Molecular Methods inDiagnosis of Ocular Diseases        Dr.T.V.Rao MD           Dr.T.V.Rao MD       1
Eye most Complex Organ         Dr.T.V.Rao MD   2
Ocular Microbiology an Emerging                Science   Ocular microbiology remains an    applied science The advancemen...
From Biology to Molecular Biology              Dr.T.V.Rao MD     4
Molecular Biology in Ocular        Disorders           Dr.T.V.Rao MD      5
Watson and Crick   The structure of DNA was described by    British Scientists Watson and Crick as long    double helix s...
Watson and Crick discovers DNA         Feb 28th 1953             Dr.T.V.Rao MD   7
DNA        A purine always links with a          pyrimidine base to          maintain the structure of          DNA.      ...
Important Methods 1 Nucleic acidprobes   2 Hybridcapture   3 Branchedchain DNA   4 Situhybridization                  Dr.T...
Nucleic acid probe   Nucleic acid fragment, labelled by a    radioisotope, biotin, etc., that is complementary to a    se...
Hybridization probe    Hybridization probe is a fragment of DNA or    RNA of variable length (usually 100-1000 bases    l...
Nucleic Acid Probes    Accu probes from Gene    probe, In which it    contain    Chemiluminescent label    and target the ...
DNA is Endless structure   The rungs of the ladder    can occur in any order    (as long as the base-    pair rule is fol...
DNA Replication   DNA replication is    semi-conservative.    That means that when    it makes a copy, one    half of the...
So we remained what we were      Because of Genes           Dr.T.V.Rao MD      15
DNA to RNA   DNA remains in the    nucleus, but in order for    it to get its instructions    translated into    proteins...
TYPES OF BLOTTING TECHNIQUES                               Blotting technique     Southern Blot               Northern Blo...
Nucleic Acid Hybridizations   The hybridization of a radioactive probe to    filter bound DNA or RNA is one of the most  ...
Western blotting   Western blotting is an Immunoblot ing technique    which rely on the specificity of binding between a ...
Western Blotting      Dr.T.V.Rao MD   20
Restriction fragment length             polymorphism   Sir Alec Jeffreys developed restriction    fragment length polymor...
Restriction Fragment Length       Polymorphism (RFLP)   Restriction Fragment    Length Polymorphism    (RFLP) is a techni...
RFLP                The resulting DNA                fragments are then                separated by length               ...
Dr.T.V.Rao MD   24
Spoligotyping   Spoligotyping, a new method for    simultaneous detection and typing of    M. tuberculosis complex bacter...
Spoligotyping in Tuberculosis   The well-conserved 36-    bp direct repeats are    interspersed with    unique spacer    ...
Results analyzed by Computer            Dr.T.V.Rao MD   27
DNA finger printing   Every one of our DNA is equal except for only about    0.10 %.   DNA finger printing lies in uniqu...
Documentation of Finger         Printing for Records   Finger print means translating all the    variable number of tande...
RLFP to PCR   Isolation of sufficient DNA for RFLP    analysis is time-consuming and    labour intensive. However, PCR ca...
Dr.T.V.Rao MD   31
Opportunistic Infections are       Difficult to Diagnose   Opportunistic pathogenic agents are    increasingly encountere...
Cataract Surgery Legal Implications   The dreaded    infections    endophthalmitis    following cataract    extraction an...
Diagnostic methods in microbiology  Task of the method – to make the microorganism            “visible” and “measureable” ...
Contact Lenses increasesOpportunistic Infections                        These opportunistic                         patho...
Collection of Optimal specimen is         most Important              Dr.T.V.Rao MD         36
Culturing Continues to be Less                  sensitive   Culture of intraocular    specimens is considered    as the g...
Prior Antibiotic therapy reduces the                 isolate rate   Prior antibiotic    therapy, small number of    organ...
Molecular diagnostics – how it works                              Every organism                               contains s...
PCR methods are rapid and             sensitive    PCR, as a    specific, sensitive and    rapid technique in the    iden...
Polymerase Chain Reaction Methodology    A Mile stone in Medical History                               He had the idea to...
Dr. Kary Mullis, wins Nobel Prize in                1993                              Kary received a Nobel              ...
Dr.T.V.Rao MD   43
PCR Liberates a Innocent       Prisoner                         KirkBloods worth case                         A Waterman...
Locates Genes for Color                Blindness   Color Blind British John    Dalton died in 1844   Request his eyes to...
Color Blindness is x linked   The genes for our red    and green colour    receptors are located    on the X-    chromoso...
DNA – RNA - DNA   In Molecular    biology, the    polymerase chain    reaction (PCR) is a    technique to amplify a    si...
Common Tools of Molecular             Biology   Nucleic acid fractionation   Polymerase chain reaction   Probes, Hybrid...
Current Uses of molecular BiologyThe most recent applied technologies, genetic  engineering, DNA finger-printing in the so...
Restriction Endonuclease   If two organisms differ in the distance    between sites of cleavage of a    particular restri...
Restriction Endonuclease   Restriction endonucleases are enzymes    that cleave DNA molecules at specific    nucleotide s...
Taq polymerase   Taq polymerase is a thermostable DNA    polymerase named after the thermophilic    bacterium Thermus aqu...
Disadvantages of Taq Pol    Taq mis-incorporates 1    base in 104.   A 400 bp target will    contain an error in 33%    ...
Thermocycler is Back bone of PCR                 methodology   The method relies    on thermal    cycling, consisting    ...
PCR - Three basic Steps Cut        Paste Amplify            Dr.T.V.Rao MD   55
PCR PrimersTTAACGGCCTTAA . . . TTTAAACCGGTTAATTGCCGGAATT . . . . . . . . . .>and        <. . . . . . . . . . AAATTTGGCCAAT...
Cutting, pasting and amplifying is      the basis of Reaction              Dr.T.V.Rao MD          57
Denaturing Template     Heat causes DNA strands to separate5’                                                 3’3’        ...
Annealing Primers     •Primers bind to the template sequence     •Taq Polymerase recognizes double-stranded substrate5’   ...
Taq Polymerase Extends      •Taq Polymerase extends primer      •DNA is replicated5’                                      ...
Molecular diagnostics is a set of methodsto study primary structure (sequence) of DNA •Hybridization with complementary se...
PCR occurs in cycles and Multiplies            the DNA               Dr.T.V.Rao MD          62
Dr.T.V.Rao MD   63
Applications of PCRThe standard specimen procedure can quantitate HIV-1 RNA in a range of 400-75,000 copies/mL.           ...
Advantages of PCR Speed Ease of use Sensitivity Robustness   Doctortvrao’s ‘e’ learning series                       ...
Candida infections can be specifically             identified The fragments of 125-bp (EO3) and 317 bp (HSP) specific for...
Molecular methods proving highly           Sensitive                            It has been                             p...
PCR helps in several critical                 Conditions   PCR has also been    evaluated in the diagnosis    of fungal e...
Dr.T.V.Rao MD   69
QIAGEN One Step RT-PCR Kit   The QIAGEN One Step    RT-PCR Kit is designed    for easy and sensitive    one-step RT-PCR u...
RT-PCR in one stepThe Robus™ T I Kit is base                         RobusT RT-PCR                          Kits perform ...
Nested polymerase chain reaction   Nested polymerase chain reaction is a    modification of polymerase chain reaction    ...
Loop Mediated Isothermal      Amplification (LAMP) Loop mediated isothermal  amplification is a  simple, rapid, specific ...
Multiplex PCR                   TaqMan probes and                    Molecular beacons                    allow multiple ...
Multiplex PCR in Real Time   Multiplex real time    quantitative RT-PCR    assays have been    developed for simultaneous...
Prevention of Contamination in PCR            Laboratory   PCR contamination be considered as    a form of infection. If ...
Advantages           Molecular methods     •High sensitivity and specificity     •Detects pathogen, not immune response   ...
Polymerase Chain Reaction Available     for several infections …. Chlamydia trachomatis Slow growing Mycobacterium  tube...
Uses and Advantages in Testing by              PCR Methods   Clinical diagnostics: detection and quantification of    inf...
Disadvantages of PCR Methods   Expensive to the Developing world   Need well trained, Manpower   Coordination for quali...
Molecular Epidemiology in Eye                Care   In several world health funded projects    molecular methods are used...
Be Familiar with Molecular     Biology or ???           Dr.T.V.Rao MD     82
   Programme Created by Dr.T.V.Rao MD     for Awareness of Emerging Need for       Molecular Methods in Laboratory       ...
Upcoming SlideShare
Loading in …5
×

Molecular methods in diagnosis in occular infections

3,079 views
2,884 views

Published on

Molecular methods in diagnosis in occular infections

Published in: Technology
1 Comment
1 Like
Statistics
Notes
No Downloads
Views
Total views
3,079
On SlideShare
0
From Embeds
0
Number of Embeds
0
Actions
Shares
0
Downloads
107
Comments
1
Likes
1
Embeds 0
No embeds

No notes for slide

Molecular methods in diagnosis in occular infections

  1. 1. Molecular Methods inDiagnosis of Ocular Diseases Dr.T.V.Rao MD Dr.T.V.Rao MD 1
  2. 2. Eye most Complex Organ Dr.T.V.Rao MD 2
  3. 3. Ocular Microbiology an Emerging Science Ocular microbiology remains an applied science The advancements in molecular biology and the newer technologies pave way for better understanding of ocular diseases The developments have made major contributions in the control and probably even eradication of many types of eye infections Dr.T.V.Rao MD 3
  4. 4. From Biology to Molecular Biology Dr.T.V.Rao MD 4
  5. 5. Molecular Biology in Ocular Disorders Dr.T.V.Rao MD 5
  6. 6. Watson and Crick The structure of DNA was described by British Scientists Watson and Crick as long double helix shaped with its sugar phosphate backbone on the outside and its bases on inside; the two strand of helix run in opposite direction and are anti-parallel to each other. The DNA double helix is stabilized by hydrogen bonds between the bases Dr.T.V.Rao MD 6
  7. 7. Watson and Crick discovers DNA Feb 28th 1953 Dr.T.V.Rao MD 7
  8. 8. DNA A purine always links with a pyrimidine base to maintain the structure of DNA. Adenine ( A ) binds to Thymine ( T ), with two hydrogen bonds between them. Guanine ( G ) binds to Cytosine ( C ), with three hydrogen bonds between them.Dr.T.V.Rao MD 8
  9. 9. Important Methods 1 Nucleic acidprobes 2 Hybridcapture 3 Branchedchain DNA 4 Situhybridization Dr.T.V.Rao MD 9
  10. 10. Nucleic acid probe Nucleic acid fragment, labelled by a radioisotope, biotin, etc., that is complementary to a sequence in another nucleic acid (fragment) and that will, by hydrogen binding to the latter, locate or identify it and be detected; a diagnostic technique based on the fact that every species of microbe possesses some unique nucleic acid sequences which differentiate it from all others, and can be used as identifying markers or "fingerprints." Dr.T.V.Rao MD 10
  11. 11. Hybridization probe Hybridization probe is a fragment of DNA or RNA of variable length (usually 100-1000 bases long), which is used to detect in DNA or RNA samples the presence of nucleotide sequences (the DNA target) that are complementary to the sequence in the probe. The probe thereby hybridizes to single-stranded nucleic acid (DNA or RNA) whose base sequence allows probe- target base pairing due to complementarily between the probe and target. Dr.T.V.Rao MD 11
  12. 12. Nucleic Acid Probes Accu probes from Gene probe, In which it contain Chemiluminescent label and target the rRNA of the Microorganisms of interest. It reads events in vivo or during the multiplication of organisms. Dr.T.V.Rao MD 12
  13. 13. DNA is Endless structure The rungs of the ladder can occur in any order (as long as the base- pair rule is followed) Those 4 bases have endless combinations just like the letters of the alphabet can combine to make different words. Dr.T.V.Rao MD 13
  14. 14. DNA Replication DNA replication is semi-conservative. That means that when it makes a copy, one half of the old strand is always kept in the new strand. This helps reduce the number of copy errors. So we remained what we were ? Dr.T.V.Rao MD 14
  15. 15. So we remained what we were Because of Genes Dr.T.V.Rao MD 15
  16. 16. DNA to RNA DNA remains in the nucleus, but in order for it to get its instructions translated into proteins, it must send its message to the ribosomes, where proteins are made. The chemical used to carry this message is Messenger RNA Dr.T.V.Rao MD 16
  17. 17. TYPES OF BLOTTING TECHNIQUES Blotting technique Southern Blot Northern Blot Western blotIt is used to detect DNA. It is used to detect RNA. It is used to detect protein. Dr.T.V.Rao MD 17
  18. 18. Nucleic Acid Hybridizations The hybridization of a radioactive probe to filter bound DNA or RNA is one of the most informative experiments that is performed in molecular genetics. Two basic types of hybridizations are possible. Southern hybridization - hybridization of a probe to filter bound DNA; the DNA is typically transferred to the filter from a gel Northern hybridization - hybridization of a probe to filter bound RNA; the RNA is typically transferred to the filter from a gel Dr.T.V.Rao MD 18
  19. 19. Western blotting Western blotting is an Immunoblot ing technique which rely on the specificity of binding between a molecule of interest and a probe to allow detection of the molecule of interest in a mixture of many other similar molecules. In Western blotting, the molecule of interest is a protein and the probe is typically an antibody raised against that particular protein. The SDS PAGE technique is a prerequisite for Western blotting . Dr.T.V.Rao MD 19
  20. 20. Western Blotting Dr.T.V.Rao MD 20
  21. 21. Restriction fragment length polymorphism Sir Alec Jeffreys developed restriction fragment length polymorphism (RFLP), which quickly became the standard technique for DNA testing throughout the 1980s. RFLP provided the world with the first form of genetic testing based on DNA, the bodys genetic material Dr.T.V.Rao MD 21
  22. 22. Restriction Fragment Length Polymorphism (RFLP) Restriction Fragment Length Polymorphism (RFLP) is a technique in which organisms may be differentiated by analysis of patterns derived from cleavage of their DNA. Dr.T.V.Rao MD 22
  23. 23. RFLP  The resulting DNA fragments are then separated by length through a process known as Agarose gel electrophoresis, and transferred to a membrane via the Southern blot procedure.Dr.T.V.Rao MD 23
  24. 24. Dr.T.V.Rao MD 24
  25. 25. Spoligotyping Spoligotyping, a new method for simultaneous detection and typing of M. tuberculosis complex bacteria, has been recently developed. This method is based on polymerase chain reaction (PCR) amplification of a highly polymorphic direct repeat locus in the M. tuberculosis genome. Dr.T.V.Rao MD 25
  26. 26. Spoligotyping in Tuberculosis The well-conserved 36- bp direct repeats are interspersed with unique spacer sequences varying from 35 to 41 bp in size. Clinical isolates of MTC bacteria can be differentiated by the presence or absence of one or more spacers. Dr.T.V.Rao MD 26
  27. 27. Results analyzed by Computer Dr.T.V.Rao MD 27
  28. 28. DNA finger printing Every one of our DNA is equal except for only about 0.10 %. DNA finger printing lies in uniqueness of those regions of DNA that do differ from person to person. Only 5 % of our DNA code rest do not code called in past as Junk DNA and contain repeated sequences of base pairs Called as Variable number of tandem repeats contain 20 to 100 base pairs and the same sequence is repeated one to 3 times in a row Dr.T.V.Rao MD 28
  29. 29. Documentation of Finger Printing for Records Finger print means translating all the variable number of tandem repeats to visible records All VNTR is tested for restriction length polymorphism which differ from species to species. All the obtained material is blotted to Nylon or Nitrocellulose membrane ( Southern Blotting ) Dr.T.V.Rao MD 29
  30. 30. RLFP to PCR Isolation of sufficient DNA for RFLP analysis is time-consuming and labour intensive. However, PCR can be used to amplify very small amounts of DNA, usually in 2-3 hours, to the levels required for RFLP analysis. Therefore, more samples can be analysed in a shorter time. Dr.T.V.Rao MD 30
  31. 31. Dr.T.V.Rao MD 31
  32. 32. Opportunistic Infections are Difficult to Diagnose Opportunistic pathogenic agents are increasingly encountered in ocular infections due to widespread use of topical and systemic immunosuppressive agents, increasing numbers of patients with (HIV) infection and with organ transplants who are on immunosuppressive therapy and cause ocular infections due to increased use of contact lens. Dr.T.V.Rao MD 32
  33. 33. Cataract Surgery Legal Implications The dreaded infections endophthalmitis following cataract extraction and lens implantation often are caused by opportunistic pathogens Dr.T.V.Rao MD 33
  34. 34. Diagnostic methods in microbiology Task of the method – to make the microorganism “visible” and “measureable” Difficult on several Occasions •Microscopy •Cultivation •Bio-testing •Immunological methods •Biochemical methods •Molecular methods Dr.T.V.Rao MD 34
  35. 35. Contact Lenses increasesOpportunistic Infections  These opportunistic pathogens also cause ocular infections due to increased use of contact lens. The dreaded infections endophthalmitis following cataract extraction and lens Dr.T.V.Rao MD 35
  36. 36. Collection of Optimal specimen is most Important Dr.T.V.Rao MD 36
  37. 37. Culturing Continues to be Less sensitive Culture of intraocular specimens is considered as the gold standard in the diagnosis of endophthalmitis. under the most appropriate care, traditional microbiological methods yield positive results in only 60-70% of the clinically typical cases of endophthalmitis. Dr.T.V.Rao MD 37
  38. 38. Prior Antibiotic therapy reduces the isolate rate Prior antibiotic therapy, small number of organisms in the samples, possible localized nature of infections in the lens capsule and fastidious growth requirement of the offending organisms, the organism not being recovered in roughly around 30-40% of the cases. Dr.T.V.Rao MD 38
  39. 39. Molecular diagnostics – how it works  Every organism contains some unique, species specific DNA sequences  Molecular diagnostics makes the species specific DNA visible Dr.T.V.Rao MD 39
  40. 40. PCR methods are rapid and sensitive PCR, as a specific, sensitive and rapid technique in the identification of the pathogen in the clinical specimen has been developed extensively over the past decade. Its value as a clinical tool is being increasingly recognized Dr.T.V.Rao MD 40
  41. 41. Polymerase Chain Reaction Methodology A Mile stone in Medical History  He had the idea to use a pair of primers to bracket the desired DNA sequence and to copy it using DNA polymerase, a technique which would allow a small strand of DNA to be copied almost an infinite number of times. Dr.T.V.Rao MD 41
  42. 42. Dr. Kary Mullis, wins Nobel Prize in 1993  Kary received a Nobel Prize in chemistry in 1993, for his invention of the polymerase chain reaction (PCR). The process, which Kary Mullis conceptualized in 1983, is hailed as one of the monumental scientific techniques of the twentieth century. Dr.T.V.Rao MD 42
  43. 43. Dr.T.V.Rao MD 43
  44. 44. PCR Liberates a Innocent Prisoner  KirkBloods worth case  A Waterman  Imprisoned for 9 years on wrong evidences of Rape  Unmatched DNA by PCR makes a freeman Dr.T.V.Rao MD 44
  45. 45. Locates Genes for Color Blindness Color Blind British John Dalton died in 1844 Request his eyes to be preserved And to be investigated why he confused scarlet with green, and pink with blue Recent PCR studies prove Dalton lacked a gene for making one of the three photo pigments essential for normal color vision. Dr.T.V.Rao MD 45
  46. 46. Color Blindness is x linked The genes for our red and green colour receptors are located on the X- chromosome, giving women a redundant set of receptor genes. This is why men are far more prone to colour- blindness than women. Dr.T.V.Rao MD 46
  47. 47. DNA – RNA - DNA In Molecular biology, the polymerase chain reaction (PCR) is a technique to amplify a single or few copies of a piece of DNA across several orders of magnitude, generating millions or more copies of a particular DNA sequence. Doctortvrao’s ‘e’ learning series Dr.T.V.Rao MD 47
  48. 48. Common Tools of Molecular Biology Nucleic acid fractionation Polymerase chain reaction Probes, Hybridization Vector, Molecular cloning Nucleic acid enzymes Microarray DNA sequencing Electrophoretic separation of nucleic acid Detection of genes: *DNA: Southern blotting; inSitu hybridization; FISH Technique *RNA: Northern blotting *Protein: Western blotting, immunohistochemistry Dr.T.V.Rao MD 48
  49. 49. Current Uses of molecular BiologyThe most recent applied technologies, genetic engineering, DNA finger-printing in the social and forensic science, pre and postnatal diagnosis of inherited disease, gene therapy and drug Design.Molecular biology allows the laboratory to be predictive in nature, it gives information that the patients may be at risk for disease (future). Major tool in Diagnosis of Infectious Dr.T.V.Rao MD 49
  50. 50. Restriction Endonuclease If two organisms differ in the distance between sites of cleavage of a particular restriction endonuclease, the length of the fragments produced will differ when the DNA is digested with a restriction enzyme. The similarity of the patterns generated can be used to differentiate species (and even strains) from one Dr.T.V.Rao MD 50
  51. 51. Restriction Endonuclease Restriction endonucleases are enzymes that cleave DNA molecules at specific nucleotide sequences depending on the particular enzyme used. Enzyme recognition sites are usually 4 to 6 base pairs in length. The recognition sequences are randomly distributed through the DNA and recognizes different nucleotide sequences, and snips through DNA molecule. Dr.T.V.Rao MD 51
  52. 52. Taq polymerase Taq polymerase is a thermostable DNA polymerase named after the thermophilic bacterium Thermus aquaticus from which it was originally isolated by Thomas D. Brock in 1965. It is often abbreviated to "Taq Pol" (or simply "Taq"), and is frequently used in polymerase chain reaction (PCR), methods for greatly amplifying short segments of DNA Dr.T.V.Rao MD 52 Doctortvrao’s ‘e’ learning series
  53. 53. Disadvantages of Taq Pol Taq mis-incorporates 1 base in 104. A 400 bp target will contain an error in 33% of molecules after 20 cycles. Error distribution will be random. Dr.T.V.Rao MD 53
  54. 54. Thermocycler is Back bone of PCR methodology The method relies on thermal cycling, consisting of cycles of repeated heating and cooling of the reaction for DNA melting and enzymatic replication of theDr.T.V.Rao MD 54
  55. 55. PCR - Three basic Steps Cut Paste Amplify Dr.T.V.Rao MD 55
  56. 56. PCR PrimersTTAACGGCCTTAA . . . TTTAAACCGGTTAATTGCCGGAATT . . . . . . . . . .>and <. . . . . . . . . . AAATTTGGCCAATTAACGGCCTTAA . . . TTTAAACCGGTT Dr.T.V.Rao MD 56
  57. 57. Cutting, pasting and amplifying is the basis of Reaction Dr.T.V.Rao MD 57
  58. 58. Denaturing Template Heat causes DNA strands to separate5’ 3’3’ 5’ Denature DNA strands 94oC5’ 3’3’ 5’ Dr.T.V.Rao MD 58
  59. 59. Annealing Primers •Primers bind to the template sequence •Taq Polymerase recognizes double-stranded substrate5’ 3’3’ 5’ Primers anneal 64oC5’ 3’ 5’ 3’ 3’ 5’3’ 5’ Dr.T.V.Rao MD 59
  60. 60. Taq Polymerase Extends •Taq Polymerase extends primer •DNA is replicated5’ 3’ 5’ 3’ 3’ 5’3’ 5’ Extend 72oC5’ 3’ 5’ 3’ 3’ 5’3’ 5’Repeat denaturing, annealing, and extending 30 cycles Dr.T.V.Rao MD 60
  61. 61. Molecular diagnostics is a set of methodsto study primary structure (sequence) of DNA •Hybridization with complementary sequences -A-A-T-T-C-G-C-G-A-T-G- - T-T-A-A-G-C-G-C-T-A-C- •Amplification (synthesis) of species specific sequences PCR – polymerase chain reaction -A-A-T-T-C-G-C-G-A-T-G- -A-A-T-T-C-G-C-G-A-T-G- -A-A-T-T-C-G-C-G-A-T-G- -A-A-T-T-C-G-C-G-A-T-G- -A-A-T-T-C-G-C-G-A-T-G- The 7th Baltic Congress in Laboratory Medicine, Pärnu 11.09.2004 Dr.T.V.Rao MD 61
  62. 62. PCR occurs in cycles and Multiplies the DNA Dr.T.V.Rao MD 62
  63. 63. Dr.T.V.Rao MD 63
  64. 64. Applications of PCRThe standard specimen procedure can quantitate HIV-1 RNA in a range of 400-75,000 copies/mL. Dr.T.V.Rao MD 64
  65. 65. Advantages of PCR Speed Ease of use Sensitivity Robustness Doctortvrao’s ‘e’ learning series Dr.T.V.Rao MD 65
  66. 66. Candida infections can be specifically identified The fragments of 125-bp (EO3) and 317 bp (HSP) specific for C. albicans were used for amplification. Dr.T.V.Rao MD 66
  67. 67. Molecular methods proving highly Sensitive  It has been postulated that DNA sequencing of the universal nested PCR product may allow identification of the causative organisms in a Dr.T.V.Rao MD number of culture 67
  68. 68. PCR helps in several critical Conditions PCR has also been evaluated in the diagnosis of fungal endophthalmitis using broad range primers as well as primers specific for C. albicans. Detection of fungal DNA by PCR in intraocular specimens will prove as a useful means of diagnosing endophthalmitis. It will greatly facilitate management decisions when conventional culture is negative. Dr.T.V.Rao MD 68
  69. 69. Dr.T.V.Rao MD 69
  70. 70. QIAGEN One Step RT-PCR Kit The QIAGEN One Step RT-PCR Kit is designed for easy and sensitive one-step RT-PCR using any RNA template. A unique enzyme combination and specially developed reaction buffer ensure efficient reverse transcription and PCR in one tube. Dr.T.V.Rao MD 70
  71. 71. RT-PCR in one stepThe Robus™ T I Kit is base  RobusT RT-PCR Kits perform cDNA synthesis and PCR amplification of cDNA successively in a single tube during a continuous thermal cycling Dr.T.V.Rao MD 71
  72. 72. Nested polymerase chain reaction Nested polymerase chain reaction is a modification of polymerase chain reaction intended to reduce the contamination in products due to the amplification of unexpected primer binding sites. Nested polymerase chain reaction involves two sets of primers, used in two successive runs of polymerase chain reaction, the second set intended to amplify a secondary target within the first run products Dr.T.V.Rao MD 72
  73. 73. Loop Mediated Isothermal Amplification (LAMP) Loop mediated isothermal amplification is a simple, rapid, specific and cost effective nucleic acid amplification method characterized by use of 8 distinct regions on the target gene. The amplification proceeds at a constant temperature using strand displacement reaction. Dr.T.V.Rao MD 73
  74. 74. Multiplex PCR  TaqMan probes and Molecular beacons allow multiple DNA species to be measured in the same sample ( Multiplex PCR) since fluorescent dyes with different emission spectra may be attached to different probes Dr.T.V.Rao MD 74
  75. 75. Multiplex PCR in Real Time Multiplex real time quantitative RT-PCR assays have been developed for simultaneous detection identification and quantification of HBV, HCV and HIV-! In plasma and Serum samples. Doctortvrao’s ‘e’ learning series Dr.T.V.Rao MD 75
  76. 76. Prevention of Contamination in PCR Laboratory PCR contamination be considered as a form of infection. If standard sterile techniques that would be applied to tissue culture or microbiological manipulations are applied to PCR, then the risk of contamination will be greatly reduced. Above all else, common sense should prevail. Dr.T.V.Rao MD 76
  77. 77. Advantages Molecular methods •High sensitivity and specificity •Detects pathogen, not immune response •Quick results •High transport tolerationIn-house (home-brew) PCR methods •Cost effective •High sensitivity R&D is absolutely necessary •High quality •Fast implementation of scientific discoveries •Customer friendly Doctortvrao’s ‘e’ learning series Dr.T.V.Rao MD 77
  78. 78. Polymerase Chain Reaction Available for several infections …. Chlamydia trachomatis Slow growing Mycobacterium tuberculosis viruses like Herpes simplex virus , Varicella Zoster virus . Adeno virus in our laboratory for corneal specimens Dr.T.V.Rao MD 78
  79. 79. Uses and Advantages in Testing by PCR Methods Clinical diagnostics: detection and quantification of infectious microorganisms, cancer cells and genetic disorders Capable of amplifying long targets, up to 6.0 kb One-tube system allows rapid, sensitive and reproducible analysis of RNA with minimal risk of sample contamination Amplifies products from a wide variety of total RNA or mRNA sources Dr.T.V.Rao MD 79
  80. 80. Disadvantages of PCR Methods Expensive to the Developing world Need well trained, Manpower Coordination for quality control Adoption to changing needs Timely technical support False positive results due to Amplifications Above all dedicated Staff Dr.T.V.Rao MD 80
  81. 81. Molecular Epidemiology in Eye Care In several world health funded projects molecular methods are used for 1 Plasmid analysis 2 Genomic fingerprinting 3 Emerging drug resistance 4 Polymerase chain reaction to identify emerging and remerging microbes, 5 Determination of antibiotic resistance patterns. Dr.T.V.Rao MD 81
  82. 82. Be Familiar with Molecular Biology or ??? Dr.T.V.Rao MD 82
  83. 83.  Programme Created by Dr.T.V.Rao MD for Awareness of Emerging Need for Molecular Methods in Laboratory Diagnosis  Email  doctortvrao@gmail.com Dr.T.V.Rao MD 83

×