• Save
What Darwin Didn't Know
Upcoming SlideShare
Loading in...5
×
 

What Darwin Didn't Know

on

  • 1,220 views

Darwin didn’t know what we know in science today. He didn’t know science on a cellular level, … biochemistry & electron microscopes weren’t available to him....

Darwin didn’t know what we know in science today. He didn’t know science on a cellular level, … biochemistry & electron microscopes weren’t available to him.

For example, in Darwin’s day, people referred to the amazing cell as a “simple” cell, and thought cells were just blobs of jelly-like material. People also still believed in spontaneous generation; that means that they believed that decaying meat generated maggots and that stale bread generated mold…….

In fact, spontaneous generation is the basis for the evolutionary theory that life erupted from a pre-historic chemical soup. So, just as we know today that meat does not produce maggots and bread doesn’t produce mold, we have a better understanding of the truly miraculous single cell. True science has proven that spontaneous generation is impossible. ....

Statistics

Views

Total Views
1,220
Views on SlideShare
969
Embed Views
251

Actions

Likes
0
Downloads
0
Comments
0

2 Embeds 251

http://www.notbychance.net 247
http://sitebuilder.yola.com 4

Accessibility

Categories

Upload Details

Uploaded via as Microsoft PowerPoint

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

What Darwin Didn't Know What Darwin Didn't Know Presentation Transcript

  • WHAT DARWIN DIDN’T KNOW
  • “I had no intent to write atheistically.”
  • “False facts are
    highly injurious
    to the progress of science, for they often endure long.”
  • “If it could be demonstrated that any complex organ existed, which could not possibly have been formed by numerous, successive, slight modifications, my theory would absolutely break down.”
  • If it could be demonstrated
    that any complex organ existed
    which could not possibly have been formed by numerous, successive, slight modifications
    my theory would absolutely break down.
  • Irreducible Complexity
  • “The human eye, to this day, gives me a cold shudder.” --- Darwin
    PROBLEM: IRREDUCIBLE COMPLEXITY
  • WHOLE PACKAGE PHENOMENON
  • “to suppose that the eye, … could have been formed by natural selection, seems, I freely confess, absurd in the highest possible degree.”
  • “the human eye to this day gives me a cold shudder”
    Darwin to Asa Gray
  • PROBLEM: MUTATIONS
  • Darwin’s “Beneficial” Mutations
    Loss of winged flight
    Loss of eyes / vision
  • “The hearing ear and the seeing eye, the Lord has made them both”
    Proverbs 20:12
  • 100,000,000,000,000 CELLS
    PROBLEM: THE CELL
  • Darwin’s “simple” cell
    “A simple little lump of albuminous carbon.”
    Haeckel
    Extremely complex cell
  • ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATC
    3,750,000,000 LETTERS = 1 DNA molecule
  • 108,000,000,000,000 miles of
    DNA in your body
  • Darwin Was Right
    “Natural selection” means that organisms that are best suited to their environment survive and pass on their genetic characteristics to succeeding generations while organisms that are less adapted tend to be eliminated.”
  • PROBLEM: NATURAL SELECTION
  • 193 species
    of monkeys & apes
    Only one needs clothes
  • 95-98%
    92%
    The Problem of
    Genetics
    I’m a banana!!
    99%
  • WOLF
    PROBLEM: INTERMEDIATE SPECIES
    WHALE
  • ‘’The number of intermediate varieties which have formerly existed on the Earth must be enormous….
  • …Why then is not every geological formation and every stratum full of such intermediate links? ...
  • The Problem of Fossils
    Geology assuredly does not reveal any such finely graduated.. chain (such as the chain from bear, pig, or wolf to whale): and this, perhaps, is the most obvious and gravest objection which can be urged against my theory.”
  • Stephen Jay Gould
    Paleontologist /& Evolutionary Biologist
    (1941-2002)
    "The absence of fossil evidence for intermediary stages ….. indeed our inability, even in our imagination, to construct functional intermediates …., has been a persistent and nagging problem for ….evolution.“
    "The extreme rarity of transitional forms
    in the fossil record persists as the trade
    secret of paleontology.”
    “Paleontologists have paid an exorbitant
    price for Darwin's argument.…we never
    see the very process we profess to study.“
  • PROBLEM:
    GIFTS
  • What Darwin Didn’t Know....
  • Mt. 5:18For truly, I say to you, until heaven and earth pass away, not an iota, not a dot, will pass from the Law until all is accomplished.
    In the Gospels:
    11x – “Have you not read…..”
    30x – “It is written……..”
  • ROMANS 1:18-24
    ….suppress the truth
    …. clearly perceived..since creation
    ….without excuse
    ….did not honor Him or give thanks
    ….foolish hearts darkened
    ….claiming to be wise (their theories)
    ….exchanged the glory of God
    (for evolution)
  • “For You formed my inward parts;You wove me in my mother’s womb.
    I will give thanks to You, for I am fearfully and wonderfully made;Wonderful are Your works,And my soul knows it very well.”Psalm 139:13-14