Your SlideShare is downloading. ×
0
Innovaciones en el Mejoramiento de la Papa
Innovaciones en el Mejoramiento de la Papa
Innovaciones en el Mejoramiento de la Papa
Innovaciones en el Mejoramiento de la Papa
Innovaciones en el Mejoramiento de la Papa
Innovaciones en el Mejoramiento de la Papa
Innovaciones en el Mejoramiento de la Papa
Innovaciones en el Mejoramiento de la Papa
Innovaciones en el Mejoramiento de la Papa
Innovaciones en el Mejoramiento de la Papa
Innovaciones en el Mejoramiento de la Papa
Innovaciones en el Mejoramiento de la Papa
Innovaciones en el Mejoramiento de la Papa
Innovaciones en el Mejoramiento de la Papa
Innovaciones en el Mejoramiento de la Papa
Innovaciones en el Mejoramiento de la Papa
Innovaciones en el Mejoramiento de la Papa
Innovaciones en el Mejoramiento de la Papa
Innovaciones en el Mejoramiento de la Papa
Innovaciones en el Mejoramiento de la Papa
Innovaciones en el Mejoramiento de la Papa
Innovaciones en el Mejoramiento de la Papa
Innovaciones en el Mejoramiento de la Papa
Innovaciones en el Mejoramiento de la Papa
Innovaciones en el Mejoramiento de la Papa
Innovaciones en el Mejoramiento de la Papa
Innovaciones en el Mejoramiento de la Papa
Innovaciones en el Mejoramiento de la Papa
Innovaciones en el Mejoramiento de la Papa
Innovaciones en el Mejoramiento de la Papa
Innovaciones en el Mejoramiento de la Papa
Innovaciones en el Mejoramiento de la Papa
Innovaciones en el Mejoramiento de la Papa
Innovaciones en el Mejoramiento de la Papa
Innovaciones en el Mejoramiento de la Papa
Innovaciones en el Mejoramiento de la Papa
Innovaciones en el Mejoramiento de la Papa
Innovaciones en el Mejoramiento de la Papa
Innovaciones en el Mejoramiento de la Papa
Innovaciones en el Mejoramiento de la Papa
Innovaciones en el Mejoramiento de la Papa
Innovaciones en el Mejoramiento de la Papa
Innovaciones en el Mejoramiento de la Papa
Innovaciones en el Mejoramiento de la Papa
Innovaciones en el Mejoramiento de la Papa
Innovaciones en el Mejoramiento de la Papa
Upcoming SlideShare
Loading in...5
×

Thanks for flagging this SlideShare!

Oops! An error has occurred.

×
Saving this for later? Get the SlideShare app to save on your phone or tablet. Read anywhere, anytime – even offline.
Text the download link to your phone
Standard text messaging rates apply

Innovaciones en el Mejoramiento de la Papa

1,025

Published on

Merideth Bonierbale - ALAP 2010 Congreso Asociacion Latinoamericana de Papa Cuzco, Peru, mayo 2010 …

Merideth Bonierbale - ALAP 2010 Congreso Asociacion Latinoamericana de Papa Cuzco, Peru, mayo 2010

1 Comment
2 Likes
Statistics
Notes
No Downloads
Views
Total Views
1,025
On Slideshare
0
From Embeds
0
Number of Embeds
1
Actions
Shares
0
Downloads
0
Comments
1
Likes
2
Embeds 0
No embeds

Report content
Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
No notes for slide

Transcript

  • 1. Innovaciones en elMejoramiento de la Papa Merideth Bonierbale Cusco, 25 Mayo, 2010
  • 2. Las Innovaciones en el Mejoramiento han contribuido a:1. Mejorar la interpretación de la estructura e historia de la diversidad genética2. Identificar nuevas características para garantizar la seguridad alimentaria y la productividad estable3. Facilitar la comprensión de la base genética de la variación de caracteres en la fuente de genes del cultivo4. Ampliar la base genética de caracteres de adaptación5. Minimizar los efectos ambientales para maximizar el poder de selección
  • 3. rap ver pcs ber amb tbrchq san mcd acl adg sto chc acg pur spl1. Mejorar la interpretación de la estructura e historia de la diversidad genética
  • 4. Caracterización de Colecciones de GermoplasmaA. Identidad/Distinción (duplicados ID) C. Medidas cuantitativas de las distancias genéticas B. Riqueza de Alelos
  • 5. Formación de Colecciones Núcleos Species Series Ploidy(EBN) Especies taxonómicas Origen geográfico Caracteres morfológicas Diversidad molecular (structural) Respuesta Hospedero- Patógenos Diversidad molecular (funcional)
  • 6. Correlacionando la variación genotípica yfenotípica: Mapeo por Desequilibrio de Ligamiento Pij(k) = µ + Ck + αXi(k) + gi(k) + yj + ei(k)j Diversidad Genética Ind.1 Ind.2 Ind.3 Ind.4 Ind.5 Ind 6 Ind.7 Ind.8 Ind.9 Ind.10 Ind.11 QTL Gen Candidato
  • 7. Caracterización fenotípica de la resistencia al tizón tardío en la Población B1 n 0º Colombi AUDPC= Σ (X i+j + X i ) (t i+1 - t i ) i=1 3º Ecuado a Concepción (Sierra 2 r 2600m) 6º Brazil 9º12º Bolivi a15º Oxapampa (Selva18º Chile Alta; 1814m)
  • 8. Asociando la variación fenotípica y genotípica de la resistencia al tizón tardío en la Población Mejorada B1 Chromosoma IIMarcador SSR STG-0006 en el Cr 2 asociado a la resistencia por LD AUDPC 5500 Presencia 5000 4500 Ausencia25 4000 350020 300015 2500 200010 15005 B1C5 1000 B1C0 5000 B1C0 B1C0 B1C5-A B1C5-A B1C5-B B1C5-B Población AUDPC (Promedios) Frequency Marker alleles B1C0 B1C5 STG-0006.174 33% 0% STG-0006.170 19% 32% STG-0006.179 48% 67%
  • 9. 2. Identificar nuevas características para garantizar la seguridad alimentaria y productividad estable303846 303835 303845 303828 303842 303826 303841 303832
  • 10. Análisis estadístico de Componentes Principales: Perfil de diferentes grupos de germoplasma en la acumulación de nutrientes C P1= 48.35 % C P2=32.43% SUM=80.78% 3 VITCDW 2 1 CP2 ZNDW 0 -1 FEDW -2 -3 -3 -2 -1 0 1 2 3 4 5 CP1 Poblacion LTVR Poblacion B3 Variedades del Mundo Variedades locales del Peru
  • 11. Desarrollo de la técnica de “Espectroscopía deInfrarrojo Cercano” (NIRS) en la evaluación masal del contenido de micronutrientes en poblaciones mejoradas y germoplasma Limpieza Procesamiento Secado Análisis NIRS Muestras Llenado para ser Muestras1 5 10 congeladas 14 de la Lavado procesadas cubeta Muestras listas Pelado 6 Liofilizado 15 para Clasificando 11 (72h) escanear2 las muestras Una muestra 7 representativa 16 Escaneo Empacado NIRS3 12 Molienda Obtención de la 8 muestra Espectro en rodajas 17 Almacena NIRS Muestras miento de 13 molidas4 las muestras Pesar la 9 muestra Resultados fresca 18 NIRS
  • 12. Estimados de parámetros genéticos para el contenido de micronutrientes en clones promisorios 0.6 GCA Fe 0.08 0.5 Mean of Fe 0.43 0.46 0.49 0.44 0.43 0.06 Hierro Heritability Estimates 0.42 0.43 0.42 0.41 0.40 0.40 0.39 Fe mg/100mg fw 0.4 0.04 gca effectsGeneral Combining Ability 0.3 0.02 0.2 0.00 0.1 -0.02 2 0.0 REICHE -0.04 h MONALISA PW88-6065 PW88-6187 88-108 C92.140 LR-93.160 OREB ATLANTIC LT-8 SPUNTA TXY.2 0.5 0.47 0.47 0.08 0.45 0.44 0.4 0.40 0.42 0.36 0.37 0.42 0.39 0.40 0.37 0.06 0.04 Zinc Zn mg/100 mg fw 0.02 gca effects 0.3 0.00 0.2 -0.02 -0.04 0.1 GCA Zn Mean Zn -0.06 0.0 20 18.8 -0.08 5 17.4 Vitamina C REICHE PW88-6065 PW88-6187 MONALISA 88.108 C92.140 LR-93.160 OREB LT-8 TXY.2 ATLANTIC SPUNTA 18 16.8 15.6 4 Vit C m g/100m g fw 15.0 14.4 15.1 16 13.7 14.3 3 13.1 13.4 14 gca effects 12.2 2 12 1 10 0 8 -1 6 4 GCA Vit C -2 2 Mean Vit C -3 0 -4 R EIC H E PW 88-6065 PW 88-6187 M O N A LISA 88.108 C 92.140 LR -93.160 O R EB LT-8 TXY.2 A TLA N TIC SPU N TA
  • 13. Ganancia genética para la concentración deHierro (Fe) y Zinc (Zn) en base fresca (mg/100mg pf) en papas nativas diploides (2x) 2005 2007 1.20 1.20 Mean =0.60+0.13 Ciclo 0Fe (mg/100g,PF) N=16 0.90 Mean =0.49 +0.07 0.88 28 progenitores N=28 0.80 0.72 (cultivares 0.65 0.60 0.55 0.64 0.60 0.56 nativos de stn, gon, phu) en 0.50 0.49 0.48 0.45 0.40 0.40 0.35 0.32 NCDI – 16 0.00 0.00 familias 0.90 0.90 Mean=0.50+0.07 Ciclo 1 N=16 Zn (mg/100g,PF) Mean=0.38+0.08 N=28 0.65 16 progenitores 0.60 0.60 0.55 0.50 0.50 0.45 Fe y Zn NCDII - 0.40 0.38 0.30 0.40 0.35 32 families 0.20 0.00 0.00 0 1Selection Cycle 2
  • 14. “Captura de Caracteres” resistente susceptible Herramientas Genómicaspara evaluar características de adaptación: Resistente Susceptible Tolerancia a la SequíaMicroarreglos: Comparación de la • Analisis deexpresión génica significanciaglobal. • Atribución de Cambios en la genes a vías oexpresión de genes de señalesclones resistentes y metabólicas Lista de genessusceptibles. candidatos
  • 15. Caracteres FisiológicosComparación de la eficiencia en el uso de agua dedos clones tetraploides: Tolerante y Susceptible CLONE: CANCHAN Control Estomático Ajuste Osmótico
  • 16. Características de tolerancia a la sequía Comparación entre el clon CIP 397077.16 (resistente) y la variedad Canchán (susceptible) a nivel morfológico, agronómico, fisiológico y genómicoPerfil fisiologico CIP 397077.16 CanchánPérdida de rendimiento debajo del 30% 60%Conductancia estomática menor mayorAjuste osmótico fuerte débilArea foliar menor mayorRWC no hay cambios no hay cambiosPerfil de expresión génica(6k ARC chip)Genes inducidos 204 82Genes reprimidos 84 29Regulación transcripcional NAC-TF, WRKY4Ajuste osmótico osmotinaDetoxificación GlutarredoxinaRescate celular Hsp, chaperonas, cloroplastos inhibidores de proteasas de permanencia verde, Lea chaperonasMobilización de Almidones α-amilasaMembrana Proteinas que tranfieren lípidosMetabolismo secundario Biosíntesis de terpenos
  • 17. GATCCCCGCCAA ACCCT AT TGTTGGTACTAGTTCACGGG TCATTCTGCT ATGCA 280 290 300 310 3200 POX67 7 TG52310 PCO00218 PCO9319 CT182212223 E32M48R6 C2At2_TaqI.2 C2At2_TaqI.1 3. Facilitar la comprensión de la262732 NL25_HpaII PCO93all RecepSer/ThrKin base genética de la variación de364344 TG651 NBS5_HaeIIIR2 TG497 caracteres de adaptación en las51 TG629 fuentes de genes del cultivo57 TG14759 P2_HaeIIIR36669 P3_HaeIIIR4 NBS9_MseIR6 NBS LRR72 NBS5a_HaeIIIR375 CT05582 TG400 P-loop Kinase-2 GLPL90 TG044 S1 NBS5a6 NBS9 S2 KIN1 GLPL4 P-loop1 NBS3
  • 18. Limitación• Falta de información genética específica para la mayoría de características agronómicamente importantes.• Esta falta de “genes a la mano” impide el progreso en el mejoramiento para caracteristicas complejas y aún para algunas de herencia simple.
  • 19. Descubriendo fuentes de resistenciacomplementarias al tizón tardío a nivel poblacional S. piurae S. paucissectum OCH11640 S. chiquidenum OCHS15210 S. chomatophilum S. acroglosum S. cajamarquense Acc. SCL 5050 3000 2500 2000 s S AUDPC 1500 1000 r OCH 14187 R 500 0 acg cjm chq chm pcs pur chm
  • 20. Identificación de fuentes genéticas para elPASOS carácter Construcción de poblaciones segregantes Identificación de marcadores que rodean al gen de interés Localización de QTL I II III IV V VI VII VIII IX X XI XII tbr Meyer et al., 1998 tbr Ewing et al., 2000 tbr Ghislain et al., 2000 tbr Leonards-Schippers et al., 1994 phu Ghislain et al., 2000 tbr, ktz, vrn, tar, stn Collins et al., 1999 blb Naess et al., 2000 tbr, chc, ktz, stn, vrn Oberhagemann et al., 1999 mcd Sandbrink et al., 2000
  • 21. Construcción de la población segregante PCC1 (S. paucissectum/.chomatophilum//S.chomatophilum) para resistencia al tizón tardíoS. paucissectum S. chomatophilum PI 473489-1 PI 310991-1 Resistant susceptible F1 MP1-8 PCC1 Resistant n=192 35 Monserrate Mean=1968.07 LBr-40 Chata Blanca Yungay SD=698.93 30 pcs n=176 Atzimba 473489.1 ( C ) 25 Female MP1-8(R) 20 15 10 5 0 666.88 975.13 1283.39 1591.65 1899.90 2208.16 2516.42 2824.67 3132.93 3441.19 Mean AUDPC 77 DAP
  • 22. e46m42.I e34m33.o e32r33.f e32m48.b e36r36.a BGL.11rr S13.700 E41M59.F e34r33.b e36r36.c E34r61.B 8.9 5.7 8.1 11.2 AJ8.1120 10.6 3.3 e31m48.g H10.2400 14.9 14.520.7 e32m48.d e31r58.c 20.3 e32m49.a e46r42.f 5.0 5.6 23.2 6.9 8.6 6.1 E34r61.A 4.5 R6.2100 28.5 3.3 T11.810 S017.p1 E39r61.C e32r48.g e32r61.d e38r49.d 5.0 E34M61.C 3.3 e39r50.d 4.4 7.1 11.2 e45r42.e J3.6rr 2.2 AJ8.5203.4 3.3 e46m42.b 3.3 e35m61.a 6.2 e31r54.b E38r39.D e45r42.f 14.3 e32m61.w 7.3 G13.8803.4 2.2 1.1 T4.1720 G3.950 AR1.1rrr 3.4 e32m61.b e34m33.L 27.81.1 2.6 AML.1000 E35M48.B 32.7 I12.75r G3.113r 6.3 14.72.2 E35r54.A E32M49.E e32m33.d 23.0 23.0 10.7 3.7 11.5 e32m51.e e45r59.b 22.33.3 1.4 18.3 M11.12507.2 E35r54.B e31r58.f E45M60.D e46m42.e AML.2100 6.2 2.2 32.6 e46r42.c Y6.420 N1.1750 e45m42.d e31m48.j E32M61.F 12.5 14.8 e32m61.a e31m58.b 12.2 6.2 e39m50.a 15.9 3.5 13.024.0 e45m59.e 7.5 11.9 Q7.34r S106.p1 2.2 e34r33.k 4.5 B8.790 21.3 e34r33.j 8.6 17.2 B4.78r 5.9 BG3.13rr e32r61.e e35m48.a 2.9 J9.450 9.2 4.4 e31m54.t e34m34.a 7.2 B8.1190 8.0 M11.2650 1.6 e33r34.a E40M51.D 9.3 e34m33.n 3.3 E41M59.B e46r42.d E35r58.B e31m58.e e36m50.e 10.710.8 8.1 e32r61.c 4.5 8.5 e46m42.j E35M58.D E38r39.A 5.8 12.7 e34r33.m 22.2 e46r42.h 27.1 E39M61.D 9.83.3 2.4 22.1 AD3.1700 e45m59.c E39r61.E 24.4 e32m51.c1.1 5.7 E34r61.H e45r42.h 17.75.9 N3.780 5.7 12.7 e32m51.d 4.4 e36r50.a e31m36.a e45r59.d e46m42.a B6.1400 6.8 M2r.78r E34M61.I 3.3 K8.78r E35r58.C 5.0 1.3 13.9 S8.940 23.4 Z1.8rr 4.2 H6.125r E39r50.E 18.1 S064.r2 e36r36.d I II III IV V VI VII VIII IX X XI XII Oxapampa 40 % Región “Hotspot” QTL y genes Comas 30% mayores en el chr11 1R3, 2R3a, b, 15% 3R6, R7 4 R10, R11 10% 1 El Kharbotly et al 1994 2 Huang et al 2004 POX67 3 El Kharbotly et al 1996 PCO093 4 Bradshaw et al 2006 5 Leister et al 1996 6 Hämäläinen et al 1997 5N,6Ry
  • 23. Genes Candidatos útiles en la caracterización de QTL Ejemplo : Carotenoides Genes Candidatos Mapas Genéticos (genética clásica) Tomate Pimiento Cromosoma 3 Thorup et al. 2000
  • 24. Localización de Genes Candidatos de laBiosíntesis de Carotenoides en la Papa Chr. 2 (PD) Chr. 2 (BCT) Chr. 3 (PD) Chr. 4 (PCC1) Zeaxanthin epoxidase β-carotene Phytoene hydroxylas Synthase e Asociado con β Lycopene-β- • zeaxantina cyclase • Totales Asociado con • luteina, β -caroteno • zeaxantina • totales Asociado con • , luteina β -caroteno • Totales Asociado con , zeaxantina Totles
  • 25. Asociando la variación fenotípica para el contenido de carotenoides con la variación genotípica o polimorfismos de marcadores SSR en el GrupoPhureja: Mapeo por Desequilibrio de Ligamiento (LD) S T M 5140 -19 3 A s s o c ia te d alle le s S T G 0 016- 1 55 S T M 2 022-195 S T I00 24-177 S T M 1 053-186 S T M 5140 -19 9 S T I0 023-212 T o tal C aro te n o id s ↑ + 38 3 ↑ + 1 60 A n th e ro x an th in ↓ - 43 ↑ + 38 ↓ - 32 Z eaxan th in ↓ - 150 ↓ - 1 24 β -caro ten e ↑ + 2 .4 I II III IV X * *** ** 703352 * Gon 703168 703831 *** *** * Gon *** Phytoene synthase ß-caroteno Lycopene 701165 Zeaxanthin epoxidase hydroxylase ß-cyclase Phu
  • 26. Perfil de Expresión de Genes: Microarreglos en el descubrimiento de genes asociados a unacaracterística: Ejemplo Resistencia la tizón tardío Diseño Clon avanzado Entrada resistente de resistente de la la especie silvestre S. B3 Población B3 cajamarquense (cjm) 274 30 cjmInoculación con aislamientos POX067 y PE 329 Recognition Colección de Muestras R genes CC-NBS Bs2-like CTV2 ADR1 CC-NBS Bs2-like CTV2 ADR1 Dirigent Dirigent 72h y 96h luego de inoculación LRR class LRR class protein protein Chr10 Chr10Hibridación con arreglo de papa TIGR10K Proteolysis ProteolysisPAD4 Signaling Signaling Chr9 Chr9 C3HC4-type EDS1 ACRE74 RING Chr6 ACRE276 finger EDS5 Chr6 Study # 83 at Solanaceae Gene expression database: Ubiquitination Ubiquitination pathway PAL Chr9 Chr9 http://www.tigr.org/tdb/potato/SGED_index2.shtml Chr12 Chr12 Chr3 SA Chr3 SA
  • 27. .. Genes Ortólogos: genes que comparten un ancestro común por especiación [Paterson y col. 1995. Science] Demostró que la mayoría de las mutaciones seleccionadas por los agricultores en la domesticación de pastos a partir de los parientes silvestres eran los mismos genes en diferentes especies tales como el arroz, maíz y trigo
  • 28. Uso de secuencias ortólogas disponibles entre especies, en la ubicación de genes y susfunciones, en otra donde no se dispone de dicha información COS COS COS COS COS COS COS COS COS COS COS COS COSArabidopsis Seleccionar Sub- COS Lycopersicum thaliana set de COS sculentum “domesticación” COS COS COS Ubicar y secuenciar COS en mapas genéticos de COS papa COS Solanum N=84 tuberosum COS
  • 29. Secuenciamiento del Genoma de la Papa PGSC por Secuenciamiento de novo Ensamblaje de los Contigs a partir de insertos de 150~ 500 bp de librerías genómicas Lecturas Contigs Ensamblaje los Scaffolds a partir de insertos de 2kb. 5kb, 10kb de librerías genómicas a gran escala Scaffold Ensamblaje de superscaffold por 454, Extremos pareados Fosmid y BACSuperscaffold 中国农业科学院蔬菜花卉研究所 Institute of Vegetables and Flowers Chinese Academy of Agricultural Sciences
  • 30. Consultando el genoma de la papa en buscade secuencias de genes de resistencia en la región “hotspot” del cromosoma 11 Mapa genético de Solanum paucissectum Mapa Físico DM cromosoma 11 0 POX67 Cromosoma 11 SUPER SCAFFOLD_ID MARKER GM_POS PGSC0003DMB000000365 PM1281_251 65.748 7 TG52310 PCO002 TG523 PGSC0003DMB000000131 PGSC0003DMB000000365 PM0395.122.A PM1281_237 57.835 57.252 PGSC0003DMB000000131 538888 56.6118 PCO93 solcap_stsnp_c1_6643 54.711921 CT182 E32M48R6 CT182 PGSC0003DMB000000354 PM0206 solcap_stsnp_c1_6633 54.257 53.4522 C2At2_TaqI.2 PGSC0003DMB000000152 STG0001.150_XI 51.4262326 C2At2_TaqI.1 NL25_HpaII NL25 PGSC0003DMB000000148 473601 50.91827 PCO93all PGSC0003DMB000000365 solcap_stsnp_c1_2221 50.77532 RecepSer/ThrKin Put_recKin36 TG65143 NBS5_HaeIIIR244 TG497 Super scaffold PGSC0003DMB000000152 0 1.4Mbp51 TG62957 TG147 Genes59 P2_HaeIIIR3 Predecidos >PGSC0003DMC10002883966 P3_HaeIIIR4 ATGGCAAAATCATCCCATGAAATTGAGCACCCAATTAAGGCATTTGGATGGGCAGCTAGA69 NBS9_MseIR6 GACACTTCTGGTGTTCTTTCTCCTTTCAACTTCTCAAGAAGGGCTACTGGGGAGAATGAT72 NBS5a_HaeIIIR3 Diseño de nuevos GTACAATTCAAAGTGTTGTATTGTGGAATATGTCACTCAGATTTTCATATGCTCAAGAAT GAATGGGATAATTCCAAGTACCCTATTGTGCCTGGGCATGAGATCGTGGGAGTGGTAACC75 CT055 oligos para saturar GAGGTCGGTAGCAAGGTTGAAAAAGTGAAAGTGGGGGACAATGTAGGTGTTGGAGTAATC GTAGGATCATGTCGAAAATGTGATAGTTGTACCAATGACCTCGAACAATATTGTTCTAGC82 TG400 AGTATTGGCACGTATAGTACAACTTACTATGACGGAACCACCACACACGGAGGCTACTCC región hotspot en GATCTCATGGTAGCCAACGAGCATTTCGTGCTCCGTTGGCCGGAGAATTTACCGATGGAT GCTGCCCCATTGTTGTGTGCTGGTATCACAACATATAGCCCATTGAGATATTTTGGGCTT90 TG044 Solanum paucissectum GATAAGCCTGGATTGAACATTGGTGTTGTGGGCCTTGGTGGGCTGGGCCATATGGCTGTG AAATTTGCAAAGGCTTTTGGATGCAATGTGACTGTTATTAGTACTTCTATTAATAAGAAG GATGAAGCAATTAAACATCTTGGTGCTAATTCATTCTTGATTAGTCATGATCAAGAACAA ATCAGGTATTTTTTCTCACTGGTTTAG
  • 31. Especies Las primeras VariedadesSilvestres domesticadas Modernas 4. Ampliar la base genética de caracteres de adaptación
  • 32. Utilizando especies silvestres y cultivadas heterocigóticas Aprovechando interacciones génicas no aditivas: Método: Poliploidización sexual Uni y Bilateral Fuentes diploides Progenitores silvestres y cultivadas (2x) tetraploides (4x) Gametos 2n rap pcschqber mcd phu x gon chm stn pur spl
  • 33. Rescate de Embriones: Método para acceder al Acerbo Terciario Bayas Abrir las bayas en (19-27 días condiciones asépticas. después Usar cámara de flujo polinización) laminar. Extirpar bajo Estereomicrsocopio Esterilizar Superficie (Etanol Torpedo 70% 30s Polinización Hipoclorito de Ca Globular Acorazonado Transferir pro- Propagación in-vitro Plántulas de embriones (faseTransplante al en medio tres nódulos de torpedo) a invernadero Murashinge Skoog medio de cultivo
  • 34. Híbridos inter- específicos resistentes aP. infestans desde rescate de embriones confirmados por marcadores SSR A B C D E F Group Goniocalyx × S. chiquidenumA B C D E F
  • 35. Hibridación Inter-poblacional: Aprovechando las interacciones génicas no aditivas en papas tetraploides Ganancia genética por Heterosis Población Población Combinando B3 resistencia a virus y LTVR tizón tardío Resistencia de campo al tizón Resistencia tardío a virus Adaptación a Adaptación trópicos altos a trópicos bajos
  • 36. Mayor frecuencia de familias heteróticas en la nueva población híbrida interpoblacional Distancias genéticas basadas en SSR útiles en la predicción de grupos heteróticos Las poblaciones progenitoras forman dos grupos claramente definidos 393242.50 391004.18 170 392639.31 160 B3 392639.8 150 B3 393280.64 140 LTVR 392637.27 130 120 LTVRB3 392650.49 110 392657.8 H% 393074.86 100 90 C97.158 80 C97.270 70 WA.077 60 C93.154 50 LTVR C97.214 40 30 LR93.309 20 C90.266 10 LR93.050 0 92.187 -100.40 0.50 0.60 0.70 0.80 0.90 9 10 11 12 13 14 15 16 Coeficiente de Similaridad de Jaccard Coeficiente de Similaridad de Jaccard Número de tubérculos
  • 37. 5. Minimizar los efectos ambientales para maximizar el poder de selección 38Air Temperature ºC 34 30 Max Day Tº 26 22 18 Max Night Tº 14 10 Oct Nov Dec Jan Feb Mar (Midmore, 1992)
  • 38. Selección Asistida por Marcadores (MAS) Ejemplo: Resistencia Extrema al PVY CP58, CT182 Ry markers Ryadg , Rysto RYSC3, M17, Elimina efectos ambientales sobre el CD17, TG508, M5, M45, M6 fenotipo del caracter GP125 CT 168 Elimina tempranamente los genotipos TG 497 indeseables en una población de mejoramiento TG 327 TG 57 Acelera el progreso en el mejoramiento ahorrando espacio, tiempo y mejorando el CT55 uso de los recursos TG546 TG26 TG393XI M 17
  • 39. Selección de Progenitores Multíplices Asistida por Marcadores: Técnica de Disociación de Alta Resolución (HRM) Escaneador de Luz
  • 40. Mejorar los métodos de tamizados masal = Mejorade estimados genéticos (más precisos).Caso: Resistencia al PLRVInoculación en Componentes Prueba de Inoculación Genéticos de Exposición en brotesbrotes Variancia Natural en Campo DE DE σ2A 190.7 72.7 264.4 98.1 σ2D 121.1 52.7 103.4 37.4 σ2AxL 18.0 14.2 13.0 8.7 σ2DxL 40.1 41.1 3.5 23.2Exposición en σ2e 60.7 6.2 42.6 4.3Campo σ2P 351.0 383.1 h2 0.54 0.20 0.69 0.26Infectores σ2D/σ2A 0.64 0.39
  • 41. Métodos Masales de Selección en Generaciones tempranas para tolerancia al calor Método en Invernadero Método in-vitro Patrones de Tuberización Tuberización Periodo Vegetativo Normal 25oC I II III IV Desórdenes Fisiológicos Inducción de tuberización
  • 42. Herramientas para la evaluación masal de poblaciones de mejoramiento y germoplasma bajo ambientes contrastantes.Ejemplo: Estrés hídrico Cámaras Infrarrojas Termómetro Infrarrojo
  • 43. Cámaras Infrarrojas en la captura de imágenes en tiempo real. Diferentes niveles de estrés hídrico NDVI 0-0.1 S catterplot of N DVI vs Mean Geometric 0.1-0.2 0.2-0.3 131 Env 0.6 DI TD C an ch an 118 0.5 C an ch an 135 0.3-0.4 135 126 131 U n ic a 103 128 U n ica 0.4-0.5 NDVI 124 130 0.4 Reich e 122 128 M .Bo n ita 130 118 Reich e 124 0.5-0.6 0.3 r=0.50 126 103 Fresh yield (t/ha) 0.2 5 M .Bo n ita 10 15 20 25 <16 Scatterplot of NDVI camera vs Yield Mean (t ha -1) Mea n Geome tric 0,7 M.Bonita >24 118 Env DI 131 NI 122 Reiche 130 131 TD 0,6 103 126 Canchan 128 124 Canchan 118 135 NDVI camera 135 Unica 0,5 Canchan 131 135 126 128 103 124 Unica 130 Reiche Unica 0,4 Reiche 130 M.Bonita 124 122 118 128 r=0.88 Riego Normal 0,3 126 103 M.Bonita 0,2 0,0 10,0 13,6 20,0 30,0 40,0 Yield Mean (t ha -1) Déficit de Riego Sequía terminal
  • 44. Flujograma para manejo de Información Publicación de métodosMuestrasInformación depedigríDatos deinvernadero Plataforma Repositorio PlataformaDatos de para para públicacampo mejoradores MejoradoresDatos deLaboratorioAnálisis dedatosCalidad Reportesde datos reproducibles
  • 45. Alianzas Estrtegicas Alcanzando Preferencias yRequisitos de Usuarios Multiples
  • 46. Agradecimientos• W Amoros, G. Burgos, T. Zum Felde• J. Landeo, M. Gastelo• R. Schafleitner, R, Gutierrez• R. Quiroz, C. Barreda• D.Koeyer, L. Portal; R. Simon• M. Ghislain, R. Herrera• H. Villamin. S, de Haan, D. Caldiz• H. Kreuze, M. Orrillo, E. Mihovilovich, E. Salas

×