Биология за 1 пару                                  Николай Вяххи                               vyahhi@bioinf.spbau.ru    ...
Геном Человека                           3,000,000,000 букв                           13 лет (1990 - 2003)                ...
Геном Человека                           3,000,000,000 букв                           13 лет (1990 - 2003)                ...
Геном Человека                           3,000,000,000 букв                           2 недели                           5...
пятница, 5 октября 12 г.
ДНКпятница, 5 октября 12 г.
ДНК                           Двойная спираль                           Нуклеотиды:                                А—Т    ...
Направление ДНКпятница, 5 октября 12 г.
Направление ДНКпятница, 5 октября 12 г.
Комплементарностьпятница, 5 октября 12 г.
Комплементарность                             1. CCCAGAACUGAGAUCAAU                             2. AGUACCCGUAUUAACGGGпятни...
ДНК → 2 x ДНК                              Репликацияпятница, 5 октября 12 г.
РНК                           Одна цепочка                           Рибонуклеотиды:                               А—U    ...
ДНК → РНК                            Транскрипция                               T→Uпятница, 5 октября 12 г.
Белки / Протеины                           Аминокислоты (20):                              ACDEFGHIKLMNPQRSTVWY           ...
Структура Белка                           Последовательность                           α-спираль / β-лист                 ...
РНК → Белок                                       Трансляция                           Кодон (3 нуклеотида) → 1 аминокисло...
РНК → Белок                           1. CCCAGAACUGAGAUCAAU                           2. AGUACCCGUAUUAACGGGпятница, 5 октя...
Центральная Догмапятница, 5 октября 12 г.
Геныпятница, 5 октября 12 г.
Омикипятница, 5 октября 12 г.
Геномика                           AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGAT                       ...
Геномикапятница, 5 октября 12 г.
Геномыпятница, 5 октября 12 г.
Сборка Геномапятница, 5 октября 12 г.
Comparative Genomicsпятница, 5 октября 12 г.
Протеомикапятница, 5 октября 12 г.
Протеомикапятница, 5 октября 12 г.
Домашнее задание                                       http://rosalind.info                                        • DNA  ...
Upcoming SlideShare
Loading in...5
×

20121005 algorithmsinbioinformatics vyahhi_lecture01

560

Published on

0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total Views
560
On Slideshare
0
From Embeds
0
Number of Embeds
2
Actions
Shares
0
Downloads
2
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

20121005 algorithmsinbioinformatics vyahhi_lecture01

  1. 1. Биология за 1 пару Николай Вяххи vyahhi@bioinf.spbau.ru Computer Science клуб Екатеринбург, 2012пятница, 5 октября 12 г.
  2. 2. Геном Человека 3,000,000,000 букв 13 лет (1990 - 2003) 3,000,000,000 $пятница, 5 октября 12 г.
  3. 3. Геном Человека 3,000,000,000 букв 13 лет (1990 - 2003) 3,000,000,000 $пятница, 5 октября 12 г.
  4. 4. Геном Человека 3,000,000,000 букв 2 недели 5,000 $пятница, 5 октября 12 г.
  5. 5. пятница, 5 октября 12 г.
  6. 6. ДНКпятница, 5 октября 12 г.
  7. 7. ДНК Двойная спираль Нуклеотиды: А—Т С—G bp = Base Pairsпятница, 5 октября 12 г.
  8. 8. Направление ДНКпятница, 5 октября 12 г.
  9. 9. Направление ДНКпятница, 5 октября 12 г.
  10. 10. Комплементарностьпятница, 5 октября 12 г.
  11. 11. Комплементарность 1. CCCAGAACUGAGAUCAAU 2. AGUACCCGUAUUAACGGGпятница, 5 октября 12 г.
  12. 12. ДНК → 2 x ДНК Репликацияпятница, 5 октября 12 г.
  13. 13. РНК Одна цепочка Рибонуклеотиды: А—U С—Gпятница, 5 октября 12 г.
  14. 14. ДНК → РНК Транскрипция T→Uпятница, 5 октября 12 г.
  15. 15. Белки / Протеины Аминокислоты (20): ACDEFGHIKLMNPQRSTVWY Функции: структурная, ферментативная, рецепторная, гормональная, транспортная, сократительная, защитная.пятница, 5 октября 12 г.
  16. 16. Структура Белка Последовательность α-спираль / β-лист Трёхмерная структура Комплекспятница, 5 октября 12 г.
  17. 17. РНК → Белок Трансляция Кодон (3 нуклеотида) → 1 аминокислотапятница, 5 октября 12 г.
  18. 18. РНК → Белок 1. CCCAGAACUGAGAUCAAU 2. AGUACCCGUAUUAACGGGпятница, 5 октября 12 г.
  19. 19. Центральная Догмапятница, 5 октября 12 г.
  20. 20. Геныпятница, 5 октября 12 г.
  21. 21. Омикипятница, 5 октября 12 г.
  22. 22. Геномика AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGAT AGCAGCTTCTGAACTGGTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGGTCACTAAA TACTTTAACCAATATAGGCATAGCGCACAGACAGATAAAAATTACAGAGTACACAACATCCATG AAACGCATTAGCACCACCATTACCACCACCATCACCATTACCACAGGTAACGGTGCGGGCTGAC GCGTACAGGAAACACAGAAAAAAGCCCGCACCTGACAGTGCGGGCTTTTTTTTTCGACCAAAGG TAACGAGGTAACAACCATGCGAGTGTTGAAGTTCGGCGGTACATCAGTGGCAAATGCAGAACGT TTTCTGCGTGTTGCCGATATTCTGGAAAGCAATGCCAGGCAGGGGCAGGTGGCCACCGTCCTCT CTGCCCCCGCCAAAATCACCAACCACCTGGTGGCGATGATTGAAAAAACCATTAGCGGCCAGGA TGCTTTACCCAATATCAGCGATGCCGAACGTATTTTTGCCGAACTTTTGACGGGACTCGCCGCC GCCCAGCCGGGGTTCCCGCTGGCGCAATTGAAAACTTTCGTCGATCAGGAATTTGCCCAAATAA AACATGTCCTGCATGGCATTAGTTTGTTGGGGCAGTGCCCGGATAGCATCAACGCTGCGCTGAT TTGCCGTGGCGAGAAAATGTCGATCGCCATTATGGCCGGCGTATTAGAAGCGCGCGGTCACAAC GTTACTGTTATCGATCCGGTCGAAAAACTGCTGGCAGTGGGGCATTACCTCGAATCTACCGTCG ATATTGCTGAGTCCACCCGCCGTATTGCGGCAAGCCGCATTCCGGCTGATCACATGGTGCTGAT GGCAGGTTTCACCGCCGGTAATGAAAAAGGCGAACTGGTGGTGCTTGGACGCAACGGTTCCGAC TACTCTGCTGCGGTGCTGGCTGCCTGTTTACGCGCCGATTGTTGCGAGATTTGGACGGACGTTG ACGGGGTCTATACCTGCGACCCGCGTCAGGTGCCCGATGCGAGGTTGTTGAAGTCGATGTCCTA CCAGGAAGCGATGGAGCTTTCCTACTTCGGCGCTAAAGTTCTTCACCCCCGCACCATTACCCCC ATCGCCCAGTTCCAGATCCCTTGCCTGATTAAAAATACCGGAAATCCTCAAGCACCAGGTACGCпятница, 5 октября 12 г.
  23. 23. Геномикапятница, 5 октября 12 г.
  24. 24. Геномыпятница, 5 октября 12 г.
  25. 25. Сборка Геномапятница, 5 октября 12 г.
  26. 26. Comparative Genomicsпятница, 5 октября 12 г.
  27. 27. Протеомикапятница, 5 октября 12 г.
  28. 28. Протеомикапятница, 5 октября 12 г.
  29. 29. Домашнее задание http://rosalind.info • DNA • RNA • REVC • PROT • HAMM http://rosalind.info/classes/enroll/ 171da3d314a0b07e00883287cd2b6ddeeeba225b/пятница, 5 октября 12 г.
  1. A particular slide catching your eye?

    Clipping is a handy way to collect important slides you want to go back to later.

×