• Share
  • Email
  • Embed
  • Like
  • Save
  • Private Content
Cancer
 

Cancer

on

  • 2,817 views

 

Statistics

Views

Total Views
2,817
Views on SlideShare
2,817
Embed Views
0

Actions

Likes
2
Downloads
68
Comments
0

0 Embeds 0

No embeds

Accessibility

Categories

Upload Details

Uploaded via as Microsoft PowerPoint

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

    Cancer Cancer Presentation Transcript

    • Fisiopatologia de Cancer
      • Dra.Cristina Wong
    • Características células cancerosas
      • MONOCLONALIDAD : un tumor se origina a partir de un única célula.
      • AUTONOMÍA : proliferan sin seguir las leyes que controlan la división celular
      • ANAPLASIA : son células poco diferenciadas, se vuelven inmaduras. (cambio fenotípico)
      • AGRESIVIDAD : por linfa o sangre, invaden otros organo
      • CAMBIO DE FORMA
    • BIOLOGÍA DE CÉLULA NEOPLÁSICA
      • Crecimiento (Ciclo celular)
      • Regulación
      • Diferenciación
      • Migración
      • Apoptosis
    •  
    • Generalidades
      • El cáncer se produce por un fallo en el control del ciclo celular.
      • Se debe a fallos en los genes que controlan dicho ciclo celular.
      • Estos genes son:
        • Protooncogenes
        • Genes supresores de tumores
    • CAUSAS DEL CANCER
    • GENES Y CANCER
      • Gen: porci ó n del DNA codifica 1 proteina
      • Genoma Humano: 25 000 a 30 000 genes, hay mas proteinas
      • Transcripción: Copia del DNA hasta RNA mensajero
      • Traducción: Formación proteina por ribosomas
    • ¿Qué es un protooncogén?
      • Es un gen normal que interviene la proliferación celular.
      • Se considera que son dominantes , ya que transforman a las células aunque sus alelos sean normales.
    • ¿Qué es un oncogén?
      • Es la forma mutada de un protooncogén.
      • Codifica una proteína anormal (oncoproteína), que se mantiene activa independientemente de las señales reguladoras (no se degrada).
      • Esto convierte a la célula en tumoral por una proliferación desordenada.
      • En los humanos se han identificado más de 60 oncogenes.
    • PROTO-ONCOGENES Y ONCOGENES
      • Proto-Oncogenen: Gen normal relac. div. celular
      • Oncogen: Alteración de proto-oncogen: sobre-expresión
      • El proto-oncogén tiene una función útil en el control del ciclo celular.
      • Cambio:
        • Mutación:
          • Física
          • Química
        • Translocación cromosómica
        • Transposición
      • Oncogen  proliferación incontrolada
    •  
    • Gen normal Protooncogén Gen mutado Oncogén Expresión Expresión Proteína normal Proteína anómala ( Oncoproteína ) Hay estímulo Hay estímulo La proteína actúa La proteína actúa No hay estímulo No hay estímulo La proteína no actúa La proteína actúa Mutación Función normal Actividad excesiva Cáncer Oncogén Sobreexpresión
    • Genes oncosupresores
      • Son genes normales que actúan deteniendo la división celular.
      • La mutación de un gen supresor hace que “pierda esta función” y se pueda desarrollar un tumor.
      • Para que se produzca la transformación neoplásica de la célula, deben resultar dañados los dos alelos (son recesivos ).
      Cuando están activos ejercen un efecto antiproliferativo en la célula
    • Gen oncosupresor Gen oncosupresor mutado Expresión Expresión Proteína normal oncosupresora Proteína anómala ( no Oncosupresora ) Hay estímulo Hay estímulo La proteína actúa La proteína no actúa No hay estímulo No hay estímulo La proteína no actúa La proteína no actúa Mutación Función normal No hay actividad Cáncer Gen supresor
    • Ejemplos de Genes supresores
      • RB : Frena el avance de la fase G1 a S en el ciclo celular.
      • Retinoblastoma familiar
      • P53 : Induce a otros genes:
        • Detienen el ciclo celular (p21).
        • Promueven la reparación de ADN (GADD45)
        • o promueven la apoptosis (BAX)
        • Síndrome de Li-Fraumeni
      • APC : Regula la degradación de la β -Catenina
      • Poliposis familiar adenomatosa de colon
      • NF-1, NF-2: Acción similar a APC (neurofibromatosis 1 y 2)
      • PTEN (síndrome de Cowden) VHL (von Hippel-Lindau), WT1
      Producen síndromes cuando hay mutación en la “línea germinal”
    •  
    • CODIGO GENETICO Y CANCER
    • Código genético
      • Es el lenguaje en el que están escritos los genes (es universal).
      • A , T , G , y C son las "letras" del código genético
      Homo sapiens otospiralin (OTOS) ; Location: 2q37.3 CCCATCCAGGCAGCACGGCTGGCTGAGCAGAGACAAGGGCTGCCACACTGGGACTGGTAGAGGAAGCCCTGACGGATGGGTGGTCTCGCCCTTCCTGGGTTCATCCTGCTGCAGGTGGGCCTGAGTCGCAGATCAGAACACCGGGAAGATGCAGGCCTGCATGGTGCCGGGGCTGGCCCTCTCCTCCTACTGGGGCCTCTTGAGGGGCCAAGCCTGTGCAGGAGGAAGGAGACCCTTACGCGGAGCTGCCGGCCATGCCCTACTGGCCTTTTCCACCTCTGACTTCTGGAACTATGTGCAGCACTTCCAGGCCCTGGGGGCCTACCCCCAGATCGAGGACTGGCCCGAACCTTCTTTGCCCACTTCCCCCTGGGGAGCACGCTGGGCTTCCACGTTCCCTATCAGGAGGACTGAATGGTGTCCAGCCTGGTGCCCGCCCACCCCGCCAGGCTGCACTCGGTCGGGCCTCCACAGGCATGGAGTCCCCGCAAAAACCTGGCCCCTGCAGGAGTCAGGCCTGGTCTCACGCTCAATAAACTCCGGACTGAAGATGCA
      • Gracias