Your SlideShare is downloading. ×
Regulacion de la expresion genica 2011- medical biotechnology
Regulacion de la expresion genica 2011- medical biotechnology
Regulacion de la expresion genica 2011- medical biotechnology
Regulacion de la expresion genica 2011- medical biotechnology
Regulacion de la expresion genica 2011- medical biotechnology
Regulacion de la expresion genica 2011- medical biotechnology
Regulacion de la expresion genica 2011- medical biotechnology
Regulacion de la expresion genica 2011- medical biotechnology
Regulacion de la expresion genica 2011- medical biotechnology
Regulacion de la expresion genica 2011- medical biotechnology
Regulacion de la expresion genica 2011- medical biotechnology
Regulacion de la expresion genica 2011- medical biotechnology
Regulacion de la expresion genica 2011- medical biotechnology
Regulacion de la expresion genica 2011- medical biotechnology
Regulacion de la expresion genica 2011- medical biotechnology
Regulacion de la expresion genica 2011- medical biotechnology
Regulacion de la expresion genica 2011- medical biotechnology
Regulacion de la expresion genica 2011- medical biotechnology
Regulacion de la expresion genica 2011- medical biotechnology
Regulacion de la expresion genica 2011- medical biotechnology
Regulacion de la expresion genica 2011- medical biotechnology
Regulacion de la expresion genica 2011- medical biotechnology
Regulacion de la expresion genica 2011- medical biotechnology
Regulacion de la expresion genica 2011- medical biotechnology
Regulacion de la expresion genica 2011- medical biotechnology
Regulacion de la expresion genica 2011- medical biotechnology
Regulacion de la expresion genica 2011- medical biotechnology
Regulacion de la expresion genica 2011- medical biotechnology
Regulacion de la expresion genica 2011- medical biotechnology
Regulacion de la expresion genica 2011- medical biotechnology
Regulacion de la expresion genica 2011- medical biotechnology
Regulacion de la expresion genica 2011- medical biotechnology
Regulacion de la expresion genica 2011- medical biotechnology
Regulacion de la expresion genica 2011- medical biotechnology
Regulacion de la expresion genica 2011- medical biotechnology
Regulacion de la expresion genica 2011- medical biotechnology
Upcoming SlideShare
Loading in...5
×

Thanks for flagging this SlideShare!

Oops! An error has occurred.

×
Saving this for later? Get the SlideShare app to save on your phone or tablet. Read anywhere, anytime – even offline.
Text the download link to your phone
Standard text messaging rates apply

Regulacion de la expresion genica 2011- medical biotechnology

607

Published on

Published in: Health & Medicine
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total Views
607
On Slideshare
0
From Embeds
0
Number of Embeds
1
Actions
Shares
0
Downloads
22
Comments
0
Likes
0
Embeds 0
No embeds

Report content
Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
No notes for slide

Transcript

  • 1. REGULACION DE LA EXPRESION GENICA Curso.: Biotecnología Médica UCSM- 2011 PROCESAMIENTO DE LA PROTEINA Y
  • 2.  
  • 3.  
  • 4. DIRECCIONALIDAD DE LA SINTESIS PROTEICA
  • 5.  
  • 6.  
  • 7. SINTESIS DE LAS PROTEINAS DE EXPORTACION
  • 8. GLICOSILACION DE LAS PROTEINAS
  • 9.  
  • 10.  
  • 11.  
  • 12.  
  • 13.  
  • 14. VIDA MEDIA DE LA PROTEINA RELACIONADA CON LA SECUENCIA DE AMINOÁCIDOS EN LA REGION N-TERMINAL DE LA PROTEINA RECIENTEMENTE SINTETIZADA
  • 15. INHIBIDORES DE LA TRADUCCION back to the top Inhibitor Comments Cloranfenicol Inhibe a la peptidiltransferasa bacteriana Estreptomicina inhibits prokaryotic peptide chain initiation, also induces mRNA misreading tertraciclinas inhibits prokaryotic aminoacyl-tRNA binding to the ribosome small subunit Neomicina similar in activity to streptomycin Eritromicina inhibits prokaryotic translocation through the ribosome large subunit Acido fuscídico similar to erythromycin only by preventing EF-G from dissociating from the large subunit Puromicina resembles an aminoacyl-tRNA, interferes with peptide transfer resulting in premature termination in both prokaryotes and eukaryotes Toxina diftérica catalyzes ADP-ribosylation of and inactivation of eEF-2 Cicloheximida Inhibe a la peptidiltransferasa de eucariotes
  • 16. MUTACION Y SUS CONSECUENCIAS
    • ATGTGCAAAGTCCCGTCACCT
    TACACGTTTCAGGGCAGTGGA AUGUGCAAAGUCCCGUCACCU Met -Cis -Lis- Val-Pro-Val Ser-Pro
  • 17.  
  • 18. PROCESAMIENTO DE LA INSULINA
  • 19.  
  • 20.  
  • 21.  
  • 22. RNA ANTISENTIDO
  • 23.  
  • 24. OPERON LAC
  • 25.  
  • 26.  
  • 27.  
  • 28.  
  • 29.  
  • 30.  
  • 31.  
  • 32.  
  • 33.  
  • 34. ACTIVACION GENICA MEDIADA POR GLUCOCORTICOIDES
  • 35.  
  • 36. A second notable feature of the human genome is the large average gene size of 27kb (27,000 nucleotide pairs). Only about 1300 bases are required to encode a protein of average size (430 amino acids in humans). Since the remaining DNA in a gene consists of introns, the majority of human genes thus consist of a long string of alternating exons ORGANISMO Nombre Científico Número de cromosomas Tamaño del genoma Kb Numero de genes .Porción que codifica Bacteria Mycoplasma genitalium 1 580 483 88 %   Escherichia coli 1 4639 4377 88 % Yeast Saccharomyces cerevisiae 16 12,069 6241 70 % Worm Caenorhabditis elegans 6 97,100 19,820 27 % Fly Drosophila melanogaster 4 180,000 13,601 20 % Weed Arabidopsis thaliana 5 117,000 25,498 29 % Mouse Mus musculus 20 3,059,000 ~30,000 < 3 % Human Homo sapiens 23 3,286,000 ~30,000 < 3 %

×