Pathological Interplay of Apoptosis and Epigenetic Mechanisms
Upcoming SlideShare
Loading in...5
×

Like this? Share it with your network

Share

Pathological Interplay of Apoptosis and Epigenetic Mechanisms

  • 467 views
Uploaded on

Presentation created for the course BIOL 3095 of the University of Puerto Rico at Cayey. It serves as a tool to explain and discuss the review paper entitled "Pathological Interplay of Apoptosis......

Presentation created for the course BIOL 3095 of the University of Puerto Rico at Cayey. It serves as a tool to explain and discuss the review paper entitled "Pathological Interplay of Apoptosis and Epigenetic Mechanisms", currently in draft form, written by Danilo Trinidad Perez Rivera.

  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Be the first to comment
    Be the first to like this
No Downloads

Views

Total Views
467
On Slideshare
450
From Embeds
17
Number of Embeds
1

Actions

Shares
Downloads
8
Comments
0
Likes
0

Embeds 17

http://danilotperez.wordpress.com 17

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
    No notes for slide

Transcript

  • 1. PATHOLOGICAL INTERPLAY OF APOPTOSIS AND EPIGENETIC MECHANISMS Danilo T. Pérez Rivera Chemistry Department Undergraduate Student University of Puerto Rico Cayey Campus Images courtesy of: WEHI.tv BDbiosciences.com
  • 2. BASICS OF EPIGENETICS Study of heritable changes in phenotype, which do not modify an organism’s DNA sequence.  Examples of epigenetic modifications include, but are not limited to:    DNA methylation Non-coding RNA actions: piRNAs  miRNAs  lncRNAs   Histone modificatons: Acetylation  Methylation  Phosphorylation  Ubiquitination  http://learn.genetics.utah.edu/content/epige netics/nutrition/
  • 3. BASICS OF APOPTOSIS A form of cell-death referred to as “programmed”, due to its systemic process, and apparent benefits acquired by the organism due to it.  In most cases, apoptosis is beneficial for the cell.  Functions include:      Sculpting skin Deleting structures Adjusting cell numbers and organization Eliminating potentially harmful cells Bad/Bim Apoptosis Bcl-2/Bcl-xL Caspase -3 Bax/Bak Caspase-9 cyt c Apaf - 1 Figure 1. Simplified extrinsic genetic pathway of apoptosis.
  • 4. HODGKIN’S LYMPHOMA    Lymphoma is a type of blood cancer caused by incorrect proliferation of lymphocytes. Initial results demonstrate heavy methylation of Tumor Suppressor Genes (TSGs). Cells in Hodgkin’s Lymphoma demonstrate strong apoptotic resistance.
  • 5. HODGKIN LYMPHOMA 1. Transfection with the IGSF4 Gene 2. Incubation in Ionomycin 3. Apoptotic Induction Empty vector IGSF4 vector Figure 2. Experimental procedure and results of the study conducted by Murray et al (2010). Murray et al. 2013
  • 6. IGSF4: METHYLATION CAUSED DEFICIENCIES IGSF4 is unnecessary for apoptosis, but heavily reduces apoptotic resistance.  IGSF4 CpG-island methylation was found rampant in HL-cells, in comparison to the healthy cells.  GCGCCCGGGCGGCCGTGCGTCCTAG – XGene GCGCCCGGGCGGCCGTGCGTCCTAG – XGene
  • 7. GLIOBLASTOMA MULTIFORME     Aggressive form of brain cancer. Prognosis is extremely poor. (4 to 15 months after diagnosis) Glial cells demonstrate to have very high apoptotic resistance, and the condition does not react very well to treatment with chemotherapy. Certain results suggest MMP-9 is one of the main conferrers of apoptotic resistance, and siRNAmediated knockdowns of this protein’s gene has been demonstrated to induce apoptosis and retrograde tumor growth. Moreover, a more readily applicable study suggests miR-211 interferes with a certain gene’s transcription, causing a chain reaction resulting in apoptosis
  • 8. MIR-211 RESCUE: FEASIBLE TREATMENT? C GCGCCCGGGCGGCCGTGCGTCCTAG CGCGGGCCCGCCGGCACGCAGGATC Bcl-2 1. DNA Replication 2. Attempted DNA methylation. 3. Upregulation of MiR211 4. Post-transcriptional silencing mechanism miR-211 MMP-9 or another oncogene Images courtesy of: SciencePhoto.com and Dan Cojocari – University of Toronto Asuthkar et al. 2012
  • 9. HYPOXIC ISCHEMIA Also known as a cerebral infarction.  Is a severe deficiency of oxygen reaching the brain.  Cells are heavily induced towards apoptosis.  Restoration of oxygen as soon as possible is positive, but cells continue to die.  Little research has been done on the epigenetic implications of this condition. 
  • 10. HYPOXIC ISCHEMIA 11 genes were targeted in rats who had been induced with HI, and their expression profiles were predicted, along with possible DNA methylation and histone modification states.  All 11 expression profiles were fulfilled, yet none of the genes had significantly different grades of epigenetic modifications from the control group.  DNA methylation was completely discarded, as it was fully inspected and their were no notable differences in any of the inspected genes.  The assessment for other epigenetic modifications remained inconclusive, due to insufficient data to compare to.  Kumral et al. 2013
  • 11. HISTONE MODIFICATIONS: ARE THEY IMPLICATED? Probably not in the short-term.  Possibilities of rapid epigenetic modification to upregulate apoptotic activity is unlikely.  The injury does not seem to be caused by erratic apoptotic behavior.  DNA methylation was deemed insignificant, but the data compiled on histone modification significance remained inconclusive, due to insufficient data on the subject. 
  • 12. REVIEW Transcriptional-silencing of genes is extent in apoptotically resistant conditions. The silencing mechanism is usually DNA methylation.  Post-transcriptional-silencing through RNAinterference also provides apoptotic resistance.    Investigation and description of these mechanisms is currently underway. Histone modifications have been left largely untouched in the studying of pathologies, though investigation is beginning to take flight.
  • 13. CONCLUSION Epigenetic mechanisms have substantial importance in the regulation in apoptosis, and this has been demonstrated.  Treatments can be developed as to take advantage of these epigenetic mechanisms to counter-act erratic apoptotic activity.  Characterization of these mechanisms must first take place, as to ensure correct manipulation of these factors.  Investigation into other forms of epigenetic modification should also be verified, moreso in apoptotically active pathologies. 
  • 14. REFERENCES     Allis CD, Jenuwein T, Reinberg D, Capparos M. 2007. Epigenetics. 1st Edition. Cold Spring Harbor (NY): CSHL Press. 492 p. Asuthkar S, Velpula KK, Chetty C, Gorantla B, Rao J. 2012. Epigenetic Regulation of miRNA-211 by MMP-9 Governs Glioma Cell Apoptosis, Chemosensitivity and Radiosensitivity. Oncotarget. 3(11):1439-1454. Chetty C, Lakka SS, Bhoopathi P, Gondi CS, Veeravalli KK, Fassett D, Klopfenstein JD, Dinh DH, Gujrati M, Rao JS. 2010. Urokinase Plasminogen Activator Receptor and/or Matrix Metalloproteinase-9 Inhibition Induces Apoptosis Signaling through Lipid Rafts in Glioblastoma Xenograft Cells. Mol Cancer Ther. 9(9):2605-2617. Johnson DR, O'Neill BP. 2012. Glioblastoma survival in the United States before and during the temozolomide era. J Neuroonc. 107(2):359-364.
  • 15. REFERENCES     Kumral A, Tuzun F, Tugyan K, Ozbal S, Yılmaz O, Yesilirmak CD, Duman N, Ozkan H. 2012. Role of epigenetic regulatory mechanisms in neonatal hypoxicischemic . brain injury. Early Human Dev. 89(3):165-173 Murray P, Fan Y, Davies G, Ying J, Geng H, Ng KM, Li H, Gao Z, Wei W, Bose S, et. al. 2010. Epigenetic Silencing of a Proapoptotic Cell Adhesion Molecule, the Immunoglobulin Superfamily Member IGSF4, by Promoter CpG Methylation Protects Hodgkin Lymphoma Cells from Apoptosis. Amer J Patho. 177(3):1480-1490. O'Rourke CJ, Knabben V, Bolton E, Moran D, Lynch T, Hollywood D, Perry AS. 2013. Manipulating the epigenome for the treatment of urological malignancies. Pharmacol Ther. 138(2):185-196 Vannucci RC, Vannucci SJ. 2005. Perinatal hypoxic– ischemic brain damage: evolution of an animal model. Dev Neurosci. 27(2-4):81-86.
  • 16. QUESTIONS? Contact Information: danilo.perez@upr.edu Danilo Trinidad Pérez Rivera Undergraduate Student University of Puerto Rico Cayey Campus
  • 17. PATHOLOGICAL INTERPLAY OF APOPTOSIS AND EPIGENETIC MECHANISMS Danilo T. Pérez Rivera Chemistry Department Undergraduate Student University of Puerto Rico Cayey Campus Images courtesy of: WEHI.tv BDbiosciences.com