Mutações e suas consequências
Upcoming SlideShare
Loading in...5
×
 

Mutações e suas consequências

on

  • 4,388 views

 

Statistics

Views

Total Views
4,388
Views on SlideShare
4,078
Embed Views
310

Actions

Likes
1
Downloads
29
Comments
0

4 Embeds 310

http://cursogeneticahumana.blogspot.com.br 292
http://www.cursogeneticahumana.blogspot.com.br 12
http://cursogeneticahumana.blogspot.com 4
http://cursogeneticahumana.blogspot.pt 2

Accessibility

Categories

Upload Details

Uploaded via as Adobe PDF

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

Mutações e suas consequências Mutações e suas consequências Presentation Transcript

  • VARIAÇÃODe onde vem a variação?Fenótipo e Genótipo
  • 2.1 FENÓTIPO osteoblasto Proteinas 12-18% peso corpóreo responsáveis por: adipócito Estrutura e forma neuronio Enzimas Anticoropos Hormonios Célula muscular Componentes iguais em todas as células Diferentes tipos celulares = diferentes funções
  • FENÓTIPO Sequencia de proteina aminoacidos 20 aminoacidos O Fenótipo é determinado pelas propriedades das proteinas As propriedades das proteinas são determinadas pela sequencia de aminoacidos
  • 2.2 GENÓTIPOGenética Classica: Mendel descobriu o que os genes fazem, mas não o que sãoGenética Molecular: Watson & Crick (1953) descobriram como genes codificam etransmitem informaçãoGenômica: sequenciamentos de genomas inteiros de diferentes espécies 1977: alguns virus 1995: bactéria 1997: verme 2001: rascunho do genoma humano 2005: chimpanzé 2007: macaco Rhesus
  • GENÉTICA CLASSICAGene: particulas de herançaAlelo: formas alternativas de genes (A/a ou a1, a2, a3)Maioria das especies com reprodução sexuada: diploidia (2n)Função dos genes: a- influenciam as características físicas (o genótipo produz o fenótipo) b- se replicam para produzir novas celulas ou individuos com o mesmo genótipo b Genótipo 1 Genótipo 2 Genótipo 1 Genótipo 1 a Fenótipo 1 Fenótipo 2 Fenótipo 1 Fenótipo 1 Tempo evolutivo
  • GENÉTICA CLASSICAFluxo de informação: unidirecionalCaracterísticas adquiridas não passamgenéticamente para a próxima geração Células somáticas: mitose (reproduzem fenotipo) Celulas germinativas: meiose Produzem (novos) genótipos
  • GENÉTICA MOLECULARCódigo Genético: 4(bases) 3 (triplas) = 64 (possibilidades), mas só há 20 aa + 3 stop codonsUniversal: todos os seres vivos compartilham o mesmo códigoEspecífico: cada codon codifica para apenas um aaRedundante: CC+qq = Pro, CU+qq=Leu etc mutação sinonima proteção Codons que diferem pela 1ª base: propriedades semelhantes
  • GENÔMICA 60% doGenoma Humano: genoma não 3.200 M pares de bases em 23 cromossomos diploides são genes 25.000 genes cada gene: ~ 27.000 pares de base ~1% do gene = exons (traduzidos) + introns (não codificadores) genoma porção codificadora de cada gene tem 1340 pares de base codifica p/ proteina
  • GENÔMICADNA não codificador: pseudogenes: restos de genes não mais utilizadosss = estr. vestigiais transposons: se copiam para diferentes partes do genoma, rearranjam material genético perfazem 43% do genoma sequencias Alu = 10% do genoma e existe só em primatas produzem variação microevolução associadas a cancer, hemofilia, diabetes.. micro e minisatélites: CCGCCGCCGCCG, c/ alta mutabilidadeDNA não codificador tem função? é em parte conservado foi selecionado tem função regulatória DNA repetitivo: aumenta potencial evolutivo (gerando novos fenótipos) Que consequencias evolutivas isso poderia ter? Transposons levam a sementes rajadas
  • GENÉTICA MOLECULARCódigo Genético: 4(bases) 3 (triplas) = 64 (possibilidades), mas só há 20 aa + 3 stopcodonsUniversal: todos os seres vivos compartilham o mesmo códigoEspecífico: cada codon codifica para apenas um aaRedundante: CC+qq = Pro, CU+qq=Leu etc mutação sinonima proteção Codons que diferem pela 3ª base: propriedades semelhantes
  • GENÔMICA 10Evolução do tamanho do Genoma: Genes Pq aves tem quase 2x+ cromossomos q HS? Polipoidia: mais de 2 copias do genoma (3n, 4n..) Chromosomes 10 O numero de genes e a proporção de DNA não- codificador tendem a aumentar com o 22-25.000 aumento de complexidade fenotípica 19.100 20.000 13.600 40- 10 8 78 46
  • TTACTGTTGCCCTGGATGGAAAACCTTACCTGGCGGAAATCAGTGTATTGTCCCCATTTGCCGGCATTCCTGTGGGGATGGATTTTGTTCGAGGCCAAATATGTGCACTTGCCCATCTGGTCAGATAGCTCCTTCCTGTGGCTCCAGATCCATACAACACTGCAATATTCGCTGTATGAATGGAGGTAGCTGCAGTGACGATCACTGTCTATGCCAGAAAGGATACATAGGGACTCACTGTGGACAACCTGTTTGTGAAAGTGGCTGTCTCAATGGAGGAAGGTGTGTGGCCCCAAATCGATGTGCATGCACTTACGGATTTACTGGACCCCAGTGTGAAAGAGATTACAGGACAGGCCCATGTTTTACTGTGATCAGCAACCAGATGTGCCAGGGACAACTCAGCGGGATTGTCTGCACAAAACAGCTCTGCTGTGCCACAGTCGGCCGAGCCTGGGGCCACCCCTGTGAGATGTGTCCTGCCCAGCCTCACCCCTGCCGCCGTGGCTTCATTCCAAATATCCGCACGGGAGCTTGTCAAGATGTGGATGAATGCCAGGCCATCCCCGGGCTCTGTCAGGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAACTTAATGAAGTGTCACAAAAATGTGAAGATATTGATGAATGCAGCACCATTCCTGGAATCTGTGAAGGGGGTGAATGTACAAACACAGTCAGCAGTTACTTTTGCAAATGTCCCCCTGGTTTTTACACCTCTCCAGATGGTACCAGATGCATAGATGTTCGCCCAGGATACTGTTAGAGCCCGGCCCGGGGGACGGGCGGCGGGATAGCGGGACCCCGGCGCGGCGGTGCGCTTCAGGGCGCAGCGGCGGCCGCAGACCGAGCCCCGGGCGCGGCAAGAGGCGGCGGGAGCCGGTGGCGGCTCGGCATCATGCGTCGAGGGCGTCTGCTGGAGATCGCCCTGGGATTTACCGTGCTTTTAGCGTCCTACACGAGCCATGGGGCGGACGCCAATTTGGAGGCTGGGAACGTGAAGGAAACCAGAGCCAGTCGGGCCAAGAGAAGAGGCGGTGGAGGACACGACGCGCTTAAAGGACCCAATGTCTGTGGATCACGTTATAATGCTTACTGTTGCCCTGGATGGAAAACCTTACCTGGCGGAAATCAGTGTATTGTCCCCATTTGCCGGCATTCCTGTGGGGATGGATTTTGTTCGAGGCCAAATATGTGCACTTGCCCATCTGGTCAGATAGCTCCTTCCTGTGGCTCCAGATCCATACAACACTGCAATATTCGCTGTATGAATGGAGGTAGCTGCAGTGACGATCACTGTCTATGCCAGAAAGGATACATAGGGACTCACTGTGGACAACCTGTTTGTGAAAGTGGCTGTCTCAATGGAGGAAGGTGTGTGGCCCCAAATCGATGTGCATGCACTTACGGATTTACTGGACCCCAGTGTGAAAGAGATTACAGGACAGGCCCATGTTTTACTGTGATCAGCAACCAGATGTGCCAGGGACAACTCAGCGGG 3.200.000.000ATTGTCTGCACAAAACAGCTCTGCTGTGCCACAGTCGGCCGAGCCTGGGGCCACCCCTGTGAGATGTGTCCTGCCCAGCCTCACCCCTGCCGCCGTGGCTTCATTCCAAATATCCGCACGGGAGCTTGTCAAGATGTGGATGAATGCCAGGCCATCCCCGGGCTCTGTCAGGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAACTTAATGAAGTGTCACAAAAATGTGAAGATATTGATGAATGCAGCACCATTCCTGGAATCTGTGAAGGGGGTGAATGTACAAACACAGTCAGCAGTTACTTTTGCAAATGTCCCCCTGGTTTTTACACCTCTCCAGATGGTACCAGATGCATAGATGTTCGCCCAGGATACTGTTACACAGCTCTGACAAACGGGCGCTGCTCTAACCAGCTGCCACAGTCCATAACCAAAATGCAGTGCTGCTGTGATGCCGGCCGATGCTGGTCTCCAGGGGTCACTGTCGCCCCTGAGATGTGTCCCATCAGAGCAACCGAGGATTTCAACAAGCTGTGCTCTGTTCCTATGGTAATTCCTGGGAGACCAGAATATCCTCCCCCACCCCTTGGCCCCATTCCTCCAGTTCTCCCTGTTCCTCCTGGCTTTCCTCCTGGACCTCAAATTCCGGTCCCTCGACCACCAGTGGAATATCTGTATCCATCTCGGGAGCCACCAAGGGTGCTGCCAGTATTACTGTTGCCCTGGATGGAAAACCTTACCTGGCGGAAATCAGTGTATTGTCCCCATTTGCCGGCATTCCTGTGGGGATGGATTTTGTTCGAGGCCAAATATGTGCACTTGCCCATCTGGTCAGATAGCTCCTTCCTGTGGCTCCAGATCCATACAACACTGCAATATTCGCTGTATGAATGGAGGTAGCTGCAGTGACGATCACTGTCTATGCCAGAAAGGATACATAGGGACTCACTGTGGACAACCTGTTTGTGAAAGTGGCTGTCTCAATGGAGGAAGGTGTGTGGCCCCAAATCGATGTGCATGCACTTACGGATTTACTGGACCCCAGTGTGAAAGAGATTACAGGACAGGCCCATGTTTTACTGTGATCAGCAACCAGATGTGCCAGGGACAACTCAGCGGGATTGTCTGCACAAAACAGCTCTGCTGTGCCACAGTCGGCCGAGCCTGGGGCCACCCCTGTGAGATGTGTCCTGCCCAGCCTCACCCCTGCCGCCGTGGCTTCATTCCAAATATCCGCACGGGAGCTTGTCAAGATGTGGATGAATGCCAGGCCATCCCCGGGCTCTGTCAGGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAACTTAATGAAGTGTCACAAAAATGTGAAGATATTGATGAATGCAGCACCATTCCTGGAATCTGTGAAGGGGGTGAATGTACAAACACAGTCAGCAGTTACTTTTGCAAATGTCCCCCTGGTTTTTACACCTCTCCAGATGGTACCAGATGCATAGATGTTCGCCCAGGATACTGTTAAACGTTACTGATTACTGCCAGTTGGTCCGCTATCTCTGTCAAAATGGACGCTGCATTCCAACTCCTGGGAGTTACCGGTGTGAGTGCAACAAAGGGTTCCAGCTGGACCTCCGTGGGGAGTGTATTGATGTTGATGAATGTGAGAAAAACCCCTGTGCTGGTGGTGAGTGTATTAACAACCAGGGTTCGTACACCTGTCAGTGCCGAGCTGGATATCAGAGCACACTCACGCGGACAGAATGCCGAGACATTGATGAGTGTTTGAATGAATGTGAGACTCCTGGAATCTGTGGTCCAGGGACATGTTACAACACCGTTGGCAACTACACCTGTATCTGTCCTCCAGACTACATGCAAGTGAATGGGGGAAATAATTGCATGGATATGAGAAGAAGTTTGTGCTACAGAAACTACTATGCTGACAACCAGACCTGTGATGGAGAATTGTTATTCAACATGACCAAGAAGATGTGCTGCTGTTCC
  • 2.3 VARIAÇÃO GENÉTICADe onde vem a variação genética? Reprodução sexuada (rearranja variação existente) recombinação segregação independente e linkage Mutação (leva a novas variantes: sem expressão, deletérias, positivas) substituição de base única expansão ou contração de sequencias repetitivas transposons duplicações de genomaO quanto a variação genotípica afeta o fenótipo? maioria dos polimorfismos não tem efeito fenotipico onde as mutações tem efeito, ele em geral é deletério animation: mendelian and polygenic inheritance
  • REPRODUÇÃO SEXUADA2n: dois cromossomos de cada par, um da mãe ,outro do paiDurante a meiose, a celula germinativa só recebe23 dos 46 cromosomos, um de cada par.A distribuição de cromossomos maternos epaternos é aleatória. animation: random assortmentUm homem pode produzir 8 M de tipos distintosde espermaIdem: mulherUm casal teoricamente poderia produzir 64 B dedescendentes distintosReprodução sexuada redistribui variação
  • Recombinação: aumenta mais ainda a diversidade animation: crossover probabilidade de recombinação varia: ao longo de cada cromossomo entre diferentes cromossomos entre os sexos : 50 por espermatozoide 80 por ovócitoSegregação independente e linkage: quanto mais proximos dois genes: maior a probabilidade de serem herdados em conjunto, e maior o linkage
  • MUTAÇÃO gera variação genética Mutação de base unica: transições: C->T e G->A (>semelhança, mais frequente) transversões: C->G e C->A (distintos, mais raro) taxas de mutação mais frequentes onde C é seguido por G taxa média de mutação: 1 em 4 M/ locus/ geraçãoFibrose cistica Neurofibromatose Tay Sachs Color blindness Anemia falsiforme Expansão e contração de sequencias repetitivas: Fra X (CGG) Coreia de Huntington (CGG) Nl=<44, afetado=>200 Nl=<28, afetado=>40
  • MUTAÇÃOTransposons: 1 a 10/100 nascimentos pode não ter efeito fenotipicoDuplicação segmental: Se gene tem função, seleção natural tende a preservá-lo como é Duplicação pode fornecer cópias a mais de genes funcionais Cópia antiga preserva função, cópia nova muta e pode fornecer nova função Importante para aparecimento de novos genes e fenótipos (Ex: familias genicas, como os 48 genes Hox envolvidos em segmentação corporea)Duplicações de genoma inteiro: muito raro, mas importante (plantas com flor e anfíbios são poliploides) também contribuem com origem de familias genicas (2 eventos de duplicação de genoma inteiro na história dos vertebrados)
  • MUTAÇÃOO efeito da diversidade genética e seu efeito sobre o fenótipo:Polimorfismo: variação entre os genomas de individuos 1:1000 bases variam de individuo para individuo (SNPs) cada indiviuo é único – fingerprinting 12% do genoma: duplicações segmentares com efeitos fenotipicos potenc. grandes 44% dos genes codificadores nos genes maternos e paternos são distintosMaioria do polimorfimso não tem efeito fenotipicoQuando mutações tem efeito fenotipico, ele normalmente é deletério: mutações tem maior chance de ocorrer em certos loci, mas ocorrem ao acaso o efeito da mutação não está relacionado à necessidades fisiológicas sem seleção há deteriorização biológica (fitness cai 0.1%/ger: Vassilieva et al, 2000) cada humano: 3 mutações novas deletérias Caenorhabditis elegans: em condições ideais selvagens
  • 2.4 DE GENÓTIPO A FENÓTIPOAlteração no DNA mudança no tipo de aminoácido mudança fenotípicaMaioria dos genes: várias funçõesMaioria dos fenótipos: causados por vários genesCaracteristicas monogenicas: várias doenças + caracteristicas normais (Rh)Como descobrir genes associados a certas características? Estudos de ligação (linkage): familias grandes + marcadores de localização conhecida Estudos de associação: inds afetados + normais genotipagem de centenas de genes conhecidos procura por genes candidato ou genome wide
  • Identificando alelos envolvidos em características poligenicas: Ex EstaturaSuposição: 6 genes (a- f), MAIUSCULO: maior altura, minusculo: menor alturaABCDEF: estatura maiorabcdef: estatura menorMaioria dos individuos: estatura médiaIndividuos com a mesma estatura podem ter alelos totalmente diferentes: abcDEF e ABCdefIndividuos com a não necessariamente são menores que aqueles com A (por conta dosoutros genes)Detectar genes para caracteristicas poligenicas é muito complexo: amostras muito maiores para muitas doenças não mendelianas não há clareza de qual genes estão envolvidos (Ca mama, diabetes, SOP, obesidade...)
  • Genes para caracteristicas físicas:Caracteristicas monogenicas:Coreia de Huntington: inicio >40ª, perda de coordenação e cognição mutação no gene da huntingtina (produz proteina que promove sobrevida e crescimento celular) sequencia repetitiva CAG: em individuos normais: 11 a 34 copias em afetados:> 40 copias (reatividade diferente: menor sobrevida de neuronios)Caracteristicas poligenicas:Tamanho em cães: muita variação ocorrida durante ~5000 anos (Sutter etal, 2007) gene IGF1 no cromossomo 15 associado a tamanho pequeno
  • Genes para o comportamento:Todo comportamento precisa de um mecanismo fisico, neuronal ou hormonalReação agressiva leva a alterações mensuráveis mediadas pelo cérebroCircuito cerebral consiste de proteinasLogo, mutação pode levar a mecanismo distinto que leva a comportamento distintoAssim: comportamento faz parte do fenótipoMicrotus ochrogaster é monogamico após acasalamento e macho cuida de prole hormonio vasopressina arginina leva a este comportamento receptor: V1a gene V1a há na maioria de roedores Microtus tem variação do V1a ratos de lab com versão V1a do Microtus desenvolvem monogamia pós acasalam.Pair-bonding em Microtus é geneticamente determinado E o comportamento humano?
  • Genes para o comportamento em humanos?Brunner et al (1993):grande familia com vários homens c/ RM leve + agressividadeLinkage implicou envolvimento de cr XJá era conhecido: gene p/ MAOA está no cr X MAOA degrada serotonina serotonina bem estar e relaxamento serotonina ansiedade, Sudden death, etcHomens agressivos não apresentavam MAOA na urinaSequenciamento de MAOA nestes pacientes revelou CAG->TAG na base 936 (=glu-> stop)Comportamento agressivo nesta familia causado por mutação de ponto no gene da MAOA
  • SUMÁRIO:1. Variação fenotipica é causada por variação no material genético.2. O genótipo leva ao fenótipo e também ao genótipo da próxima geração. Não há mecanismo em que o fenótipo altere permanentemente o genótipo e assim caracteristicas adquiridas não são normalmente passadas para a prole.3. Genes são sequencias de bases de DNA que codificam para proteinas.4. A maioria do genoma de organismos como os humanos não consiste de genes codificadores para proteina, mas sim de sequencias não codificadoras.5. A reprodução sexuada cria novas combinações, mas a origem verdadeira de variação genética é a mutação. Diferentes tipos de mutação ocorrem durante mitose e meiose. Individuos da mesma espécie variam bastante por conta de mutações.6. A maioria das mutações não tem efeito fenotipico, e as que tem são deletérias.7. Um “gene para” significa que a variação de determinada caracteristica é resultado dos alelos presentes.8. O comportamento é parte do fenótipo e assim há genes para comportamento.
  • 1. Como pode ter ocorrido a seleção natural do código genético? Use os termos herança, variação e competição na sua resposta.We assume that earlier in evolutionary history there were systems withdifferent and perhaps simpler or less specific mappings of codons toamino acids. Small biochemical changes (specifically in the structure ofthe tRNA molecules that the organism makes) would lead to variation inthe mappings of the code. Some of these variant codes would be moreprone than others to errors that meant that the phenotype did not developproperly. Because the phenotypes of such codes would be more likely todie, error-prone codes would fare badly in competition with other codes.Since genetic code type would be heritable, this would lead to non-randomretention of the best (most robust) codings, leading ultimately to the nearoptimalcode we see today. There is, by the way, some evidence thatminor variation in the genetic code does arise.
  • 2. Se cada um de nós humanos apresenta 3 mutações novas e estas são majoritariamente deletérias, por que humanos não apresentam uma deteriorização biológica, assim como ocorre nos vermes estudados por Vassilieva et al, 2000?Basically because of natural selection. Many deleterious mutations maketheir bearers more likely to be miscarried, less likely to survive intoadulthood, or less likely to reproduce. Thus, natural selection is constantlyworking to eliminate the deleterious mutations that mutation introduces.The reason that Vassilieva, Hook & Lynch (2000) got the results they didwas that they had eliminated natural selection, by making the environmentas benign as possible and removing any competition.Has enhanced folate status during pregnancy altered natural selectionand possibly Autism prevalence? A closer look at a possible link OriginalResearch ArticleMedical Hypotheses, Volume 71, Issue 3, September 2008, Pages 406-410Eugene J. Rogers
  • 3. Assuma que pair bonding (vinculo monogamico) é vantajoso para roedores que vivem em campos abertos, enquanto promiscuidade é adaptativa para roedores que vivem em florestas. Imagine que uma ilha com florestas e campos abertos é invadida por roedores promiscuos. Depois de milhões de anos de evolução há roedores promiscuos na floresta e monogamicos nos campos abertos desta ilha. Quais os passos evolutivos ocorridos neste processo de adaptação usando os termos mutação, fenótipo e competição?The rodents initially disperse all over the island. At some point, a mutationarises in the V1a gene. The phenotypic effect of this mutation is to causemore arginine vasopressin receptors to develop throughout the brain,which in turn means the males become bonded to the females aftermating. If such a mutant form arises in the forest, it will be disadvantagedin competition with the resident population, since pair-bonding is not thebest strategy here. It will thus die out and promiscuity will remainwidespread. However, if such a mutant arises in the plains, it will beadvantaged in competition with its promiscuous cousins there, becausethis is the best strategy in this habitat. This means it will leave moreoffspring than its competitors. Over the generations, the proportion of theplains population will rise and rise until it reaches 100% or nearly 100%,thus bringing about the behavioural differentiation of the two populations inthe different habitats.
  • 4. Se há um “gene para” comportamento agressivo, como no exemplo de MAOA, o ambiente não desempenha papel algum em causar este tipo de comportamento?Finding ‘genes for’ a particular characteristic does not mean that theenvironment plays no causal role. Remember, what the ‘genes for’language really means is that the difference between two phenotypicoutcomes is associated with which allele is present other genetic andenvironmental factors being equal. In the aggression example, aggressionis almost always immediately caused by some environmental trigger in theperson’s experience. What MAOA seems to affect is the propensity torespond to those environmental triggers in one way rather than another.Men with high-activity forms of MAOA seem to be protected frombecoming violent themselves even when they are mistreated as children.Men with a low-activity form are more likely to become violent themselvesin response to being treated violently. The environment is the immediatecause of aggressive behaviour; the genetic variant explains the differencebetween individuals’ responses to the environment. It follows that the bestway to stop violence would be to stop young men being treated violently(an environmental intervention), even though there is a ‘gene for’aggressive behaviour.