• Like
  • Save
7. Exploiting whole genome sequencing for public health microbiology
Upcoming SlideShare
Loading in...5
×
 

7. Exploiting whole genome sequencing for public health microbiology

on

  • 876 views

Presented by Jonathan Green from Health Protection Agency. This is the seventh presentation from Eagle second symposium, held on 29th March 2012. ...

Presented by Jonathan Green from Health Protection Agency. This is the seventh presentation from Eagle second symposium, held on 29th March 2012.


Abstract:
"Next Generation Sequencing (NGS) represents a revolution in DNA sequencing technologies, making routine rapid analysis of the complete DNA sequence of viral and bacterial genomes a reality. It is already the case that microbiological investigations of any significant outbreak of infectious disease include whole genome sequencing (WGS) of a putative causative agent. for example pandemic influenza strains, MRSA and Acinetobacter baumannii.

The potential impact of these technologies on Organisations such as the HPA is far-reaching. The bioinformatics challenges of NGS and other 'omic technologies, in terms of IT infrastructure for the storage and management of the large amounts of data generated, are well-known but not resolved. A key challenge is how to ensure it has the appropriate workforce capability for the analysis of these data in order to best use the extracted information for public health purposes. This requires meaningful integration of 'omics data with other laboratory information pipelines, clinical datasets and surveillance systems which is a significant challenge. Public health microbiology is increasingly 'data-rich' and laboratory scientists are being required to spend more of their time on data analysis using desktop bioinformatics tools or working with bioinformaticians to deliver these analyses, and this will increase as automation replaces much of the current manual approach to development of data. This is likely to create a significant shift in the skill-mix required to deliver reference microbiology, epidemiology and surveillance. The need to enhance microbiology and to integrate molecular typing into International as well as national surveillance context is recognised as paramount and needs to be a component of the current strategy.The presentation will aim to describe the relevance and likely impact of these technologies on public health microbiology, to describe the challenges and the work being undertaken to provide a platform for further development."

Statistics

Views

Total Views
876
Views on SlideShare
874
Embed Views
2

Actions

Likes
1
Downloads
0
Comments
0

1 Embed 2

http://www.slashdocs.com 2

Accessibility

Upload Details

Uploaded via as Microsoft PowerPoint

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment
  • Turning to the methods… from a paper by Foxman et al, 2005 Optimistically has complete genome sequencing down as a typing method The case for sequenced-based methods is now well accepted The second thing, looking at these methods and their exotic acronyms is that you can’t help but be reminded…..
  • Timeliness: The recent emergence of NGS and subsequent technologies which are clearly already impacting on how we view and go about microbial investigations for surveillance and other purposes. This is not a ‘fad’, this is happening and will stay with us Important to explore what the vision look like and start making so important decisions
  • Interpret that we need these within the Agency as well as through collaborations
  • Should we store data centrally? Alternative is an assortment of servers containing data which may or may not have appropriate resilience However, you could argue that resilient, distributed interoperable databases within as well as outside the Agency is adequate.

7. Exploiting whole genome sequencing for public health microbiology 7. Exploiting whole genome sequencing for public health microbiology Presentation Transcript

  • HPA Colindale Infectious Disease Centre for the Health Protection Agency HPA Colindale carries out a broad spectrum of work relating to prevention of infectious disease.The remit of the Centre includes: • infectious disease surveillance, • providing specialist and reference microbiology and microbial epidemiology, • Research & Development • co-ordinating the investigation and cause of national and uncommon outbreaks, • helping advise government on the risks posed by various infections • Responding to international health alerts.
  • Exploiting whole genome sequencingfor public health microbiology • The Centre’s function • Public Health Microbiology - Current status • Potential Impact • Challenges
  • Bacterial Genome Size
  • Bacterial Diversity in the Tree of Life
  • Bacterial Genome Comparisons: Simultaneous comparison of two M.tuberculosis andshowing the Genome comparison of two Neisseria meningitidis strains one M.bovis inversions present throughout the genome strains.
  • Public Health Microbiology Why ‘Type’ Micro-organisms?• To relate individual cases to an outbreak of infectious disease.• To establish an association between an outbreak of food poisoning and a specific food vehicle• To trace the source of contaminants within a manufacturing process• To study variations in the pathogenicity, virulence and antibiotic resistance of individual strains within a species• To study the microbial ecology of complex communities• (To characterize microorganisms with important industrial/medical) applications Public Health Microbiology = Microbiological Molecular Epidemiology
  • serotyping
  • RFLP/PFGE
  • mlst: multi-locus sequence typing mlva: multi-locus vntr analysisAGCTAGTCTATGCGTACGTACGTACGTACGTACGTACGTACGTATAGCTAGAGAT AGCTAGTCTATGCGTACGTACGTACGTACGTACGTACGTATAGCTAGAGAT AGCTAGTCTATGCGTACGTACGTACGTACGTACGTATAGCTAGAGAT
  • Common Bacterial Typing MethodsModified from Foxman B etal, Epidemiol Perspect Innov. 2005; 2: 10.
  • Tracing International Spread of InfectionJohn Threlfall, Mike Hampton, Linda Ward, Bernard Rowe, LEP, CPHL 12
  • different levels of resolution affectour interpretation of an outbreak
  • if we could look at the WHOLE genome – of every isolate in an outbreak…
  • Where we are nowWHOLE GENOME SEQUENCING ISCHANGING THE WAY WE INVESTIGATEOUTBREAKS OF INFECTIOUS DISEASE.Any ‘significant’ outbreak is now almost certainlyto be investigated using WGSFurther impacts on how we deliver specialist andreference microbiology and surveillance.
  • Recent Outbreaks in the media• Improved our understanding of the organism.• May not necessarily directly inform management of the outbreak.• genomic data isn’t enough• good epi data is key to the reconstruction, as is an informed clinical perspective
  • Transmission of MDR A. baumanii fromMilitary to Civilian Patients in a UK hospital PubMed ID: 20299126
  • Global and Local Analysis of MRSA PubMed ID: 20093474
  • The Challenges How do we get these technologies as routine tools in reference microbiology labs?• Bench-level machines• Medium/high-trhoughput
  • Exploiting Whole Genome Sequencing in the HPAIn order to fully exploit these technologies, requirements include: –Appropriate access to the sequencing technology. –The technical capability to store, manage, integrate and provide analysis of data. –Developing an appropriately skilled staff through workforce planning and training.
  • Global Financial CrisisTimes of austerityAdopting new approaches requires comparative evaluationDevelopment funding required.
  • WGS Data and Information Management in Health Protection• Data storage• Data transfer• Processing and analysis of NGS data –Primary (Raw quality assurance) –Secondary (assembly, mapping) –Tertiary analysis(organism-centric question requiring custom solution)• Data integration (genomic, phenotypic, clinical, epidemiological, tertiary)• Public Health Analysis (combined epidemiological and laboratory data)
  • The Case for Centralised Storage of HPA-Generated NGS DataWhat the data user What the Agency needs needs • Effective use of IT resources• Reliable, fast easy • Protection against data access to data losses• Invisibly scalable • Ensure appropriate data security• Datasets stored • Fulfil Agency obligations to consistently make data available• Appropriate level of access control• No data corruption
  • Data Transfer•How do we move datasets around?• An additional capital cost of an NGS implementationto provide adequate network speeds between internaland external ‘hubs’•Learn from ‘compression research’ in parallelsciences: –Human genomics –Astronomy / Imaging sciences
  • Processing & Analysis: General Principles• Empower scientists to do as much of their own analysis as is possible.• Automate/outsource the routine/mundane e.g. assembly or reference pipelines (as long as it doesn’t compromise quality).• Develop custom bioinformatics tools for specific analysis requirements• As appropriate, make them generic and deliver via the web.• Network delivery but desktop-like performance!!
  • The Galaxy Interface Galaxy , a powerful web-based system for performing many common genomeanalysis tasks. Joint project with Eagle Genomics
  • The Inevitable Impact of These Disruptive Technologies:A paradigm shift in how we ‘do’ microbiology
  • Analytical Workflow in a significant Outbreak?
  • Some Direct Evidence rather than Inference Comprehensive high quality databases required.
  • Paradigm shift:• The laboratory workforce – >15% staff bioinformaticians/informaticians – Develop more multi-disciplinary teams to address public health problems – Develop academic programmes for next generation of public health microbiologist and epidemiologist• Recognise that scientific IT needs are distinct from ‘business needs (email etc) and of key importance.• THE ROLE OF THE AGENCY
  • The laboratory (Factory) of the future will have only two employees, a man and a dog. The man will be there to feed the dog. The dog will be there to keep the man from touching the equipment. Warren G BennisPlus an army of bioinformaticians Disclaimer: Other NGS platforms are available
  • Summary• Second and Third Generation Technologies are here to stay and increasingly they will impact on how we do public health microbiology and surveillance• WGS will be used as a component of any significant outbreak investigation and will be used as a routine method in large, technologically capable reference laboratories in the near future.• It will replace some but not all pre-existing techniques.• Planning of storage for immediate needs essential but planning in longer term more difficult due to flux in technology.• Data transmission bandwidth currently inadequate.• Paradigm shift in what we do and how we do it.