0
POLYMERASE CHAIN REACTION                IN INFECTIOUS DISEASES                                     BASICS                ...
DR.KARY BANKS MULLIS                  DISCOVERY OF PCR• Dr.Kary Banks Mullis  received a Nobel Prize  in chemistry in 1993...
MOLECULAR MICROBIOLOGY• Molecular microbiology is     the branch of microbiology     devoted to the study of the     molec...
MOLECULAR BIOLOGY DEALS WITH                           • Molecular microbiology is                             primarily i...
MOLECULAR METHODS ARE                  REVOLUTIONIZING• The use of molecular biology techniques, such as nucleic acid  pro...
MOLECULAR METHODS IN DIAGNOSIS• The introduction of molecular methods will not only  depend on their performance for each ...
WHY USE A MOLECULAR TEST TO    DIAGNOSE AN INFECTIOUS DISEASE?• Need an accurate and  timely diagnosis      • Important fo...
WHEN WE REALLY NEED MOLECULAR             METHODS ?• Molecular diagnosis  is most appropriate  for infectious agents  that...
MOLECULAR BIOLOGY IS EMERGING IN       DIAGNOSTIC METHOD• Diagnostic microbiology is in the midst of a new era.  Rapid nuc...
LEADING USES FOR NUCLEIC ACID           BASED TESTS• Nonculturable agents      • Human papilloma virus      • Hepatitis B ...
LEADING USES FOR NUCLEIC ACID BASED                  TESTS• In situ detection of infectious  agents      • Helicobacter py...
MOLECULAR METHODS ARE NECESSARY IF THE  TRADITIONAL METHODS PROVIDE POOR RESULTS ?• Microscopy gives false positive result...
MOLECULAR DIAGNOSTICS              HOW IT WORKS?• Every organism  contains some  unique,species  specific DNA  sequences• ...
UNDERSTANDING THE BASIS OF     POLYMERASE CHAIN REACTIONDR.T.V.RAO MD                      14
DNA MOLECULE                       Adenine                       Thymine                       Guanine                    ...
OUTLINE1. DNA2. PCR      • Targets      • Denaturing      • Primers      • Annealing      • Cycles      • RequirementsDR.T...
DNA STRUCTURE• In double stranded linear DNA, 1 end of each strand  has a free 5’ carbon and phosphate and 1 end has a  fr...
DNADNA is a nucleic acid that  is composed of two  complementary  nucleotide building  block chains.The nucleotides are ma...
DNADNA has four nitrogen  bases.• Two are purines ( 2 ringed base )      • Adenine ( A ), Guanine        (G)• Two are pyri...
DNAThese four bases are  linked in a repeated  pattern by hydrogen  bonding between the  nitrogen bases.The linking of the...
DNAA purine always links with a   pyrimidine base to maintain the   structure of DNA.Adenine ( A ) binds to Thymine ( T ),...
DNAExample of bonding pattern.• Primary strand     CCGAATGGGATGC     GGCTTACCCTACG• Complementary strandDR.T.V.RAO MD     ...
Molecular diagnostics is a set of methodsto study primary structure (sequence) of DNA    •Hybridization with complementary...
PCR    PCR is a    technique that    takes a specific    sequence of DNA    of small amounts    and amplifies it to    be ...
PCR REQUIREMENTS• Magnesium chloride: .5-2.5mM• Buffer: pH 8.3-8.8• dNTPs: 20-200µM• Primers: 0.1-0.5µM• DNA Polymerase: 1...
PCR TARGETS    The targets in    PCR are the    sequences of DNA    on each end of the    region of interest,    which can...
PCR TARGETSThe number of bases in the  targets can vary.       TTAAGGCTCGA . . . .           AATTGGTTAAThe . . . . Represe...
PCR DENATURING    Denaturing is the    first step in PCR,    in which the    DNA strands are    separated by    heating to...
PCR PRIMERSPrimers range from 15 to 30 nucleotides, aresingle-stranded, and are used for thecomplementary building blocks ...
PCR PRIMERSTTAACGGCCTTAA . . . TTTAAACCGGTTAATTGCCGGAATT . . . . . . . . . .>and                   <. . . . . . . . . . AA...
PCR PRIMERSThe primers are  added in excess  so they will bind to  the target DNA  instead of the two  strands binding  ba...
PCR ANNEALINGAnnealing is the  process of allowing  two sequences of  DNA to form  hydrogen bonds.The annealing of the  ta...
PCR TAQ DNA POLYMERASETaq stands for Thermus   aquaticus, which is a   microbe found in 176°F hot   springs in Yellow Ston...
ESTABLISHMENT OF A PCR            LABORATORY• To perform PCR for the  repetitive detection of  a specific sequence,  three...
PCR laboratory  Sample handling                       QC & QA                                    Quality control &  DNA pr...
PCR IN CLINICAL MICROBIOLOGY• Molecular detection has  mostly come to the  clinical microbiology  laboratory in the form o...
HELPS RAPID DETECTIONTIMELY DIAGNOSIS CAN SAVE SEVERAL LIVES                           • Polymerase chain                 ...
UNDERSTANDING THE PCR CYCLEDR.T.V.RAO MD                    38
Isolation of Nucleic AcidsGoals:                       Types of Methods:• removal of proteins        • differential solubi...
High MW Genomic DNA IsolationTypical Procedure                  EtOH Precipitation1 Cell Lysis                            ...
High MW Genomic DNA IsolationTypical Procedure                  Phenol Extraction1 Cell Lysis                       • mix ...
PCR• The PCR reaction has three basic steps   • Denature – when you denature DNA, you separate it into single     strands ...
PCR    • The primer concentration is in excess of the template concentration.    • The excess primer concentration ensures...
PCR CYCLESDR.T.V.RAO MD                44
PCR• Most PCR  reaction use 25 to  30 of these cycles  to amplify the  target DNA up to a  million times the  starting  co...
PCR CYCLESDR.T.V.RAO MD                46
PCR      • Extension – during this stage of the PCR reaction, the DNA        polymerase will use dNTPs to synthesize DNA  ...
PCR CYCLESDR.T.V.RAO MD                48
PCR CYCLESDR.T.V.RAO MD                49
PCR CYCLESDR.T.V.RAO MD                50
PCR CYCLES REVIEW• Denaturalization: 94°- 95°C• Primer Annealing: 55°-  65°C• Extension of DNA: 72°• Number of Cycles: 25-...
LEADING USES FOR NUCLEIC ACID BASED                  TESTS• Differentiation of antigenically similar agents      • May be ...
LEADING USES FOR NUCLEIC ACID                BASED TESTS• Molecular epidemiology      • To identify point        sources f...
APPLICATIONS OF PCRThe swab specimens can be  stored 2-30°C for 4 days or  frozen at -20°C.The urine samples are  refriger...
TARGET AMPLIFICATION• Target amplification  requires that the DNA to be  tested for be amplified, i.e.,  the number of cop...
POLYMERASE TEMPLATE AND PRIMER          REQUIREMENTS• DNA polymerase cannot  initiate synthesis on its  own.      • It nee...
PCR REACTIONS IN THE LAB• We will be doing two different PCR reactions in the lab.      • For the first PCR reaction we wi...
PCR REACTIONS IN THE LAB                • The sequence of the amplified DNA will be determined.                • The ident...
WHAT ARE THE ADVANTAGES OF USING       A MOLECULAR TEST?• High sensitivity      • Can theoretically detect the presence of...
APPLICATIONS OF PCR IN OPTIMAL          DIAGNOSIS IN INFECTIONS   Neisseria gonorrhea and   Chlamydia trachomatis are   tw...
Advantages                       Molecular methods                  •High sensitivity and specificity                  •De...
WHAT ARE THE ADVANTAGES OF USING A             MOLECULAR TEST?• Simplicity  •Some   assays   are now   automatedDR.T.V.RAO...
WHAT ARE THE DISADVANTAGES OF USING A         MOLECULAR TESTS ?• Expensive• So specific that must have good clinical data ...
WHAT ARE THE DISADVANTAGES OF USING A          MOLECULAR TEST?• Too     sensitive?     Are the     results     clinically ...
PCR TO RT PCR• Use of PCR in the field of molecular diagnostics has increased  to the point where it is now accepted as th...
OVERVIEW OF RT - PCR                            tissue                         extract RNA                      copy into ...
NEED FOR NOVEL METHODS IN DIAGNOSIS OF                             INFECTIONS• Identification of the infectious  agent(s) ...
OUR VISION TO FUTURE DIAGNOSIS OF              INFECTIOUS DISEASES•    With the ability to test for an unlimited number of...
Advantages                      Molecular methods                  •High sensitivity and specificity                  •Det...
MOLECULAR METHODS HAVE                 LIMITATIONS• However, because of their high specificity, molecular methods  will no...
DIAGNOSTIC MICROBIOLOGY CHANGING FROMPHENOTYPIC METHODS TO MOLECULAR METHODS• In hospital epidemiology, the use of such te...
FOLLOW ME FOR ARTICLES OF INTEREST ON      INFECTIOUS DISEASES AND MICROBIOLOGY ..DR.T.V.RAO MD                           ...
Created by Dr. T.V.Rao MD for „e‟ learning    resources Microbiologists in the Developing                        World    ...
Upcoming SlideShare
Loading in...5
×

Molecular biology based diagnostic methods in microbiology

8,956

Published on

Polymerase chain reaction in Infectious Diseases

Published in: Health & Medicine, Technology
0 Comments
4 Likes
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total Views
8,956
On Slideshare
0
From Embeds
0
Number of Embeds
0
Actions
Shares
0
Downloads
726
Comments
0
Likes
4
Embeds 0
No embeds

No notes for slide

Transcript of "Molecular biology based diagnostic methods in microbiology"

  1. 1. POLYMERASE CHAIN REACTION IN INFECTIOUS DISEASES BASICS Dr.T.V.Rao MDDR.T.V.RAO MD 1
  2. 2. DR.KARY BANKS MULLIS DISCOVERY OF PCR• Dr.Kary Banks Mullis received a Nobel Prize in chemistry in 1993, for his invention of the polymerase chain reaction (PCR). The process, which Kary Mullis conceptualized in 1983, is hailed as one of the monumental scientific techniques of the twentieth century.DR.T.V.RAO MD 2
  3. 3. MOLECULAR MICROBIOLOGY• Molecular microbiology is the branch of microbiology devoted to the study of the molecular principles of the physiological processes involved in the life cycle of prokaryotic and eukaryotic microorganisms such as bacteria, viruses unicellular algae fungi, and protozoa. This includes gene expression and regulation, genetic transfer, the synthesis of macromolecules, sub-cellular organization, cell to cell communication, and molecular aspects of pathogenicity and virulenDR.T.V.RAO MD ce. 3
  4. 4. MOLECULAR BIOLOGY DEALS WITH • Molecular microbiology is primarily involved in the interactions between the various cell systems of microorganisms including the interrelationship of DNA, RNA and protein biosynthesis and the manner in which these interactions are regulated .DR.T.V.RAO MD 4
  5. 5. MOLECULAR METHODS ARE REVOLUTIONIZING• The use of molecular biology techniques, such as nucleic acid probing and amplification, provides the potential for revolutionizing how we diagnose infecting pathogens and determining the relation between nosocomial isolates. In clinical microbiology, this means that we will be able to detect smaller amounts of DNA or RNA of pathogens than is currently possible, that the time required to identify and determine the antimicrobial susceptibility of slow-growing pathogens will be dramatically reduced, and that the diagnosis of nonculturable organisms will become possible.DR.T.V.RAO MD 5
  6. 6. MOLECULAR METHODS IN DIAGNOSIS• The introduction of molecular methods will not only depend on their performance for each individual microorganism, but also on the clinical relevance of the diagnostic question asked, the prevalence of the clinical problem and whether the new methods are added to the procedures in use or will replace them. Therefore no general rules can be proposed, strategies have to be elaborated for each infectious agent or clinical syndrome.DR.T.V.RAO MD 6
  7. 7. WHY USE A MOLECULAR TEST TO DIAGNOSE AN INFECTIOUS DISEASE?• Need an accurate and timely diagnosis • Important for initiating the proper treatment • Important for preventing the spread of a contagious diseaseDR.T.V.RAO MD 7
  8. 8. WHEN WE REALLY NEED MOLECULAR METHODS ?• Molecular diagnosis is most appropriate for infectious agents that are difficult to detect, identify, or test for susceptibility in a timely fashion with conventional methods.DR.T.V.RAO MD 8
  9. 9. MOLECULAR BIOLOGY IS EMERGING IN DIAGNOSTIC METHOD• Diagnostic microbiology is in the midst of a new era. Rapid nucleic acid amplification and detection technologies are quickly displacing the traditional assays based on pathogen phenotype rather than genotype. The polymerase chain reaction (PCR) has increasingly been described as the latest gold standard for detecting some microbes, but such claims can only be taken seriously when each newly described assay is suitably compared to its characterized predecessorsDR.T.V.RAO MD 9
  10. 10. LEADING USES FOR NUCLEIC ACID BASED TESTS• Nonculturable agents • Human papilloma virus • Hepatitis B virus• Fastidious, slow-growing agents • Mycobacterium tuberculosis • Legionella pneumophila• Highly infectious agents that are dangerous to culture • Francisella tularensis • Brucella species • Coccidioidis immitisDR.T.V.RAO MD 10
  11. 11. LEADING USES FOR NUCLEIC ACID BASED TESTS• In situ detection of infectious agents • Helicobacter pylori • Toxoplasma gondii• Agents present in low numbers • HIV in antibody negative patients • CMV in transplanted organs• Organisms present in small volume specimens • Intra-ocular fluid • Forensic samplesDR.T.V.RAO MD 11
  12. 12. MOLECULAR METHODS ARE NECESSARY IF THE TRADITIONAL METHODS PROVIDE POOR RESULTS ?• Microscopy gives false positive results - - T.vaginalis, N.gonorrhoeae• Intracellular pathogens – viruses, M.genitalium• Low sensitivity – Chlamydia sp.,Neisseria sp.• Seropositivity is common – Chlamydia sp.• Subtyping is mandatory – HSV, HPV, HCV• Microbial growth is slow – M. tuberculosis The 7th Baltic Congress in Laboratory Medicine, Pärnu 11.09.2004 DR.T.V.RAO MD 12
  13. 13. MOLECULAR DIAGNOSTICS HOW IT WORKS?• Every organism contains some unique,species specific DNA sequences• Molecular diagnostics makes the species specific DNA visible The 7th Baltic Congress in Laboratory Medicine, Pärnu 11.09.2004DR.T.V.RAO MD 13
  14. 14. UNDERSTANDING THE BASIS OF POLYMERASE CHAIN REACTIONDR.T.V.RAO MD 14
  15. 15. DNA MOLECULE Adenine Thymine Guanine CytosineDR.T.V.RAO MD 15
  16. 16. OUTLINE1. DNA2. PCR • Targets • Denaturing • Primers • Annealing • Cycles • RequirementsDR.T.V.RAO MD 16
  17. 17. DNA STRUCTURE• In double stranded linear DNA, 1 end of each strand has a free 5’ carbon and phosphate and 1 end has a free 3’ OH group. • The two strands are in the opposite orientation with respect to each other (antiparallel).• Adenines always base pair with thymines (2 hydrogen bonds) and guanines always base pair with cytosines (3 hydrogen bonds)DR.T.V.RAO MD 17
  18. 18. DNADNA is a nucleic acid that is composed of two complementary nucleotide building block chains.The nucleotides are made up of a phosphate group, a five carbon sugar, and a nitrogen base.DR.T.V.RAO MD 18
  19. 19. DNADNA has four nitrogen bases.• Two are purines ( 2 ringed base ) • Adenine ( A ), Guanine (G)• Two are pyrimidines ( 1 ringed base ) • Cytosine ( C ), Thymine ( T )DR.T.V.RAO MD 19
  20. 20. DNAThese four bases are linked in a repeated pattern by hydrogen bonding between the nitrogen bases.The linking of the two complementary strands is called hybridization.DR.T.V.RAO MD 20
  21. 21. DNAA purine always links with a pyrimidine base to maintain the structure of DNA.Adenine ( A ) binds to Thymine ( T ), with two hydrogen bonds between them.Guanine ( G ) binds to Cytosine ( C ), with three hydrogen bonds between them.DR.T.V.RAO MD 21
  22. 22. DNAExample of bonding pattern.• Primary strand CCGAATGGGATGC GGCTTACCCTACG• Complementary strandDR.T.V.RAO MD 22
  23. 23. Molecular diagnostics is a set of methodsto study primary structure (sequence) of DNA •Hybridization with complementary sequences -A-A-T-T-C-G-C-G-A-T-G- - T-T-A-A-G-C-G-C-T-A-C- •Amplification (synthesis) of species specific sequences PCR – polymerase chain reaction -A-A-T-T-C-G-C-G-A-T-G- -A-A-T-T-C-G-C-G-A-T-G- -A-A-T-T-C-G-C-G-A-T-G- -A-A-T-T-C-G-C-G-A-T-G- -A-A-T-T-C-G-C-G-A-T-G- The 7th Baltic Congress in Laboratory Medicine, Pärnu 11.09.2004DR.T.V.RAO MD23
  24. 24. PCR PCR is a technique that takes a specific sequence of DNA of small amounts and amplifies it to be used for further testing.DR.T.V.RAO MD 24
  25. 25. PCR REQUIREMENTS• Magnesium chloride: .5-2.5mM• Buffer: pH 8.3-8.8• dNTPs: 20-200µM• Primers: 0.1-0.5µM• DNA Polymerase: 1-2.5 units• Target DNA:  1 µgDR.T.V.RAO MD 25
  26. 26. PCR TARGETS The targets in PCR are the sequences of DNA on each end of the region of interest, which can be a complete gene or small sequence.DR.T.V.RAO MD 26
  27. 27. PCR TARGETSThe number of bases in the targets can vary. TTAAGGCTCGA . . . . AATTGGTTAAThe . . . . Represents the middle DNA sequence,and does not have to be known to replicate it.DR.T.V.RAO MD 27
  28. 28. PCR DENATURING Denaturing is the first step in PCR, in which the DNA strands are separated by heating to 95°C.DR.T.V.RAO MD 28
  29. 29. PCR PRIMERSPrimers range from 15 to 30 nucleotides, aresingle-stranded, and are used for thecomplementary building blocks of the targetsequence.Primers range from 15 to 30 nucleotides, aresingle-stranded, and are used for thecomplementary building blocks of the targetsequence.A primer for each target sequence on the endof your DNA is needed. This allows bothstrands to be copied simultaneously in bothdirections.DR.T.V.RAO MD 29
  30. 30. PCR PRIMERSTTAACGGCCTTAA . . . TTTAAACCGGTTAATTGCCGGAATT . . . . . . . . . .>and <. . . . . . . . . . AAATTTGGCCAATTAACGGCCTTAA . . . TTTAAACCGGTT DR.T.V.RAO MD 30
  31. 31. PCR PRIMERSThe primers are added in excess so they will bind to the target DNA instead of the two strands binding back to each other.DR.T.V.RAO MD 31
  32. 32. PCR ANNEALINGAnnealing is the process of allowing two sequences of DNA to form hydrogen bonds.The annealing of the target sequences an primers is done by cooling the DNA to 55°C.DR.T.V.RAO MD 32
  33. 33. PCR TAQ DNA POLYMERASETaq stands for Thermus aquaticus, which is a microbe found in 176°F hot springs in Yellow Stone National Forest.Taq produces an enzyme called DNA polymerase, that amplifies the DNA from the primers by the polymerase chain reaction, in the presence of Mg.DR.T.V.RAO MD 33
  34. 34. ESTABLISHMENT OF A PCR LABORATORY• To perform PCR for the repetitive detection of a specific sequence, three distinct laboratory areas are required. The specific technical operations, reagents ,and personnel considerations DR.T.V.RAO MD 34
  35. 35. PCR laboratory Sample handling QC & QA Quality control & DNA preparation assurance No alternative Thermocycler Detection Laboratory Amplification Documentation Mixing site Clean room R&D (Research and development) Stock solutions Alternatives: - commercial kits - robots + kitsDR.T.V.RAO MD35
  36. 36. PCR IN CLINICAL MICROBIOLOGY• Molecular detection has mostly come to the clinical microbiology laboratory in the form of PCR technology, initially involving single round or nested procedures with detection by gel electrophoresis. DR.T.V.RAO MD 36
  37. 37. HELPS RAPID DETECTIONTIMELY DIAGNOSIS CAN SAVE SEVERAL LIVES • Polymerase chain reaction (PCR) techniques have led the way into this new era by allowing rapid detection of microorganisms that were previously difficult or impossible to detect by traditional microbiological methods. DR.T.V.RAO MD 37
  38. 38. UNDERSTANDING THE PCR CYCLEDR.T.V.RAO MD 38
  39. 39. Isolation of Nucleic AcidsGoals: Types of Methods:• removal of proteins • differential solubility• DNA vs RNA • ‘adsorption’ methods• isolation of a specific • density gradient type of DNA (or RNA) centrifugationTypes of DNA:• genomic General Features: (chromosomal) • denaturing cell lysis (SDS,• organellar (satellite) alkali, boiling, chaotropic)• plasmid (extra- •  enzyme treatments chromosomal) - protease• phage/viral (ds or ss) - RNase (DNase-free)• complementary - DNase (RNase-free) (mRNA) 39
  40. 40. High MW Genomic DNA IsolationTypical Procedure EtOH Precipitation1 Cell Lysis • 2-2.5 volumes EtOH, -20o – 0.5% SDS + proteinase • high salt, pH 5-5.5 K (55o several hours) • centrifuge or ‘spool’ out2 Phenol Extraction – gentle rocking several hours3 Ethanol Precipitation4 RNAse followed by proteinase K5 Repeat Phenol Extrac-tion and EtOH ppt 40
  41. 41. High MW Genomic DNA IsolationTypical Procedure Phenol Extraction1 Cell Lysis • mix sample with equal volume – 0.5% SDS + proteinase of sat. phenol soln K (55o several hours) • retain aqueous phase2 Phenol Extraction • optional chloroform/isoamyl – gentle rocking several alcohol extraction(s) hours3 Ethanol Precipitation4 RNAse followed by proteinase K5 Repeat phenol extrac-tion and  aqueous phase EtOH ppt (nucleic acids)  phenol phase (proteins) 41
  42. 42. PCR• The PCR reaction has three basic steps • Denature – when you denature DNA, you separate it into single strands (SS). • In the PCR reaction, this is accomplished by heating at 95 0 C for 15 seconds to 1 minute. • The SS DNA generated will serve as templates for DNA synthesis. • Anneal – to anneal is to come together through complementary base-pairing (hybridization). • During this stage in the PCR reaction the primers base-pair with their complementary sequences on the SS template DNA generated in the denaturation step of the reaction. DR.T.V.RAO MD 42
  43. 43. PCR • The primer concentration is in excess of the template concentration. • The excess primer concentration ensures that the chances of the primers base-pairing with their complementary sequences on the template DNA are higher than that of the complementary SS DNA templates base-pairing back together. • The annealing temperature used should ensure that annealing will occur only with DNA sequences that are completely complementary. WHY? • The annealing temperature depends upon the lengths and sequences of the primers. The longer the primers and the more Gs and Cs in the sequence, the higher the annealing temperature. WHY? • The annealing time is usually 15 seconds to 1 minute.DR.T.V.RAO MD 43
  44. 44. PCR CYCLESDR.T.V.RAO MD 44
  45. 45. PCR• Most PCR reaction use 25 to 30 of these cycles to amplify the target DNA up to a million times the starting concentration.DR.T.V.RAO MD 45
  46. 46. PCR CYCLESDR.T.V.RAO MD 46
  47. 47. PCR • Extension – during this stage of the PCR reaction, the DNA polymerase will use dNTPs to synthesize DNA complementary to the template DNA. • To do this DNA polymerase extends the primers that annealed in the annealling step of the reaction. • The temperature used is 72 0 C since this is the optimum reaction temperature for the thermostable polymerase that is used in PCR. • Why is a thermostable polymerase used? • The extension time is usually 15 seconds to 1 minute.• The combination of denaturation, annealing, and extension constitute 1 cycle in a PCR reaction.DR.T.V.RAO MD 47
  48. 48. PCR CYCLESDR.T.V.RAO MD 48
  49. 49. PCR CYCLESDR.T.V.RAO MD 49
  50. 50. PCR CYCLESDR.T.V.RAO MD 50
  51. 51. PCR CYCLES REVIEW• Denaturalization: 94°- 95°C• Primer Annealing: 55°- 65°C• Extension of DNA: 72°• Number of Cycles: 25-40DR.T.V.RAO MD 51
  52. 52. LEADING USES FOR NUCLEIC ACID BASED TESTS• Differentiation of antigenically similar agents • May be important for detecting specific virus genotypes associated with human cancers (Papilloma viruses)• Antiviral drug susceptibility testing • May be important in helping to decide anti-viral therapy to use in HIV infections• Non-viable organisms • Organisms tied up in immune complexesDR.T.V.RAO MD 52
  53. 53. LEADING USES FOR NUCLEIC ACID BASED TESTS• Molecular epidemiology • To identify point sources for hospital and community- based outbreaks • To predict virulence• Culture confirmationDR.T.V.RAO MD 53
  54. 54. APPLICATIONS OF PCRThe swab specimens can be stored 2-30°C for 4 days or frozen at -20°C.The urine samples are refrigerated at 2-8°C or stored at -20°C.A target sequence is chosen for both, amplified with polymerase, and then evaluated with an enzyme immunoassay. DR.T.V.RAO MD 54
  55. 55. TARGET AMPLIFICATION• Target amplification requires that the DNA to be tested for be amplified, i.e., the number of copies of the DNA is increased.• To understand this we must first review the activity of the enzyme, DNA polymerase, that is used to amplify the DNA.DR.T.V.RAO MD 55
  56. 56. POLYMERASE TEMPLATE AND PRIMER REQUIREMENTS• DNA polymerase cannot initiate synthesis on its own. • It needs a primer to prime or start the reaction. • The primer is a single stranded piece of DNA that is complementary to a unique region of the sequence to be amplified.DR.T.V.RAO MD 56
  57. 57. PCR REACTIONS IN THE LAB• We will be doing two different PCR reactions in the lab. • For the first PCR reaction we will be using what are called consensus sequence primers. • These are primers that will bind to unique regions of the 16S ribosomal genes found in all bacteria. • The sequences of these primers are not unique to a specific kind of bacteria, but they are unique to a conserved region (consensus sequence) of DNA found in the 16S ribosomal genes of all bacteria. • They will be used to amplify a portion of the 16S ribosomal gene of an unknown bacteria.DR.T.V.RAO MD 57
  58. 58. PCR REACTIONS IN THE LAB • The sequence of the amplified DNA will be determined. • The identity of the unknown will be determined by searching the DNA sequence databases. • Note that that DNA of all bacteria should be amplified and yield a product using these consensus primers. • For the second PCR reaction we will be using primers that are unique to the genes that encode the shiga-like toxin produced by EHEC. • Only the DNA of those bacteria that carry the shiga-like toxin gene will be amplified and yield a product when using these primers. • For diagnostic purposes, only the second type of PCR, in which primers unique to a single type of organism or gene are used, is practical.DR.T.V.RAO MD 58
  59. 59. WHAT ARE THE ADVANTAGES OF USING A MOLECULAR TEST?• High sensitivity • Can theoretically detect the presence of a single organism• High specificity • Can detect specific genotypes • Can determine drug resistance • Can predict virulence• Speed • Quicker than traditional culturing for certain organismsDR.T.V.RAO MD 59
  60. 60. APPLICATIONS OF PCR IN OPTIMAL DIAGNOSIS IN INFECTIONS Neisseria gonorrhea and Chlamydia trachomatis are two of the most common sexually transmitted diseases. The infections are asymptomatic and can lead to pelvic inflammatory disease, salpingitis in women, epididymitis in men, infertility, and ectopic pregnancy.DR.T.V.RAO MD 60
  61. 61. Advantages Molecular methods •High sensitivity and specificity •Detects pathogen, not immune response •Quick results •High transport toleration In-house (home-brew) PCR methods •Cost effective •High sensitivity R&D is absolutely necessary •High quality •Fast implementation of scientific discoveries •Customer friendly The 7th Baltic Congress in Laboratory Medicine, Pärnu 11.09.2004DR.T.V.RAO MD61
  62. 62. WHAT ARE THE ADVANTAGES OF USING A MOLECULAR TEST?• Simplicity •Some assays are now automatedDR.T.V.RAO MD 62
  63. 63. WHAT ARE THE DISADVANTAGES OF USING A MOLECULAR TESTS ?• Expensive• So specific that must have good clinical data to support infection by that organism before testing is initiated.• Will miss new organisms unless sequencing is done as we will be doing in the lab for our molecular unknowns (not practical in a clinical setting).• May be a problem with mixed cultures – would have to assay for all organisms causing the infection.DR.T.V.RAO MD 63
  64. 64. WHAT ARE THE DISADVANTAGES OF USING A MOLECULAR TEST?• Too sensitive? Are the results clinically relevant?DR.T.V.RAO MD 64
  65. 65. PCR TO RT PCR• Use of PCR in the field of molecular diagnostics has increased to the point where it is now accepted as the standard method for detecting nucleic acids from a number of sample and microbial types.• However, conventional PCR was already an essential tool in the research laboratory. Real-time PCR has catalyzed wider acceptance of PCR because it is more rapid, sensitive and reproducible, while the risk of carryover contamination is minimizedDR.T.V.RAO MD 65
  66. 66. OVERVIEW OF RT - PCR tissue extract RNA copy into cDNA (reverse transciptase) do real-time PCR analyze resultsDR.T.V.RAO MD 66
  67. 67. NEED FOR NOVEL METHODS IN DIAGNOSIS OF INFECTIONS• Identification of the infectious agent(s) is essential to provide an accurate diagnosis, appropriately manage patient care and in certain cases reduce the risk of transmission within the community and health care settings. To meet these challenges, innovative technologies have been developed that detect single pathogens, multiple syndrome related pathogens and genotypic drug resistanceDR.T.V.RAO MD 67
  68. 68. OUR VISION TO FUTURE DIAGNOSIS OF INFECTIOUS DISEASES• With the ability to test for an unlimited number of potential pathogens simultaneously, next-generation sequencing has the potential to revolutionize infectious diseases diagnostics• In the microbiology laboratory, this technology will likely replace the traditional “one test, one bug” approach to pathogen diagnostics• The deep sequence information being generated is rapidly surpassing our capacity to analyze the data and will necessitate the development of highly parallel computational frameworks, such as cloud computing• In adapting this technology for clinical diagnostics, interpretation of data, appropriate quality control standards, and fulfilling regulatory requirements will be critical• One powerful application of next-generation sequencing is discovery of novel pathogens that may be associated with acute or chronic illnessesDR.T.V.RAO MD 68
  69. 69. Advantages Molecular methods •High sensitivity and specificity •Detects pathogen, not immune response •Quick results •High transport toleration In-house (home-brew) PCR methods •Cost effective •High sensitivity R&D is absolutely necessary •High quality •Fast implementation of scientific discoveries •Customer friendlyDR.T.V.RAO MD 69
  70. 70. MOLECULAR METHODS HAVE LIMITATIONS• However, because of their high specificity, molecular methods will not detect newly emerging resistance mechanisms and are unlikely to be useful in detecting resistance genes in species where the gene has not been observed previously. Furthermore, the presence of a resistance gene does not mean that the gene will be expressed, and the absence of a known resistance gene does not exclude the possibility of resistance from another mechanism. Phenotypic antimicrobial susceptibility testing methods allow laboratories to test many organisms and detect newly emerging as well as established resistance patterns.DR.T.V.RAO MD 70
  71. 71. DIAGNOSTIC MICROBIOLOGY CHANGING FROMPHENOTYPIC METHODS TO MOLECULAR METHODS• In hospital epidemiology, the use of such techniques has already provided tests with exceptional discriminatory power. Molecular techniques allow more efficient typing of all pathogens, and permit discrimination between strains of organisms that were previously phenotypically identical or uncharacterizable. Currently, cost and complexity limit the applicability of these techniques; however, they are likely to be developed for routine laboratory use in the next decade, and their impact will be considerable.DR.T.V.RAO MD 71
  72. 72. FOLLOW ME FOR ARTICLES OF INTEREST ON INFECTIOUS DISEASES AND MICROBIOLOGY ..DR.T.V.RAO MD 72
  73. 73. Created by Dr. T.V.Rao MD for „e‟ learning resources Microbiologists in the Developing World Email doctortvrao@gmail.comDR.T.V.RAO MD 73
  1. A particular slide catching your eye?

    Clipping is a handy way to collect important slides you want to go back to later.

×