Your SlideShare is downloading. ×
20121005 algorithmsinbioinformatics vyahhi_lecture01
Upcoming SlideShare
Loading in...5
×

Thanks for flagging this SlideShare!

Oops! An error has occurred.

×
Saving this for later? Get the SlideShare app to save on your phone or tablet. Read anywhere, anytime – even offline.
Text the download link to your phone
Standard text messaging rates apply

20121005 algorithmsinbioinformatics vyahhi_lecture01

542

Published on

0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total Views
542
On Slideshare
0
From Embeds
0
Number of Embeds
2
Actions
Shares
0
Downloads
1
Comments
0
Likes
0
Embeds 0
No embeds

Report content
Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
No notes for slide

Transcript

  • 1. Биология за 1 пару Николай Вяххи vyahhi@bioinf.spbau.ru Computer Science клуб Екатеринбург, 2012пятница, 5 октября 12 г.
  • 2. Геном Человека 3,000,000,000 букв 13 лет (1990 - 2003) 3,000,000,000 $пятница, 5 октября 12 г.
  • 3. Геном Человека 3,000,000,000 букв 13 лет (1990 - 2003) 3,000,000,000 $пятница, 5 октября 12 г.
  • 4. Геном Человека 3,000,000,000 букв 2 недели 5,000 $пятница, 5 октября 12 г.
  • 5. пятница, 5 октября 12 г.
  • 6. ДНКпятница, 5 октября 12 г.
  • 7. ДНК Двойная спираль Нуклеотиды: А—Т С—G bp = Base Pairsпятница, 5 октября 12 г.
  • 8. Направление ДНКпятница, 5 октября 12 г.
  • 9. Направление ДНКпятница, 5 октября 12 г.
  • 10. Комплементарностьпятница, 5 октября 12 г.
  • 11. Комплементарность 1. CCCAGAACUGAGAUCAAU 2. AGUACCCGUAUUAACGGGпятница, 5 октября 12 г.
  • 12. ДНК → 2 x ДНК Репликацияпятница, 5 октября 12 г.
  • 13. РНК Одна цепочка Рибонуклеотиды: А—U С—Gпятница, 5 октября 12 г.
  • 14. ДНК → РНК Транскрипция T→Uпятница, 5 октября 12 г.
  • 15. Белки / Протеины Аминокислоты (20): ACDEFGHIKLMNPQRSTVWY Функции: структурная, ферментативная, рецепторная, гормональная, транспортная, сократительная, защитная.пятница, 5 октября 12 г.
  • 16. Структура Белка Последовательность α-спираль / β-лист Трёхмерная структура Комплекспятница, 5 октября 12 г.
  • 17. РНК → Белок Трансляция Кодон (3 нуклеотида) → 1 аминокислотапятница, 5 октября 12 г.
  • 18. РНК → Белок 1. CCCAGAACUGAGAUCAAU 2. AGUACCCGUAUUAACGGGпятница, 5 октября 12 г.
  • 19. Центральная Догмапятница, 5 октября 12 г.
  • 20. Геныпятница, 5 октября 12 г.
  • 21. Омикипятница, 5 октября 12 г.
  • 22. Геномика AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGAT AGCAGCTTCTGAACTGGTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGGTCACTAAA TACTTTAACCAATATAGGCATAGCGCACAGACAGATAAAAATTACAGAGTACACAACATCCATG AAACGCATTAGCACCACCATTACCACCACCATCACCATTACCACAGGTAACGGTGCGGGCTGAC GCGTACAGGAAACACAGAAAAAAGCCCGCACCTGACAGTGCGGGCTTTTTTTTTCGACCAAAGG TAACGAGGTAACAACCATGCGAGTGTTGAAGTTCGGCGGTACATCAGTGGCAAATGCAGAACGT TTTCTGCGTGTTGCCGATATTCTGGAAAGCAATGCCAGGCAGGGGCAGGTGGCCACCGTCCTCT CTGCCCCCGCCAAAATCACCAACCACCTGGTGGCGATGATTGAAAAAACCATTAGCGGCCAGGA TGCTTTACCCAATATCAGCGATGCCGAACGTATTTTTGCCGAACTTTTGACGGGACTCGCCGCC GCCCAGCCGGGGTTCCCGCTGGCGCAATTGAAAACTTTCGTCGATCAGGAATTTGCCCAAATAA AACATGTCCTGCATGGCATTAGTTTGTTGGGGCAGTGCCCGGATAGCATCAACGCTGCGCTGAT TTGCCGTGGCGAGAAAATGTCGATCGCCATTATGGCCGGCGTATTAGAAGCGCGCGGTCACAAC GTTACTGTTATCGATCCGGTCGAAAAACTGCTGGCAGTGGGGCATTACCTCGAATCTACCGTCG ATATTGCTGAGTCCACCCGCCGTATTGCGGCAAGCCGCATTCCGGCTGATCACATGGTGCTGAT GGCAGGTTTCACCGCCGGTAATGAAAAAGGCGAACTGGTGGTGCTTGGACGCAACGGTTCCGAC TACTCTGCTGCGGTGCTGGCTGCCTGTTTACGCGCCGATTGTTGCGAGATTTGGACGGACGTTG ACGGGGTCTATACCTGCGACCCGCGTCAGGTGCCCGATGCGAGGTTGTTGAAGTCGATGTCCTA CCAGGAAGCGATGGAGCTTTCCTACTTCGGCGCTAAAGTTCTTCACCCCCGCACCATTACCCCC ATCGCCCAGTTCCAGATCCCTTGCCTGATTAAAAATACCGGAAATCCTCAAGCACCAGGTACGCпятница, 5 октября 12 г.
  • 23. Геномикапятница, 5 октября 12 г.
  • 24. Геномыпятница, 5 октября 12 г.
  • 25. Сборка Геномапятница, 5 октября 12 г.
  • 26. Comparative Genomicsпятница, 5 октября 12 г.
  • 27. Протеомикапятница, 5 октября 12 г.
  • 28. Протеомикапятница, 5 октября 12 г.
  • 29. Домашнее задание http://rosalind.info • DNA • RNA • REVC • PROT • HAMM http://rosalind.info/classes/enroll/ 171da3d314a0b07e00883287cd2b6ddeeeba225b/пятница, 5 октября 12 г.

×