrachyBio! Goals Partnership: Teachers, Scientists, Students Students Learning Objectives Scientist Research Objectives
Students make Discoveries!
Standardize experimental conditions
Make observations and collect data
Record and share results
Topics: Biology, genetics, environmental science, agriculture
Create a library of brachy data
Share data with the research community
Use data as a tool for investigating cereal crops

BrachyBio! Goals Scientific inquiry can help solve important social & environmental problems Current Plant Science Research Challenge Meet the population’s demand for food

Meeting Agricultural Research Goals Maize Wheat Rice Barley Large plants Long growing seasons with specific growth requirements Regulated food crops

Brachypodium distachyon A Model System
Brachypodium distachyon , is a small, fast-growing grass related to rice, wheat, barley, oats and other important grain crops.
Self fertilizing; goes form seed to seed in 6-8 weeks
Requires minimal care
One of the smallest of all of the grass species genomes sequenced to date (only 272 million base pairs)
DNA can be easily mutated through standard plant breeding methods
Model system for engineering C4 photosystem traits into C3 plants

C 4 C 3 Common descent Maize 2.5 billion bp Rice 420 million bp Wheat 17 billion bp Brachy 270 million bp Setaria 510 million bp Phylogeny of the grasses

Phylogeny of the grasses Slide courtesy of Toby Kellogg

DNA: The Molecule of Life DNA Sequence Observable Phenotype Genes Color, Architecture, Disease Resistance, Etc

DNA: The Molecule of Life DNA Sequence Observable Phenotype Genes Color, Architecture, Disease Resistance, Etc CCCTTGATATGCTGCACGACGT Plant trait?

GATCGTCGACCGGTGC CTAGCAGCTGGCCACG GATCGTCGACC A GTGC CTAGCAGCTGG T CACG Mutagenesis Ethyl Methanesulfonate (EMS) CH3SO3C2H5 Produces random mutations in genetic material by nucleotide substitution

BTI Scientists Treat Seeds with EMS and build mutant seed populations Generation 1 Brachy Seeds Generations 1 Plant Gerations 3 seed population Grow M1 & Harvest Overnight EMS Treatment + GA Plant M2 Harvest seeds Generations 2 plants BrachyBio! Seed Stock

Students Find and Catalogue Mutants Family #000931 Phenotype Category Phenotype Subcategory Mutant Descriptions First Screen Family # #mutants #germinated Color White Albino 00931 3/12 Architecture Size Small 00931 3/12

Students find and Catalog Mutants
Pale Green Mutant
Variegated Mutant & Early Flowering

Pigmentation related to photosynthetic pathways may be applied towards understanding photosynthetic development.
Discuss Applications of Mutant Phenotypes
Increased branching may contribute towards increased plant yields with potential applications in biofuel development.
Wild Type Pale Green Highly Branched
A majority of the plants will be wild type. These plants can be used for many additional lessons in the classroom.

Students observe and record physical characteristics
Size
Coloration
Architecture
Flowering time
Tool for future gene discovery
Applicable to related cereal crops
Record and Share Data in the Mutant Library

Students Upload pictures in the Mutant Library 000874 Virescent Class/School name Scientists Can Access Library and Order Seeds Search: Virescent Results: 000874 Students join the Research Community

Professional Development for Science Teachers
Develop content knowledge in hard-to-teach topics like genetics, heredity, and photosynthesis
Work as an annual cohort to develop lesson plans that integrate new content knowledge into the existing curricula
Receive classroom support, web-based resources, and equipment to implement new lessons into their classrooms
Access to an online database where students can upload their data and compare it to data generated in classrooms across New York State.

Students: making discoveries that extend beyond the classroom
Students are making discoveries!
They work to standardize growth conditions and collect meta-data on environmental conditions like temperature, light, humidity.
They observe and catalog unique phenotypes caused by random genetic mutations in the DNA of Brachypodium plants.
Through a shared database, they have the opportunity to compare their results with other classrooms. They may discover how environmental differences influence phenotypic expression.
Wheatland Chili Middle School

Connecting to BTI Scientists
Student work is generating data that scientists will use to continue to breed and develop important food crops.
Students are exposed to agricultural issues and research in ways that are relevant and timely.

How do teachers bring BrachyBio! To their classrooms?
The BrachyBio! website ( www.bti.cornell.edu/brachybio ) and curriculum materials have been developed by teachers, scientists and science educators for use in the middle and high school science classroom. The curriculum may be taught as a stand-along unit, or integrated into existing units including genetics and heredity, photosynthesis, or growth and development, all using scientific inquiry.

Acknowledgements Tom Brutnell, Scientist Amanda Romag, Research Technician Hugues Barbier, Postdoctoral Associate Ying Rong, Research Technician Tiffany Fleming, Boyce Thompson Institute Charles Bender, Guilderland High School Kim LaCelle, Wheatland-Chili Central School

Brachybio!

by educationprojects

Accessibility

Categories

Upload Details

Usage Rights

Statistics

Brachybio! Presentation Transcript