Ion Torrent Sequencing Applications: Variant Calling, Barcoding, and Long Range Mate Pairs

Ion Torrent Sequencing Applications: Variant Calling, Barcoding, and Long Range Mate Pairs David Jenkins Bioinformatics Engineer EdgeBio

Contract Research Division• Five SOLiD4 sequencing platforms• One Life Techologies 5500XL• Two Ion Torrent PGMs• Automation thru Caliper Sciclone & Biomek FX• Life Technologies Preferred Service Provider• Agilent Certified Service Provider• Commercial partnerships with companies such as CLCBio, DNANexus and Genologics• MD/PhD & Masters Level Scientists and Bioinformaticians• IT Infrastructure of >100 CPUs and >100TB storage

Agenda• Germ Line Variant Caller• Barcoding• Long Range Mate Pair Data

Variant Calling

Variant Calling• Goal: indentify SNPs and INDELs – High sensitivity • Few false negatives – High positive predictive value • Few false positives• Challenge: distinguish between homopolymer sequencing error and true INDELs

Variant Calling• DH10B• All identified variants are false positives• PPV and sensitivity• maq fakemut used to insert artificial mutations – 220 SNPs and 239 INDELs• EdgeBio 316 Chip Run – 11.00x AQ17 coverage of genome• Goal: identify most sensitive (true pos./[true pos. + false neg.+) settings that don’t lose PPV (true pos./*true pos. + false pos.]) – Identify the most variants while avoiding calling any non- variants

Samtools Defaults vs. Variant Calling Settings• Default samtools setting not optimized for Ion Torrent error model – Lower base quality of candidates – Coverage from both strands – Strict requirements for homopolymers • two sequences from both strands

PPV Corrected Sensitivity Settings Total SNPs INDELs Total SNPs INDELs Samtools Default 6.014% 96.682% 3.203% 100% 100% 100% SettingsQ4, h100, o20, e27, m1, H1 39.672% 100% 25.060% 98.690% 99.550% 97.910%Q14, h100, o20, e21, m1, H2 79.565% 100% 64.259% 92.810% 98.180% 89.870% Q7, h50, o10, e17, m4, H1 93.523% 100% 86.486% 91.720% 99.090% 84.940%Q14, h50, o10, e17, m4, H1 95.148% 100% 89.655% 90.850% 98.180% 84.100% Variant Calling 95.676% 100% 90.533% 90.650% 99.550% 83.260% SettingsQ14, h50, o10, e17, m4, H2 97.175% 100% 93.631% 89.540% 96.360% 83.260%

PPV and Sensitivity of Samtools Analyses100.000% 80.000% 60.000% 40.000% Total PPV SNPs PPV INDELs PPV 20.000% Total Corrected Sensitivity SNPs Corrected Sensitivity INDELs Corrected Sensitivity 0.000% Default Samtools h100, o20, e27, m1, H1 o20, e21, m4, H2 o10, e17, m4, H1 Q4, Q14, h75, Q7, h50, Q14, h50, o10, e17, m4, H1Variant CallingQ14, h50, o10, e17, m4, H2

Similar Results with Public DH10B Runs PPV and Sensitivity of Public DH10B Runs100.00% 80.00% 60.00% Total PPV SNP PPV 40.00% INDEL PPV Total Sensitivity 20.00% SNP Sensitivity INDEL Sensitivity 0.00% Life Ion Torrent 314 Life Ion Torrent Life Ion Torrent 318 Life Ion Torrent Edge Bio Ion Life Ion Torrent 316 Life Ion Torrent 100MB 316LR DH10B Chip 314LR DH10B Torrent 316 DH10B DH10B 316LR DH10B >99% accuracy

Homopolymer Mutated Reference Genome Homopolymer PPV and Sensitivity100.00% 80.00% 60.00% Homopolymer PPV 40.00% Hompolymer Sensitivity 20.00% 0.00% Life Ion Torrent 314 Life Ion Torrent Life Ion Torrent 318 Life Ion Torrent Edge Bio Ion Life Ion Torrent 316 Life Ion Torrent 100MB 316LR DH10B Chip 314LR DH10B Torrent 316 DH10B DH10B 316LR DH10B >99% per base accuracy with long reads.

Conclusions• Variant Calling plugin • Important to remember able to identify >80% Variant Calling is well-covered INDELs Application Specific and >99% well-covered • Easy to re-run Germ SNPs Line Variant Caller with• Improves on custom settings. performance of default • More information at samtools settings by http://www.edgebio.com/blog/ avoiding false positive SNPs and INDELs

Barcoding

Barcoding• HuRef gDNA• Compared read quality statistics with non- barcoded run• IonSet barcodes 5-8• 11bp barcodes at beginning of the read

Barcoding• 94.51% reads mapped to barcodes used.• Variant Calling Report for Each Barcode – New feature in 1.5.1• Ion Community Feature Requests – Aligning barcodes to different references – Find out what community wants

Quality ComparisonBarcoded hg19 Run (TS 1.5.1) Non-barcoded hg19 Run (TS 1.5.1)

Mapping Comparison

Conclusions• Similar quality between • 318 Chip and Barcoding barcoded and non • Ion Torrent Community barcoded runs – Technical details• Robust set of barcodes – Desired Features• Losing first 11 high – Troubleshooting quality bases to the barcode – Explains lower initial quality

Long Range Mate Pairs

Long Range Mate Pairs• Data provided by Ion Torrent• Average 10KB inserts• Split sff files with sff_extract utility • >IA_A • CTGCTGTACGGCCAAGGCGGATGTACGGTACAGCAG • >IA_B • CTGCTGTACCGTACATCCGCCTTGGCCGTACAGCAG• Can reads map successfully with average 10KB inserts? – Increasing homopolymers farther into read

Unsplit ReadsMetric MbpTotal Number of Bases 404.65Q17 Bases 207.67Q20 Bases 150.07Total Number of Reads 2,308,396Mean length [bp] 175Longest Read [bp] 365 From: http://flxlexblog.wordpress.com

Split Reads Metrics 2000000 1800000 1600000Type Count Percent 1400000 Total Reads 2,308,396 1200000Orphan Reads 220,707 9.561% 1000000 Partial Linker 106,913 4.631%Multiple Linker 29 0.001% 800000 Too Short 1,757 0.076% 600000Correctly Split 1,978,990 85.730% 400000 200000 0 Orphan Partial Multiple Too Short Correctly Reads (1 Linker Linker Split Reads seq) Found Occuracnes

Reads 1• Per base sequence quality below Q20 after base 20• Analysis performed pre TS 1.5 release • Predicted base quality has improved• Homopolymer enrichment relatively consistent across the read

Reads 2• Per base sequence quality below Q20• Second part of read in lower quality region of unsplit read• Homopolymer enrichment still fairly uniform

Insert Size bwa tmapμ = 10189.78, σ = 1282.43 μ = 9751.20, σ = 2016.62

Mapping AQ17 AQ20 Perfect Total Number of Bases [Mbp] 218.55 179.37 170.28 Mean Length [bp] 70 63 60 Longest Alignment [bp] 173 171 167 Mean Coverage Depth 46.6x 38.3x 36.3x Percentage of Library Covered 99.99% 99.99% 99.99% Read >= 2 Reads Unmapped Excluded Clipped Perfect 1 mismatchLength [bp] mismatches 50 3,240,310 15,981 20 0 1,810,959 744,229 669,121 100 349,925 1,340 5 49,717 104,928 72,110 121,825 150 1,944 73 0 851 127 172 721

Conclusion• Long reads capable of producing Mate Pair reads – Quality mapping – Tight distribution around insert size• Human Application – With longer insert sizes (40kb) could be used to resolve structural variation• Blog post coming soon: – http://www.edgebio.com/blog/

ThanksEdge Bio Team Follow Us:• Lab • EdgeBio Twitter: @EdgeBio – Joy Adigun • David Jenkins Twitter: @dfjenkins3 – Jennifer Sheffield • Justin Johnson Twitter: @BioInfo – Ryan Mease • djenkins@edgebio.com – Rossio Kersey • http://www.edgebio.com/blog/• Informatics – Anju Varadarajan – Phil Dagosto• Justin Johnson• John Seed• Dean Galaas

Ion Torrent Sequencing Applications: Variant Calling, Barcoding, and Long Range Mate Pairs

by dfjenkins3 on Nov 15, 2011

Accessibility

Categories

Tags

Upload Details

Usage Rights

2 Embeds 2,038

Statistics

Ion Torrent Sequencing Applications: Variant Calling, Barcoding, and Long Range Mate Pairs — Presentation Transcript

http://www.edgebio.com	2015
http://feeds.feedburner.com	23