Eagle Bioinformatics Symposium: 6. Fiona Nielsen, Privacy-preserving Data Access and Improved Data Reuse for Human Genomics Research - the DNAdigest initiative

  • 69 views
Uploaded on

Data sharing in the roadmap of the future of human genetics …

Data sharing in the roadmap of the future of human genetics
Why do the majority of genetic conditions still go undiagnosed on the molecular level? What does this have to do with data sharing? And why is data sharing in human genetics not as easy as setting up a dropbox of files to share with your colleagues? In this presentation Fiona will introduce some of the core difficulties related to data sharing in human genetics, including data privacy, consent for use, data security, and why finding a way around these road blocks is essential to unlock the promise of the genomic revolution for diagnostics and research in genetic diseases.
DNAdigest works to promote and enable easier and more efficient sharing of genomics data for research. We educate and engage our local and international community about the hurdles and dilemmas for data sharing as faced from the perspective of stakeholders in academia, industry and patient communities. As part of our work we are working with our community and supporters to prototype new mechanisms and concepts for data sharing and data access.

  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Be the first to comment
    Be the first to like this
No Downloads

Views

Total Views
69
On Slideshare
0
From Embeds
0
Number of Embeds
1

Actions

Shares
Downloads
0
Comments
0
Likes
0

Embeds 0

No embeds

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
    No notes for slide
  • The data tsunami. That’s us!
  • Latest prediction for 2015 based on the capacity of the planned delivery of HiSeqX systems for human genomes. Don’t panic!
  • Promises of genomic medicine
  • Rosy picture breaks when you cannot make sense of the data
  • There is no limit to the number of data analysis programs available, but there is a serious bottleneck in access to data for comparison, filtering and testing of hypotheses
  • Clinical pilot studies: max 25% WES and WGS enable diagnosisLittle overlap between interpretation, conclusion of different labs looking at the same dataClearly we are in an unwanted situation. Why is no more data available to provide evidence-based results?
  • Trade-off: details are necessary for data re-use!Advantage: access to complete datasets of genetics and medical dataDisadvantage: cumbersome, timeconsuming and slow processing of application for accessDisadvantage: difficult to discover the data you need
  • Not easy to discover dataNot easy to apply for access to dataNot easy to deal with bulk datasetsAs a consequence:Researchers do not cross-check their resultsData is not re-used for analysisResearchers duplicate existing workResults are published based on small sample sizeswhere
  • Collaborative approach
  • Collaborative approach
  • Allow more knowledge to be generated from data
  • Create new hope for genetic research

Transcript

  • 1. Secure the data – share the knowledge Fiona Nielsen, DNAdigest founder and CEO Eagle Genomics Symposium 2014.org
  • 2. !
  • 3. CATTATGCCAGAAGTAGAATGAGGTGGTGCAACAGTATAACCCTAACCCTAACCCTAACCCTAAC CCTAACCCTCTGAAAGTGGACCTATCAGCAGGATGTGGGTGGGAGCAGATTAGAGAATAAAAGCA GACTGCCTGAGCCAGCAGTGGCAACCCAATGGGGTCCCTTTCCATACTGTGGAAGCTTCGTTCTT TCACTCTTTGCAATAAATCTTGCTATTGCTCACTCTTTGGGTCCACACTGCCTTTATGAGCTGTG ACACTCACCGCAAAGGTCTGCAGCTTCACTCCTGAGCCAGTGAGACCACAACCCCACCAGAAAGA AGAAACTCAGAACACATCTGAACATCAGAAGAAACAAACTCCGGACGCGCCACCTTTAAGAACTG TAACACTCACCGCGAGGTTCCGCGTCTTCATTCTTGAAGTCAGTGAGACCAAGAACCCACCAATT CCAGACACACTAGGACCCTGAGACAACCCCTAGAAGAGCACCTGGTTGATAACCCAGTTCCCATC TGGGATTTAGGGGACCTGGACAGCCCGGAAAATGAGCTCCTCATCTCTAACCCAGTTCCCCTGTG GGGATTTAGGGGACCAGGGACAGCCCGTTGCATGAGCCCCTGGACTCTAACCCAGTTCCCTTCTG GAATTTAGGGGCCCTGGGACAGCCCTGTACATGAGCTCCTGGTCTGTAACACAGTTCCCCTGTGG GGATTTAGGGACTTGGGCCTTCTGTCTTTGGGATCTACTCTCTATGGGCCACACAGATATGTCTT CCAACTTCCCTACACAGGGGGGACTTCAAAGAGTGCCTTGAGCTGATCTGGTGATTGCTTTTTTG TACTGTTATTTATCTTATTCTTTTCATTGTGAGGTACTGATGCAAACACTTTGTACGAAAAGGTC TTTCTCATCTCGGGAGTCCCCGTCTATTTGTCCCGGTCCCTGTTAACCCAGTCCCCGACAGGAGC CCCTTCTGCACCTTGAGCTCTCACCACTCACCGTCCATCCAGCCCCAGCTCTGCCTGCAACCCAC CCATCCCTGGGACTCGGGCCTCCCCTCTCTAGTGGTCTGGTCATCAGGCCAGGGGCACGTGGAAG AAGCTATCGTGGCAAAGGGAGCAGTCATATCCCCAAAATCTGTGGTTGGTTTACCACCACCATGG AAACCCCAGGGTGGGACTCTAGTTTCAGGTTGGAGCTGAGCCCTGTCGGGAATGAGCTTTCCCCA GCTATGGCTTCTTGGGGCCCCTGTGCCCTGAGCTGTGTCTCCCAGCATCGGGTCCCCACCATGCA TATGGCCCACTCAGGCACAGTGCCGCGATGGCTGCATGCGTGAGGGGGGCCTGGGCCCAGGGCTG GGAGTCCTTTGTGTCTCATGGCCATGATTGTCCTTCCGAGTATGATATGGTGGCCAATTTCTTTT ATTCTGTCGTTCAGAGTGAGTAAATGATGTAGAGTTCATGCAGAAAAAAATACAACAAAAACCAA GGGAACATAGAATTGGAAAACGCGTCACAGCAATGAGTTAAATAGGTAACAAATTTCATCATTTG AAGAAAGACTTAGAGTGCCAAAAGTGCCTCTTAAGTCTCCTTTAAAAAGTAGCAAAATTCATCCC
  • 4. CATTATGCCAGAAGTAGAATGAGGTGGTGCAACAGTATAACCCTAACCCTAACCCTAACCCTAAC CCTAACCCTCTGAAAGTGGACCTATCAGCAGGATGTGGGTGGGAGCAGATTAGAGAATAAAAGCA GACTGCCTGAGCCAGCAGTGGCAACCCAATGGGGTCCCTTTCCATACTGTGGAAGCTTCGTTCTT TCACTCTTTGCAATAAATCTTGCTATTGCTCACTCTTTGGGTCCACACTGCCTTTATGAGCTGTG ACACTCACCGCAAAGGTCTGCAGCTTCACTCCTGAGCCAGTGAGACCACAACCCCACCAGAAAGA AGAAACTCAGAACACATCTGAACATCAGAAGAAACAAACTCCGGACGCGCCACCTTTAAGAACTG TAACACTCACCGCGAGGTTCCGCGTCTTCATTCTTGAAGTCAGTGAGACCAAGAACCCACCAATT CCAGACACACTAGGACCCTGAGACAACCCCTAGAAGAGCACCTGGTTGATAACCCAGTTCCCATC TGGGATTTAGGGGACCTGGACAGCCCGGAAAATGAGCTCCTCATCTCTAACCCAGTTCCCCTGTG GGGATTTAGGGGACCAGGGACAGCCCGTTGCATGAGCCCCTGGACTCTAACCCAGTTCCCTTCTG GAATTTAGGGGCCCTGGGACAGCCCTGTACATGAGCTCCTGGTCTGTAACACAGTTCCCCTGTGG GGATTTAGGGACTTGGGCCTTCTGTCTTTGGGATCTACTCTCTATGGGCCACACAGATATGTCTT CCAACTTCCCTACACAGGGGGGACTTCAAAGAGTGCCTTGAGCTGATCTGGTGATTGCTTTTTTG TACTGTTATTTATCTTATTCTTTTCATTGTGAGGTACTGATGCAAACACTTTGTACGAAAAGGTC TTTCTCATCTCGGGAGTCCCCGTCTATTTGTCCCGGTCCCTGTTAACCCAGTCCCCGACAGGAGC CCCTTCTGCACCTTGAGCTCTCACCACTCACCGTCCATCCAGCCCCAGCTCTGCCTGCAACCCAC CCATCCCTGGGACTCGGGCCTCCCCTCTCTAGTGGTCTGGTCATCAGGCCAGGGGCACGTGGAAG AAGCTATCGTGGCAAAGGGAGCAGTCATATCCCCAAAATCTGTGGTTGGTTTACCACCACCATGG AAACCCCAGGGTGGGACTCTAGTTTCAGGTTGGAGCTGAGCCCTGTCGGGAATGAGCTTTCCCCA GCTATGGCTTCTTGGGGCCCCTGTGCCCTGAGCTGTGTCTCCCAGCATCGGGTCCCCACCATGCA TATGGCCCACTCAGGCACAGTGCCGCGATGGCTGCATGCGTGAGGGGGGCCTGGGCCCAGGGCTG GGAGTCCTTTGTGTCTCATGGCCATGATTGTCCTTCCGAGTATGATATGGTGGCCAATTTCTTTT ATTCTGTCGTTCAGAGTGAGTAAATGATGTAGAGTTCATGCAGAAAAAAATACAACAAAAACCAA GGGAACATAGAATTGGAAAACGCGTCACAGCAATGAGTTAAATAGGTAACAAATTTCATCATTTG AAGAAAGACTTAGAGTGCCAAAAGTGCCTCTTAAGTCTCCTTTAAAAAGTAGCAAAATTCATCCC
  • 5. CATTATGCCAGAAGTAGAATGAGGTGGTGCAACAGTATAACCCTAACCCTAACCCTAACCCTAAC CCTAACCCTCTGAAAGTGGACCTATCAGCAGGATGTGGGTGGGAGCAGATTAGAGAATAAAAGCA GACTGCCTGAGCCAGCAGTGGCAACCCAATGGGGTCCCTTTCCATACTGTGGAAGCTTCGTTCTT TCACTCTTTGCAATAAATCTTGCTATTGCTCACTCTTTGGGTCCACACTGCCTTTATGAGCTGTG ACACTCACCGCAAAGGTCTGCAGCTTCACTCCTGAGCCAGTGAGACCACAACCCCACCAGAAAGA AGAAACTCAGAACACATCTGAACATCAGAAGAAACAAACTCCGGACGCGCCACCTTTAAGAACTG TAACACTCACCGCGAGGTTCCGCGTCTTCATTCTTGAAGTCAGTGAGACCAAGAACCCACCAATT CCAGACACACTAGGACCCTGAGACAACCCCTAGAAGAGCACCTGGTTGATAACCCAGTTCCCATC TGGGATTTAGGGGACCTGGACAGCCCGGAAAATGAGCTCCTCATCTCTAACCCAGTTCCCCTGTG GGGATTTAGGGGACCAGGGACAGCCCGTTGCATGAGCCCCTGGACTCTAACCCAGTTCCCTTCTG GAATTTAGGGGCCCTGGGACAGCCCTGTACATGAGCTCCTGGTCTGTAACACAGTTCCCCTGTGG GGATTTAGGGACTTGGGCCTTCTGTCTTTGGGATCTACTCTCTATGGGCCACACAGATATGTCTT CCAACTTCCCTACACAGGGGGGACTTCAAAGAGTGCCTTGAGCTGATCTGGTGATTGCTTTTTTG TACTGTTATTTATCTTATTCTTTTCATTGTGAGGTACTGATGCAAACACTTTGTACGAAAAGGTC TTTCTCATCTCGGGAGTCCCCGTCTATTTGTCCCGGTCCCTGTTAACCCAGTCCCCGACAGGAGC CCCTTCTGCACCTTGAGCTCTCACCACTCACCGTCCATCCAGCCCCAGCTCTGCCTGCAACCCAC CCATCCCTGGGACTCGGGCCTCCCCTCTCTAGTGGTCTGGTCATCAGGCCAGGGGCACGTGGAAG AAGCTATCGTGGCAAAGGGAGCAGTCATATCCCCAAAATCTGTGGTTGGTTTACCACCACCATGG AAACCCCAGGGTGGGACTCTAGTTTCAGGTTGGAGCTGAGCCCTGTCGGGAATGAGCTTTCCCCA GCTATGGCTTCTTGGGGCCCCTGTGCCCTGAGCTGTGTCTCCCAGCATCGGGTCCCCACCATGCA TATGGCCCACTCAGGCACAGTGCCGCGATGGCTGCATGCGTGAGGGGGGCCTGGGCCCAGGGCTG GGAGTCCTTTGTGTCTCATGGCCATGATTGTCCTTCCGAGTATGATATGGTGGCCAATTTCTTTT ATTCTGTCGTTCAGAGTGAGTAAATGATGTAGAGTTCATGCAGAAAAAAATACAACAAAAACCAA GGGAACATAGAATTGGAAAACGCGTCACAGCAATGAGTTAAATAGGTAACAAATTTCATCATTTG AAGAAAGACTTAGAGTGCCAAAAGTGCCTCTTAAGTCTCCTTTAAAAAGTAGCAAAATTCATCCC
  • 6. Why is no more data available to provide evidence-based results?
  • 7. Data Privacy vs Data Access Restricted access repositories Open access • Time-consuming deposit • Time-consuming access • Difficult to discover data • Requires consent for open access (PGP) or • Details removed (1k genomes)
  • 8. deadlock
  • 9. • Data discovery • Data access • Incentives You are invited!
  • 10. • Connectivity • Aggregation • Immediate access
  • 11. DEMO
  • 12. Secure the data – share the knowledge @DNAdigest Support our work at http://tiny.cc/funddna .org