Molecular methods in diagnosis in occular infections
Upcoming SlideShare
Loading in...5
×
 

Molecular methods in diagnosis in occular infections

on

  • 2,315 views

Molecular methods in diagnosis in occular infections

Molecular methods in diagnosis in occular infections

Statistics

Views

Total Views
2,315
Views on SlideShare
2,315
Embed Views
0

Actions

Likes
0
Downloads
81
Comments
1

0 Embeds 0

No embeds

Accessibility

Categories

Upload Details

Uploaded via as Microsoft PowerPoint

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

Molecular methods in diagnosis in occular infections Molecular methods in diagnosis in occular infections Presentation Transcript

  • Molecular Methods inDiagnosis of Ocular Diseases Dr.T.V.Rao MD Dr.T.V.Rao MD 1
  • Eye most Complex Organ Dr.T.V.Rao MD 2
  • Ocular Microbiology an Emerging Science Ocular microbiology remains an applied science The advancements in molecular biology and the newer technologies pave way for better understanding of ocular diseases The developments have made major contributions in the control and probably even eradication of many types of eye infections Dr.T.V.Rao MD 3
  • From Biology to Molecular Biology Dr.T.V.Rao MD 4
  • Molecular Biology in Ocular Disorders Dr.T.V.Rao MD 5
  • Watson and Crick The structure of DNA was described by British Scientists Watson and Crick as long double helix shaped with its sugar phosphate backbone on the outside and its bases on inside; the two strand of helix run in opposite direction and are anti-parallel to each other. The DNA double helix is stabilized by hydrogen bonds between the bases Dr.T.V.Rao MD 6
  • Watson and Crick discovers DNA Feb 28th 1953 Dr.T.V.Rao MD 7
  • DNA A purine always links with a pyrimidine base to maintain the structure of DNA. Adenine ( A ) binds to Thymine ( T ), with two hydrogen bonds between them. Guanine ( G ) binds to Cytosine ( C ), with three hydrogen bonds between them.Dr.T.V.Rao MD 8
  • Important Methods 1 Nucleic acidprobes 2 Hybridcapture 3 Branchedchain DNA 4 Situhybridization Dr.T.V.Rao MD 9
  • Nucleic acid probe Nucleic acid fragment, labelled by a radioisotope, biotin, etc., that is complementary to a sequence in another nucleic acid (fragment) and that will, by hydrogen binding to the latter, locate or identify it and be detected; a diagnostic technique based on the fact that every species of microbe possesses some unique nucleic acid sequences which differentiate it from all others, and can be used as identifying markers or "fingerprints." Dr.T.V.Rao MD 10
  • Hybridization probe Hybridization probe is a fragment of DNA or RNA of variable length (usually 100-1000 bases long), which is used to detect in DNA or RNA samples the presence of nucleotide sequences (the DNA target) that are complementary to the sequence in the probe. The probe thereby hybridizes to single-stranded nucleic acid (DNA or RNA) whose base sequence allows probe- target base pairing due to complementarily between the probe and target. Dr.T.V.Rao MD 11
  • Nucleic Acid Probes Accu probes from Gene probe, In which it contain Chemiluminescent label and target the rRNA of the Microorganisms of interest. It reads events in vivo or during the multiplication of organisms. Dr.T.V.Rao MD 12
  • DNA is Endless structure The rungs of the ladder can occur in any order (as long as the base- pair rule is followed) Those 4 bases have endless combinations just like the letters of the alphabet can combine to make different words. Dr.T.V.Rao MD 13
  • DNA Replication DNA replication is semi-conservative. That means that when it makes a copy, one half of the old strand is always kept in the new strand. This helps reduce the number of copy errors. So we remained what we were ? Dr.T.V.Rao MD 14
  • So we remained what we were Because of Genes Dr.T.V.Rao MD 15
  • DNA to RNA DNA remains in the nucleus, but in order for it to get its instructions translated into proteins, it must send its message to the ribosomes, where proteins are made. The chemical used to carry this message is Messenger RNA Dr.T.V.Rao MD 16
  • TYPES OF BLOTTING TECHNIQUES Blotting technique Southern Blot Northern Blot Western blotIt is used to detect DNA. It is used to detect RNA. It is used to detect protein. Dr.T.V.Rao MD 17
  • Nucleic Acid Hybridizations The hybridization of a radioactive probe to filter bound DNA or RNA is one of the most informative experiments that is performed in molecular genetics. Two basic types of hybridizations are possible. Southern hybridization - hybridization of a probe to filter bound DNA; the DNA is typically transferred to the filter from a gel Northern hybridization - hybridization of a probe to filter bound RNA; the RNA is typically transferred to the filter from a gel Dr.T.V.Rao MD 18
  • Western blotting Western blotting is an Immunoblot ing technique which rely on the specificity of binding between a molecule of interest and a probe to allow detection of the molecule of interest in a mixture of many other similar molecules. In Western blotting, the molecule of interest is a protein and the probe is typically an antibody raised against that particular protein. The SDS PAGE technique is a prerequisite for Western blotting . Dr.T.V.Rao MD 19
  • Western Blotting Dr.T.V.Rao MD 20
  • Restriction fragment length polymorphism Sir Alec Jeffreys developed restriction fragment length polymorphism (RFLP), which quickly became the standard technique for DNA testing throughout the 1980s. RFLP provided the world with the first form of genetic testing based on DNA, the bodys genetic material Dr.T.V.Rao MD 21
  • Restriction Fragment Length Polymorphism (RFLP) Restriction Fragment Length Polymorphism (RFLP) is a technique in which organisms may be differentiated by analysis of patterns derived from cleavage of their DNA. Dr.T.V.Rao MD 22
  • RFLP  The resulting DNA fragments are then separated by length through a process known as Agarose gel electrophoresis, and transferred to a membrane via the Southern blot procedure.Dr.T.V.Rao MD 23
  • Dr.T.V.Rao MD 24
  • Spoligotyping Spoligotyping, a new method for simultaneous detection and typing of M. tuberculosis complex bacteria, has been recently developed. This method is based on polymerase chain reaction (PCR) amplification of a highly polymorphic direct repeat locus in the M. tuberculosis genome. Dr.T.V.Rao MD 25
  • Spoligotyping in Tuberculosis The well-conserved 36- bp direct repeats are interspersed with unique spacer sequences varying from 35 to 41 bp in size. Clinical isolates of MTC bacteria can be differentiated by the presence or absence of one or more spacers. Dr.T.V.Rao MD 26
  • Results analyzed by Computer Dr.T.V.Rao MD 27
  • DNA finger printing Every one of our DNA is equal except for only about 0.10 %. DNA finger printing lies in uniqueness of those regions of DNA that do differ from person to person. Only 5 % of our DNA code rest do not code called in past as Junk DNA and contain repeated sequences of base pairs Called as Variable number of tandem repeats contain 20 to 100 base pairs and the same sequence is repeated one to 3 times in a row Dr.T.V.Rao MD 28
  • Documentation of Finger Printing for Records Finger print means translating all the variable number of tandem repeats to visible records All VNTR is tested for restriction length polymorphism which differ from species to species. All the obtained material is blotted to Nylon or Nitrocellulose membrane ( Southern Blotting ) Dr.T.V.Rao MD 29
  • RLFP to PCR Isolation of sufficient DNA for RFLP analysis is time-consuming and labour intensive. However, PCR can be used to amplify very small amounts of DNA, usually in 2-3 hours, to the levels required for RFLP analysis. Therefore, more samples can be analysed in a shorter time. Dr.T.V.Rao MD 30
  • Dr.T.V.Rao MD 31
  • Opportunistic Infections are Difficult to Diagnose Opportunistic pathogenic agents are increasingly encountered in ocular infections due to widespread use of topical and systemic immunosuppressive agents, increasing numbers of patients with (HIV) infection and with organ transplants who are on immunosuppressive therapy and cause ocular infections due to increased use of contact lens. Dr.T.V.Rao MD 32
  • Cataract Surgery Legal Implications The dreaded infections endophthalmitis following cataract extraction and lens implantation often are caused by opportunistic pathogens Dr.T.V.Rao MD 33
  • Diagnostic methods in microbiology Task of the method – to make the microorganism “visible” and “measureable” Difficult on several Occasions •Microscopy •Cultivation •Bio-testing •Immunological methods •Biochemical methods •Molecular methods Dr.T.V.Rao MD 34
  • Contact Lenses increasesOpportunistic Infections  These opportunistic pathogens also cause ocular infections due to increased use of contact lens. The dreaded infections endophthalmitis following cataract extraction and lens Dr.T.V.Rao MD 35
  • Collection of Optimal specimen is most Important Dr.T.V.Rao MD 36
  • Culturing Continues to be Less sensitive Culture of intraocular specimens is considered as the gold standard in the diagnosis of endophthalmitis. under the most appropriate care, traditional microbiological methods yield positive results in only 60-70% of the clinically typical cases of endophthalmitis. Dr.T.V.Rao MD 37
  • Prior Antibiotic therapy reduces the isolate rate Prior antibiotic therapy, small number of organisms in the samples, possible localized nature of infections in the lens capsule and fastidious growth requirement of the offending organisms, the organism not being recovered in roughly around 30-40% of the cases. Dr.T.V.Rao MD 38
  • Molecular diagnostics – how it works  Every organism contains some unique, species specific DNA sequences  Molecular diagnostics makes the species specific DNA visible Dr.T.V.Rao MD 39
  • PCR methods are rapid and sensitive PCR, as a specific, sensitive and rapid technique in the identification of the pathogen in the clinical specimen has been developed extensively over the past decade. Its value as a clinical tool is being increasingly recognized Dr.T.V.Rao MD 40
  • Polymerase Chain Reaction Methodology A Mile stone in Medical History  He had the idea to use a pair of primers to bracket the desired DNA sequence and to copy it using DNA polymerase, a technique which would allow a small strand of DNA to be copied almost an infinite number of times. Dr.T.V.Rao MD 41
  • Dr. Kary Mullis, wins Nobel Prize in 1993  Kary received a Nobel Prize in chemistry in 1993, for his invention of the polymerase chain reaction (PCR). The process, which Kary Mullis conceptualized in 1983, is hailed as one of the monumental scientific techniques of the twentieth century. Dr.T.V.Rao MD 42
  • Dr.T.V.Rao MD 43
  • PCR Liberates a Innocent Prisoner  KirkBloods worth case  A Waterman  Imprisoned for 9 years on wrong evidences of Rape  Unmatched DNA by PCR makes a freeman Dr.T.V.Rao MD 44
  • Locates Genes for Color Blindness Color Blind British John Dalton died in 1844 Request his eyes to be preserved And to be investigated why he confused scarlet with green, and pink with blue Recent PCR studies prove Dalton lacked a gene for making one of the three photo pigments essential for normal color vision. Dr.T.V.Rao MD 45
  • Color Blindness is x linked The genes for our red and green colour receptors are located on the X- chromosome, giving women a redundant set of receptor genes. This is why men are far more prone to colour- blindness than women. Dr.T.V.Rao MD 46
  • DNA – RNA - DNA In Molecular biology, the polymerase chain reaction (PCR) is a technique to amplify a single or few copies of a piece of DNA across several orders of magnitude, generating millions or more copies of a particular DNA sequence. Doctortvrao’s ‘e’ learning series Dr.T.V.Rao MD 47
  • Common Tools of Molecular Biology Nucleic acid fractionation Polymerase chain reaction Probes, Hybridization Vector, Molecular cloning Nucleic acid enzymes Microarray DNA sequencing Electrophoretic separation of nucleic acid Detection of genes: *DNA: Southern blotting; inSitu hybridization; FISH Technique *RNA: Northern blotting *Protein: Western blotting, immunohistochemistry Dr.T.V.Rao MD 48
  • Current Uses of molecular BiologyThe most recent applied technologies, genetic engineering, DNA finger-printing in the social and forensic science, pre and postnatal diagnosis of inherited disease, gene therapy and drug Design.Molecular biology allows the laboratory to be predictive in nature, it gives information that the patients may be at risk for disease (future). Major tool in Diagnosis of Infectious Dr.T.V.Rao MD 49
  • Restriction Endonuclease If two organisms differ in the distance between sites of cleavage of a particular restriction endonuclease, the length of the fragments produced will differ when the DNA is digested with a restriction enzyme. The similarity of the patterns generated can be used to differentiate species (and even strains) from one Dr.T.V.Rao MD 50
  • Restriction Endonuclease Restriction endonucleases are enzymes that cleave DNA molecules at specific nucleotide sequences depending on the particular enzyme used. Enzyme recognition sites are usually 4 to 6 base pairs in length. The recognition sequences are randomly distributed through the DNA and recognizes different nucleotide sequences, and snips through DNA molecule. Dr.T.V.Rao MD 51
  • Taq polymerase Taq polymerase is a thermostable DNA polymerase named after the thermophilic bacterium Thermus aquaticus from which it was originally isolated by Thomas D. Brock in 1965. It is often abbreviated to "Taq Pol" (or simply "Taq"), and is frequently used in polymerase chain reaction (PCR), methods for greatly amplifying short segments of DNA Dr.T.V.Rao MD 52 Doctortvrao’s ‘e’ learning series
  • Disadvantages of Taq Pol Taq mis-incorporates 1 base in 104. A 400 bp target will contain an error in 33% of molecules after 20 cycles. Error distribution will be random. Dr.T.V.Rao MD 53
  • Thermocycler is Back bone of PCR methodology The method relies on thermal cycling, consisting of cycles of repeated heating and cooling of the reaction for DNA melting and enzymatic replication of theDr.T.V.Rao MD 54
  • PCR - Three basic Steps Cut Paste Amplify Dr.T.V.Rao MD 55
  • PCR PrimersTTAACGGCCTTAA . . . TTTAAACCGGTTAATTGCCGGAATT . . . . . . . . . .>and <. . . . . . . . . . AAATTTGGCCAATTAACGGCCTTAA . . . TTTAAACCGGTT Dr.T.V.Rao MD 56
  • Cutting, pasting and amplifying is the basis of Reaction Dr.T.V.Rao MD 57
  • Denaturing Template Heat causes DNA strands to separate5’ 3’3’ 5’ Denature DNA strands 94oC5’ 3’3’ 5’ Dr.T.V.Rao MD 58
  • Annealing Primers •Primers bind to the template sequence •Taq Polymerase recognizes double-stranded substrate5’ 3’3’ 5’ Primers anneal 64oC5’ 3’ 5’ 3’ 3’ 5’3’ 5’ Dr.T.V.Rao MD 59
  • Taq Polymerase Extends •Taq Polymerase extends primer •DNA is replicated5’ 3’ 5’ 3’ 3’ 5’3’ 5’ Extend 72oC5’ 3’ 5’ 3’ 3’ 5’3’ 5’Repeat denaturing, annealing, and extending 30 cycles Dr.T.V.Rao MD 60
  • Molecular diagnostics is a set of methodsto study primary structure (sequence) of DNA •Hybridization with complementary sequences -A-A-T-T-C-G-C-G-A-T-G- - T-T-A-A-G-C-G-C-T-A-C- •Amplification (synthesis) of species specific sequences PCR – polymerase chain reaction -A-A-T-T-C-G-C-G-A-T-G- -A-A-T-T-C-G-C-G-A-T-G- -A-A-T-T-C-G-C-G-A-T-G- -A-A-T-T-C-G-C-G-A-T-G- -A-A-T-T-C-G-C-G-A-T-G- The 7th Baltic Congress in Laboratory Medicine, Pärnu 11.09.2004 Dr.T.V.Rao MD 61
  • PCR occurs in cycles and Multiplies the DNA Dr.T.V.Rao MD 62
  • Dr.T.V.Rao MD 63
  • Applications of PCRThe standard specimen procedure can quantitate HIV-1 RNA in a range of 400-75,000 copies/mL. Dr.T.V.Rao MD 64
  • Advantages of PCR Speed Ease of use Sensitivity Robustness Doctortvrao’s ‘e’ learning series Dr.T.V.Rao MD 65
  • Candida infections can be specifically identified The fragments of 125-bp (EO3) and 317 bp (HSP) specific for C. albicans were used for amplification. Dr.T.V.Rao MD 66
  • Molecular methods proving highly Sensitive  It has been postulated that DNA sequencing of the universal nested PCR product may allow identification of the causative organisms in a Dr.T.V.Rao MD number of culture 67
  • PCR helps in several critical Conditions PCR has also been evaluated in the diagnosis of fungal endophthalmitis using broad range primers as well as primers specific for C. albicans. Detection of fungal DNA by PCR in intraocular specimens will prove as a useful means of diagnosing endophthalmitis. It will greatly facilitate management decisions when conventional culture is negative. Dr.T.V.Rao MD 68
  • Dr.T.V.Rao MD 69
  • QIAGEN One Step RT-PCR Kit The QIAGEN One Step RT-PCR Kit is designed for easy and sensitive one-step RT-PCR using any RNA template. A unique enzyme combination and specially developed reaction buffer ensure efficient reverse transcription and PCR in one tube. Dr.T.V.Rao MD 70
  • RT-PCR in one stepThe Robus™ T I Kit is base  RobusT RT-PCR Kits perform cDNA synthesis and PCR amplification of cDNA successively in a single tube during a continuous thermal cycling Dr.T.V.Rao MD 71
  • Nested polymerase chain reaction Nested polymerase chain reaction is a modification of polymerase chain reaction intended to reduce the contamination in products due to the amplification of unexpected primer binding sites. Nested polymerase chain reaction involves two sets of primers, used in two successive runs of polymerase chain reaction, the second set intended to amplify a secondary target within the first run products Dr.T.V.Rao MD 72
  • Loop Mediated Isothermal Amplification (LAMP) Loop mediated isothermal amplification is a simple, rapid, specific and cost effective nucleic acid amplification method characterized by use of 8 distinct regions on the target gene. The amplification proceeds at a constant temperature using strand displacement reaction. Dr.T.V.Rao MD 73
  • Multiplex PCR  TaqMan probes and Molecular beacons allow multiple DNA species to be measured in the same sample ( Multiplex PCR) since fluorescent dyes with different emission spectra may be attached to different probes Dr.T.V.Rao MD 74
  • Multiplex PCR in Real Time Multiplex real time quantitative RT-PCR assays have been developed for simultaneous detection identification and quantification of HBV, HCV and HIV-! In plasma and Serum samples. Doctortvrao’s ‘e’ learning series Dr.T.V.Rao MD 75
  • Prevention of Contamination in PCR Laboratory PCR contamination be considered as a form of infection. If standard sterile techniques that would be applied to tissue culture or microbiological manipulations are applied to PCR, then the risk of contamination will be greatly reduced. Above all else, common sense should prevail. Dr.T.V.Rao MD 76
  • Advantages Molecular methods •High sensitivity and specificity •Detects pathogen, not immune response •Quick results •High transport tolerationIn-house (home-brew) PCR methods •Cost effective •High sensitivity R&D is absolutely necessary •High quality •Fast implementation of scientific discoveries •Customer friendly Doctortvrao’s ‘e’ learning series Dr.T.V.Rao MD 77
  • Polymerase Chain Reaction Available for several infections …. Chlamydia trachomatis Slow growing Mycobacterium tuberculosis viruses like Herpes simplex virus , Varicella Zoster virus . Adeno virus in our laboratory for corneal specimens Dr.T.V.Rao MD 78
  • Uses and Advantages in Testing by PCR Methods Clinical diagnostics: detection and quantification of infectious microorganisms, cancer cells and genetic disorders Capable of amplifying long targets, up to 6.0 kb One-tube system allows rapid, sensitive and reproducible analysis of RNA with minimal risk of sample contamination Amplifies products from a wide variety of total RNA or mRNA sources Dr.T.V.Rao MD 79
  • Disadvantages of PCR Methods Expensive to the Developing world Need well trained, Manpower Coordination for quality control Adoption to changing needs Timely technical support False positive results due to Amplifications Above all dedicated Staff Dr.T.V.Rao MD 80
  • Molecular Epidemiology in Eye Care In several world health funded projects molecular methods are used for 1 Plasmid analysis 2 Genomic fingerprinting 3 Emerging drug resistance 4 Polymerase chain reaction to identify emerging and remerging microbes, 5 Determination of antibiotic resistance patterns. Dr.T.V.Rao MD 81
  • Be Familiar with Molecular Biology or ??? Dr.T.V.Rao MD 82
  •  Programme Created by Dr.T.V.Rao MD for Awareness of Emerging Need for Molecular Methods in Laboratory Diagnosis  Email  doctortvrao@gmail.com Dr.T.V.Rao MD 83