Department of Food Environmental   Consorzio per la tutela            Consorzio Tutela Vini    and Nutritional Sciences   ...
Sperimentazione condotta nell’ambito del progetto di ricerca n. 1315“Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò...
Department of Food Environmental       Consorzio per la tutela   Consorzio Tutela Vini    and Nutritional Sciences        ...
IndiceIndicePresentazione	7Capitolo 1. Analisi dei fabbisogni,                                  5stato dell’arte e obietti...
PresentazionePresentazione                                La Lombardia è regione leader nel-                             l...
Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico…    penetrazione dei nostri prodotti nei merc...
Capitolo 1. Analisi dei fabbisogni, stato dell’arte e obiettiviCapitolo 1. Analisi dei fabbisogni, stato dell’artee obiett...
Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico…        Gli areali della Franciacorta e dell’...
Capitolo 1. Analisi dei fabbisogni, stato dell’arte e obiettivi   Il crescente e continuato utilizzo di starter commercial...
Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico…     da fermentazione operata da lieviti. Da ...
Capitolo 1. Analisi dei fabbisogni, stato dell’arte e obiettiviprofilo aromatico) soddisfa l’obiettivo della difesa della ...
Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico…     Saccharomyces autoctoni per la produzion...
Capitolo 1. Analisi dei fabbisogni, stato dell’arte e obiettivi   lativi a ciascuna area di produzione, la cui idoneità si...
Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico…     •	 Attività di divulgazione tecnica e sc...
Capitolo 2. Indagine sull’ecologia di lieviti enologici in Franciacorta ed Oltrepò PaveseCapitolo 2. Indagine sull’ecologi...
Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico…     può riguardare sia la “biodiversità inte...
Capitolo 2. Indagine sull’ecologia di lieviti enologici in Franciacorta ed Oltrepò Pavese   Lo sviluppo ed il migliorament...
Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico…        L’analisi PCR-RFLP degli ITS impiega ...
Capitolo 2. Indagine sull’ecologia di lieviti enologici in Franciacorta ed Oltrepò Paveseromycodes, Torulaspora, Dekkera, ...
Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico…     sedimentano velocemente nei mezzi liquid...
Capitolo 2. Indagine sull’ecologia di lieviti enologici in Franciacorta ed Oltrepò PaveseFigura 2.2 Air Sampler “MAS 100 E...
Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico…     Campionamento del mosto        Il campio...
Capitolo 2. Indagine sull’ecologia di lieviti enologici in Franciacorta ed Oltrepò Paveseminati, per spatolamento, in pias...
Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico…     2.2.2 Tecniche molecolari     Estrazione...
Capitolo 2. Indagine sull’ecologia di lieviti enologici in Franciacorta ed Oltrepò PaveseAGTTCAGCGG-GT 3’) (Montrocher, 19...
Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico…     fettuata una fase di estensione finale a...
Capitolo 2. Indagine sull’ecologia di lieviti enologici in Franciacorta ed Oltrepò Pavesecerevisiae)/55°C (S. pastorianus)...
Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico…            Vendemmia e Origine         Numer...
Capitolo 2. Indagine sull’ecologia di lieviti enologici in Franciacorta ed Oltrepò Paveseoperazione era facilitata dall’us...
Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico…     crorganismi dal vino base è stato esegui...
Capitolo 2. Indagine sull’ecologia di lieviti enologici in Franciacorta ed Oltrepò Pavese2.3.2 Biodiversità interspecifica...
Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico…         L’attribuzione della specie per il g...
Capitolo 2. Indagine sull’ecologia di lieviti enologici in Franciacorta ed Oltrepò Paveseterricola e Rhodotorula glutinis ...
Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico…36   Figura 2.7 Biodiversità osservata nei ca...
Capitolo 2. Indagine sull’ecologia di lieviti enologici in Franciacorta ed Oltrepò Pavese    Il campionamento del mosto ha...
Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico…     Franciacorta, mentre Pichia fluxum (0,6%...
Capitolo 2. Indagine sull’ecologia di lieviti enologici in Franciacorta ed Oltrepò Pavesedai grappoli, oppure frutto della...
Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico…          Vendemmia e Origine        Numero d...
Capitolo 2. Indagine sull’ecologia di lieviti enologici in Franciacorta ed Oltrepò Pavese         Oltrepò Pavese          ...
Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico…42     Figura 2.10 Permanenza delle specie di...
Capitolo 2. Indagine sull’ecologia di lieviti enologici in Franciacorta ed Oltrepò Pavesecie dominante in vino base, a fin...
Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico…             Vendemmia e Origine             ...
Capitolo 2. Indagine sull’ecologia di lieviti enologici in Franciacorta ed Oltrepò PaveseFigura 2.11 Biodiversità interspe...
Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico…46     Figura 2.12 Permanenza delle specie di...
Capitolo 3. Tipizzazione molecolare dei ceppi di S. cerevisiae …Capitolo 3. Tipizzazione molecolare dei ceppidi S. cerevis...
Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico …     lizzato le loro attività sullo studio d...
Capitolo 3. Tipizzazione molecolare dei ceppi di S. cerevisiae …(parte della sequenza che codifica gli enzimi implicati ne...
Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico …     nuova coppia di primers hanno ottenuto ...
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
VALORIZZAZIONE DELLE D.O.C.G.
Upcoming SlideShare
Loading in...5
×

VALORIZZAZIONE DELLE D.O.C.G.

649

Published on

VALORIZZAZIONE DELLE D.O.C.G. FRANCIACORTA
ED OLTREPÒ PAVESE METODO CLASSICO
MEDIANTE IMPIEGO DI LIEVITI AUTOCTONI
PER IL MIGLIORAMENTO DELLE PRODUZIONI
E COME MARCATORI DI TIPICITÀ

Published in: Business
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total Views
649
On Slideshare
0
From Embeds
0
Number of Embeds
3
Actions
Shares
0
Downloads
9
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

VALORIZZAZIONE DELLE D.O.C.G.

  1. 1. Department of Food Environmental Consorzio per la tutela Consorzio Tutela Vini and Nutritional Sciences del Franciacorta Oltrepò Pavese www.regione.lombardia.it VALORIZZAZIONE DELLE D.O.C.G. FRANCIACORTA ED OLTREPÒ PAVESE METODO CLASSICO MEDIANTE IMPIEGO DI LIEVITI AUTOCTONI PER IL MIGLIORAMENTO DELLE PRODUZIONI E COME MARCATORI DI TIPICITÀ Quaderni della Ricerca n. 148 - novembre 2012
  2. 2. Sperimentazione condotta nell’ambito del progetto di ricerca n. 1315“Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico mediante impiego di lieviti autoctoni per il miglioramento delle produzioni ecome marcatori di tipicità” (d.g.r. 30/3/2009 n. VIII/9182 - Piano per la ricerca e lo sviluppo 2009). Hanno realizzato le attività sperimentali: Università degli Studi di Milano Dipartimento di Scienze per gli Alimenti, la Nutrizione e l’Ambiente via Celoria, 2 - 20133 Milano referente: prof. Roberto Foschino, roberto.foschino@unimi.it Consorzio per Tutela del Franciacorta Via Verdi, 53 - 25030 Erbusco (BS) referente: dr.ssa Monica Faccincani, ufficio.tecnico@franciacorta.net Consorzio Tutela Vini Oltrepò Pavese piazza Vittorio Veneto, 24 - 27043 Broni (PV) referente: dr.ssa Alice Colombo, ufficio.tecnico@vinoltrepo.it Per Informazioni: Regione Lombardia - Direzione Generale Agricoltura U.O. Innovazione, cooperazione e valorizzazione delle produzioni Struttura Ricerca, innovazione tecnologica e servizi alle imprese Piazza Città di Lombardia 1 - 20124 Milano tel: +39.02.6765.3790 fax: +39.02.6765.8056 e-mail: agri_ricerca@regione.lombardia.it referente: Rossana Tonesi - tel: +39.02.6765.3737 e-mail: rossana_tonesi@regione.lombardia.it © Copyright Regione Lombardia
  3. 3. Department of Food Environmental Consorzio per la tutela Consorzio Tutela Vini and Nutritional Sciences del Franciacorta Oltrepò PaveseVALORIZZAZIONE DELLE D.O.C.G. FRANCIACORTA ED OLTREPÒ PAVESE METODO CLASSICO MEDIANTE IMPIEGO DI LIEVITI AUTOCTONI PER IL MIGLIORAMENTO DELLE PRODUZIONI E COME MARCATORI DI TIPICITÀ A cura di: Roberto Foschino Ileana Vigentini Gabriella De Lorenzis Claudia Picozzi Shirley Barrera Cardenas Vincenzo Fabrizio Quaderni della Ricerca n. 148 - novembre 2012
  4. 4. IndiceIndicePresentazione 7Capitolo 1. Analisi dei fabbisogni, 5stato dell’arte e obiettivi 9Capitolo 2. Indagine sull’ecologia di lieviti enologiciin Franciacorta ed Oltrepò Pavese 17Capitolo 3. Tipizzazione molecolare dei ceppidi S. cerevisiae per il riconoscimento di ecotipi autoctoni 47Capitolo 4. Selezione dei ceppie prove di microvinificazione 64Capitolo 5. Il destino del DNA nello spumante 95Capitolo 6. Considerazioni finali 120Bibliografia 125Ringraziamenti 134
  5. 5. PresentazionePresentazione La Lombardia è regione leader nel- la produzione di vino spumante di alta qualità rappresentando oltre il 60% del prodotto nazionale realizzato con me- todo classico. Nel settore vitivinicolo le bollicine lombarde sono da anni in co- stante crescita, grazie al continuo mi- glioramento del livello qualitativo e al trainante successo imprenditoriale del 7 “modello” Franciacorta. Con il recen- te riconoscimento della Denominazio- ne d’Origine Controllata e Garantita conferito all’Oltrepò Pavese Metodo Classico la Lombardia può vantare unaproduzione di eccellenza negli spumanti D.O.C.G. con un poten-ziale di oltre 13 milioni di bottiglie. Occorre tuttavia riconoscere che il mondo dell’enologia ita-liana sta attraversando una fase di forte trasformazione e crisi,determinata un profondo cambiamento delle preferenze e del-le abitudini al consumo e accompagnata da una importanteriduzione delle disponibilità economiche del pubblico. Inoltrel’ingresso di nuovi Paesi produttori ha ulteriormente innalzato lacompetizione commerciale, soprattutto sul mercato estero. Percontro, con tendenza positiva, si va affermando tra i consumato-ri una maggior attenzione alla qualità, alla tipicità del vino e agliaspetti sensoriali ed emozionali della degustazione. È tempo dunque di riflettere, progettare e reagire per indiriz-zare le risorse, da un lato, verso il miglioramento e la differenzia-zione qualitativa, valorizzando soprattutto vini che esprimano unlegame con il territorio di appartenenza, dall’altro lato verso la
  6. 6. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… penetrazione dei nostri prodotti nei mercati emergenti incremen- tando l’attività di promozione all’estero. Su questa linea strategica si inserisce il progetto di ricerca Eno- track che, a tre anni dal suo avvio, presenta in questo volume i suoi risultati, frutto della fattiva collaborazione tra il Dipartimento di Scienze per gli Alimenti, la Nutrizione e l’Ambiente dell’Universi- tà degli Studi di Milano, il Consorzio per Tutela del Franciacorta e il Consorzio Tutela Vini Oltrepò Pavese. Per valorizzare le D.O.C.G. metodo classico della Franciacor- ta e dell’Oltrepò Pavese la ricerca ha sperimentato l’impiego di lieviti autoctoni per il miglioramento qualitativo delle produzioni e come marcatori della tipicità. Giuseppe Elias Assessore all’Agricoltura Regione Lombardia8
  7. 7. Capitolo 1. Analisi dei fabbisogni, stato dell’arte e obiettiviCapitolo 1. Analisi dei fabbisogni, stato dell’artee obiettivi All’interno della regione Lombardia, Franciacorta ed OltrepòPavese costituiscono le aree geografiche trainanti la produzionedi vino spumante realizzato con metodo classico, rappresentan-do quasi due terzi dei “bollicine” a marchio D.O.C.G. fabbricatisul territorio nazionale. Il continuo miglioramento del livello qua-litativo del prodotto lombardo e l’attenzione alla promozionedell’immagine, sapientemente considerati come obiettivi fon- 9damentali da entrambi i Consorzi e dalla maggioranza dei pro-duttori, sono comprovati dall’incremento costante delle vendite,anche in questi anni di crisi economica. La valorizzazione dei pro-dotti di origine, realizzati e percepiti come meglio legati al territo-rio, può emergere come linea strategica di successo, soprattuttoper le attività rivolte al rafforzamento della comunicazione e allapenetrazione del mercato estero, naturale destino di uno svilup-po commerciale futuro.1.1 Analisi dei fabbisogni Il Franciacorta D.O.C.G., viene preparato a partire da uveChardonnay e/o Pinot bianco e/o Pinot nero coltivate in provin-cia di Brescia su una superficie di circa 2000 ettari; 160 sono gliaderenti al Consorzio di Tutela del Franciacorta, 74 le aziende diimbottigliamento. L’ Oltrepò Pavese Metodo Classico, è prodot-to da uve Pinot Nero in purezza o in miscela con Chardonnaycoltivate in provincia di Pavia per un’estensione di circa 2000 et-tari; il Consorzio Tutela Vini Oltrepò Pavese conta 250 associati,con 1300 viticoltori conferenti, 6 le cantine sociali.
  8. 8. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… Gli areali della Franciacorta e dell’Oltrepò Pavese rappresen- tano zone di particolare interesse per l’applicazione di nuove tec- nologie nel settore viti-vinicolo come effetto della convergenza di fattori positivi e strategici per il successo delle innovazioni quali, la grande perizia tecnica ed il buon livello socio-culturale degli operatori, l’atteggiamento di apertura verso la sperimentazione senza tralasciare il valore della tradizione, l’elevata vocazionalità dei territori, l’orientamento della filiera verso produzioni vinicole di pregio. Entrambi i vini , Franciacorta D.O.C.G. e Oltrepò Pavese Me- todo Classico, si ottengono da una lavorazione che dura non meno di 2 anni dalla vendemmia, di cui almeno 15 mesi (per la denominazione Oltrepò Pavese) e 18 mesi (per la denominazio- ne Franciacorta) di lenta rifermentazione in bottiglia a contatto con cellule di lievito. L’utilizzo di preparati commerciali di lievito è una pratica ormai universalmente diffusa presso le cantine della nostra Regione10 poiché offre garanzie di una conduzione ininterrotta e completa della fermentazione e della rifermentazione. Tuttavia le colture di Saccharomyces attualmente utilizzate per le spumantizzazioni (starter) sono in numero ridotto, talvolta lo stesso ceppo assume sigle diverse perché attribuito a marchi diversi, e comunque trat- tasi di ceppi isolati e selezionati in territorio francese sulla base delle caratteristiche qualitative dello Champagne o per adat- tarsi alla produzione di una ampia gamma di preparazioni vina- rie, non tenendo conto delle specifiche proprietà sensoriali dei prodotti lombardi. La sostituzione dei ceppi starter d’oltralpe con ceppi di nuovo isolamento in territorio lombardo, appositamente selezionati per caratteri tecnologici e di qualità, può condurre alla produzione di vini con proprietà sensoriali migliorate e co- munque valorizzanti il prodotto finito, attraverso il riconoscimento di una relazione diretta con l’area geografica di produzione. Nel- lo specifico caso degli spumanti fatti secondo il metodo classico, la tecnica di rifermentazione in bottiglia comporta il vantaggio che i residui cellulari permangono nel prodotto fino al consumo. Per conseguenza il DNA di lievito, grazie alla sua natura di mole- cola informativa, può costituire un idoneo bersaglio analitico e la sua decodificazione può risultare un potente strumento per l’indi- viduazione e la certificazione dell’origine territoriale del prodotto.
  9. 9. Capitolo 1. Analisi dei fabbisogni, stato dell’arte e obiettivi Il crescente e continuato utilizzo di starter commerciali costituitida un esiguo numero di ceppi per la rifermentazione tende aduniformare le caratteristiche sensoriali dei vini omologando i pro-dotti di Franciacorta e di Oltrepò Pavese agli spumanti di altrezone produttive. Infatti, il dominio fermentativo e la dispersioneambientale delle colture starter selezionate di provenienza este-ra conducono sostanzialmente a due conseguenze:• la prima, di tipo enologico, è legata al fatto che i lieviti autoc- toni, a seguito della loro inferiore concentrazione iniziale e/o della competizione nutrizionale, non riescono ad apportare il loro contributo metabolico alla qualità del prodotto finale;• la seconda, di tipo ecologico, è che le forme indigene pos- sono scomparire dall’habitat del vigneto e della cantina, pur possedendo caratteristiche elettive in termini di apporto sen- soriale verso i prodotti. Il recupero di tali ceppi, mediante una campagna program-mata ed estesa di campionamento sui territori coinvolti, vieneproposto per salvaguardare le forme microbiche rimaste che 11possono essere impiegate nella valorizzazione e tutela dei pro-dotti attuali e che, in futuro, potrebbero venire utilizzate per nuo-ve applicazioni. Il terzo problema che l’idea progettuale si propone di affronta-re è quello di fornire un potente strumento di verifica per i sistemidi tracciabilità adottati a garanzia della qualità ed autenticitàdel prodotto lombardo. L’impegno è quello di sviluppare un pro-tocollo analitico, in tecnica qPCR basato sull’analisi del DNA e alsuo utilizzo per la tutela delle produzioni di spumante D.O.C.G..Attraverso l’analisi della sequenza nucleotidica o la determina-zione di alcuni target genici specifici, questo metodo consen-tirebbe di individuare il ceppo di lievito che è stato impiegatonella rifermentazione, rappresentando un vero e proprio “mes-saggio nella bottiglia” per la durata della vita commerciale delprodotto.1.2 Stato dell’arte Lo spumante è un vino che forma spuma all’atto della mescitain conseguenza della liberazione di anidride carbonica ottenuta
  10. 10. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… da fermentazione operata da lieviti. Da un punto di vista tec- nologico la produzione dei vini spumanti può essere suddivisa in due fasi: la formulazione del vino base, realizzata allestendo una miscela di differenti vini preparati con tecnica di vinificazione in bianco, e la spumantizzazione, ottenuta per rifermentazione di zuccheri da parte di ceppi di Saccharomyces in contenitori chiusi. Nel metodo classico (metodo champenoise) la presa di spuma avviene direttamente in bottiglia, inoculando il vino base con idoneo innesto microbico (> 106 UFC/ml) e sciroppo zucche- rino (20-24 g/L) in modo da raggiungere una sovrappressione di CO2 di 5-6 atmosfere. La maturazione del prodotto sulle fecce avviene a basse temperature (a circa 12°C-14°C) e si protrae per un tempo prolungato (≥ 15 mesi); in questo periodo avvengono trasformazioni biochimiche operate da enzimi sintetizzati dai lie- viti, fenomeni di diffusione di sostanze tra cellule e mezzo, lisi delle cellule, che permettono il conferimento delle peculiari caratteri- stiche aromatiche. Nel metodo Charmat la spumantizzazione del12 vino base, addizionato di zucchero e lieviti, avviene in autocla- vi a temperature più elevate (20-25°C) e per tempi brevi (pochi giorni) che non consentono l’ottenimento delle qualità sensoriali che si raggiungono mediante l’affinamento in bottiglia. In effetti è proprio nel metodo classico per la produzione di spumanti, più che in ogni altra tecnica enologica, che l’azione dei lieviti non si esaurisce con il compimento della sola fermenta- zione alcolica, ma si esalta con la formazione di composti secon- dari (es. alcoli superiori e loro esteri, esteri etilici di acidi grassi, po- lisaccaridi parietali), con la modifica di composti nativi dell’uva (es. acido malico, glicosidi, tioli alifatici ramificati, acidi fenolici) (Lambrechts e Pretorius, 2000) e prosegue con la cessione di so- stanze attraverso il fenomeno dell’autolisi cellulare (aminoacidi, oligopeptidi). La quantità di ciascuno di questi composti è spes- so difficilmente correlabile al gradimento finale, che è funzione della percezione complessiva che offre il vino, ed è dipendente in larga misura dal ceppo di Saccharomyces utilizzato oltre che dalle condizioni ambientali di sviluppo del lievito (Ribereau-Ga- yon, 1998). La possibilità di selezionare ceppi autoctoni con proprietà tec- nologiche utili e caratteristiche di qualità idonee al tipo di pro- dotto (potere fermentativo, purezza fermentativa, flocculenza,
  11. 11. Capitolo 1. Analisi dei fabbisogni, stato dell’arte e obiettiviprofilo aromatico) soddisfa l’obiettivo della difesa della comuni-tà microbica indigena e contemporaneamente suggella la va-lorizzazione del prodotto tipico attraverso l’evidenza del legametra territorio e prodotto finito. L’isolamento e l’identificazione dilieviti è oggi facilitata dallo disponibilità di tecniche molecola-ri sufficientemente rapide ed affidabili (Eigel e Feldmann, 1982;Querol, 1992; Granchi,1999; Mannazzu et al., 2002; Marinangeliet al. 2004a; Marinangeli et al. 2004b; Foschino e Vigentini, 2006).Saccharomyces cerevisiae è stata la prima specie eucariota il cuigenoma è stato sequenziato totalmente (Goffeau et al., 1996) etuttavia il settore enologico non ha ancora sfruttato pienamen-te questa enorme potenzialità informativa. Le moderne tecni-che di analisi genetica forniscono dunque adeguati strumentiscientifici per individuare nuovi ceppi autoctoni (Ayoub, 2006,Baleiras Couto, 1996; Egli, 1998; Pretorius, 2000; Ciani, 2004) le cuiproprietà tecnologiche e metaboliche hanno già consentito ilmiglioramento qualitativo del vino e la salvaguardia delle popo-lazioni autoctone in alcune regioni italiane, quali il Veneto (Ciani, 131997; Torriani, 1999; Zilio, 2000; Bocca, 2004; Zilio, 2004), le Marche(Guerra, 1999), la Toscana (Rosi,1998) e la Sicilia (Giudici, 1997).I parametri analitici adottati per la selezione di ceppi enologicidi lievito fra quelli di nuovo isolamento sono stati ampiamentedescritti (Giudici e Zambonelli, 1992; Steger e Lambrechts, 2000;Masneuf , 2003; Cavazza, 2006) per gli aspetti metabolici (vigorefermentativo, completezza della fermentazione degli zuccheri,resa in alcol, metabolismo dell’acido malico, formazione di com-posti secondari della fermentazione, metabolismi degli ammino-acidi, dei grassi e dei fenoli) e tecnologici generali (tolleranzaall’alcol e al biossido di zolfo, criotolleranza, produzione/sensibi-lità al “fattore killer”) o specifici per l’impiego nella spumantiz-zazione (attitudine alla flocculazione, potere schiumogeno, ca-pacità autolitica). Tuttavia, solo valutando il comportamento delceppo in vinificazione è possibile garantire che il vino possa trarregiovamento dal nuovo agente biologico fermentativo ritrovato(Rosi, 2005). Pertanto l’introduzione di una valutazione sensorialedi vinificazioni e spumantizzazioni ad-hoc rappresenta un fattoredeterminante per una conclusione positiva ed efficace in questoambito di ricerca. Allo stato delle conoscenze non sono noti studi di selezione di
  12. 12. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… Saccharomyces autoctoni per la produzione di spumante lom- bardi benché questi prodotti rappresentino in Italia una quota di mercato preponderante tra le D.O.G.C. Anche lavori sperimen- tali riguardanti la condizione e lo stato degli acidi nucleici nei vini e in generale nelle matrici enologiche (Savazzini e Martinelli, 2006; Vigentini, 2007), non sono numerosi sebbene tali molecole costituiscano un interessante componente biologica, assai utile per il riconoscimento delle specie. Il caso specifico dello spuman- te fatto con metodo classico rappresenta un ottimo modello per l’applicazione di sistemi di tracciabilità che sfruttano la presen- za ed il ruolo dei microrganismi nel processo produttivo. Infatti poiché la rifermentazione avviene in bottiglia, e cioè nell’ultimo contenitore ermetico che non subisce ulteriori trattamenti tecno- logici, è assai probabile che il DNA sia presente nelle poche cel- lule residue o sia fuoriuscito nel mezzo in seguito alla lisi cellulare, rimanendo nel prodotto finito in quantità e qualità utili per l’ese- cuzione di saggi molecolari. L’idea originale di questo program-14 ma di ricerca è quella di sfruttare questa frazione di acidi nucleici come marcatori molecolari per individuare il ceppo rifermentan- te e indirettamente “tracciare” le produzioni. Infine si ricorda come il dibattito sui lieviti autoctoni è tuttora aperto e che, in ogni caso, la messa a punto di protocolli analiti- ci per l’individuazione accurata di ceppi costituenti le comunità microbiche che intervengono nel processo fermentativo, costitu- isce il presupposto metodologico per la dimostrazione oggettiva di un eventuale legame esistente tra prodotto e territorio. 1.3 Obiettivi del progetto e risultati attesi Il progetto si è prefisso i seguenti obiettivi: • isolare, caratterizzare e conservare in maniera stabile i ceppi di Saccharomyces “ecotipi-specifici” delle zone vitivinicole della Lombardia vocate alla produzione di spumanti; • identificare, fra i ceppi riconosciuti come autoctoni sia dell’a- rea Franciacorta che dell’area Oltrepò, quelli con adeguata attitudine alla vinificazione e spumantizzazione sulla base di caratteristiche tecnologiche ed aromatiche; • formulare starter di rifermentazione con ceppi autoctoni, re-
  13. 13. Capitolo 1. Analisi dei fabbisogni, stato dell’arte e obiettivi lativi a ciascuna area di produzione, la cui idoneità sia stata validata mediante vinificazioni e spumantizzazioni secondo la prassi produttiva prevista dai rispettivi disciplinari di produzione di Franciacorta ed Oltrepò Pavese;• definire protocolli di estrazione ed amplificazione del DNA fun- gino da spumante per l’identificazione delle specie ed even- tuale riconoscimento del ceppo utilizzato in rifermentazione. I risultati attesi dall’esecuzione del progetto sono stati rispettati;in particolare sono stati ottenuti i seguenti prodotti:• Allestimento e disponibilità di una collezione di ceppi autoc- toni lombardi a vocazione enologica. Le colture sono conser- vate allo stato congelato presso il DeFENS dell’Università degli Studi di Milano.• Preparazione di starter costituiti da colture di lieviti autoctoni da impiegare per i vini spumanti. La formulazione dello starter è un punto chiave per la fase di rifermentazione in bottiglia poiché le cellule del lievito inserite nel liqueur de tirage sono gli agenti 15 biologici per l’ottenimento di profili aromatici nuovi e peculiari nonché costituiranno il materiale bersaglio per l’applicazione delle tecniche molecolari utili alla verifica della tracciabilità. Sono state preparate otto differenti colture starter, quattro per ciascuna area di produzione, Franciacorta e Oltrepò Pavese.• Produzione, affinamento e valutazione sensoriale di vino speri- mentale prodotto con spumantizzazioni in scala ridotta per la verifica della performance delle colture starter sopra citate. La produzione dello spumante è stata realizzata presso otto strutture produttive, cinque per il Consorzio per la Tutela del Franciacorta e tre per il Consorzio Tutela Vini Oltrepò Pavese. Sono state previste diverse sedute di degustazione a differenti età del prodotto in affinamento, organizzate dai Consorzi e re- alizzate da panel di assaggiatori esperti.• Protocollo sperimentale per l’estrazione ed amplificazione di DNA da vino spumante e riconoscimento della specie utilizza- ta in rifermentazione. L’idea era quella di realizzare un meto- do che potesse impiegarsi come strumento per identificare il/i ceppo/i impiegato/i in rifermentazione e dunque per verificare la presenza di un elemento oggettivo al fine di garantire il mar- chio di denominazione.
  14. 14. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… • Attività di divulgazione tecnica e scientifica attraverso pubbli- cazioni su riviste di settore a livello nazionale e internazionale, siti internet, per l’aumento delle conoscenze in enologia, ed ecologia microbica e a tutela della fruibilità universale dei risul- tati. Organizzazione di un convegno al termine della sperimen- tazione atto a divulgare i risultati del progetto presso le imprese della Regione, gli enologi, i tecnici dei servizi agricoli regionali al fine di diffondere l’innovazione introdotta. I destinatari diretti dei risultati sono gli operatori della filiera enologica in Lombardia, con particolare riguardo ai produtto- ri di D.O.C.G. Franciacorta e D.O.C.G. Oltrepò Pavese Metodo Classico, per i quali l’innovazione tecnologica adottata potreb- be comportare un vantaggio competitivo in termini di migliora- mento qualitativo e raggiungimento dell’evidenza di una relazio- ne diretta tra prodotto finito e territorio, fattori determinanti per il successo commerciale del prodotto.16 Altri destinatari potranno essere le aziende di produzione di fer- menti per l’industria enologica, anch’esse diffusamente presenti in Lombardia, qualora si assumano l’incarico di rendere dispo- nibili commercialmente le formulazioni di starter prodotte dalla ricerca, previo accordo con i partner del progetto. I destinatari indiretti sono i consumatori finali del vino e più in generale il sistema economico regionale che si avvantaggia nel fornire al mercato prodotti tipici e di qualità superiore con riper- cussioni positive anche nel comparto turistico.
  15. 15. Capitolo 2. Indagine sull’ecologia di lieviti enologici in Franciacorta ed Oltrepò PaveseCapitolo 2. Indagine sull’ecologia di lievitienologici in Franciacorta ed Oltrepò Pavese2.1 Introduzione Nel corso di una vinificazione sono molteplici i fattori che posso-no influenzare la qualità del vino; tra questi, la gestione del vigne-to, le tecniche enologiche e le specie di lievito utilizzate (Ciani,2009). In particolare, per quanto riguarda l’aspetto microbiologi-co, oggigiorno vi è un notevole interesse a migliorare la cono- 17scenza di base riguardante la biodiversità dei lieviti a vocazioneenologica che possono propagarsi durante la fermentazione al-colica (Agnolucci, 2007; Cappello, 2004; Guerra, 1999; Mercado,2007; Vilanova, 2003). I lieviti vinari vengono classificati tra gli asco-miceti (Tabella 2.1) e comprendono sia i lieviti sporigeni capaci diformare meiospore (teleomorfici) che i lieviti asporigeni (anamorfi-ci), di cui non si conosce la fase sessuata. Saccharomyces cerevi-siae, sebbene rappresenti l’attore principale della fermentazionealcolica, non è l’unica specie riscontrata in vinificazione; infattile principali forme di interesse enologico si ricordano quelle ap-partenenti ai generi: Candida (C. stellata, C. vini), Debaryomyces(D. hansenii, Candida famata), Dekkera (D. anomala, D. bruxel-lensis, B. bruxellensis), Issatchenkia (I. orientalis, I.terricola, Candidakrusei), Hanseniaspora (H. uvarum, K. apiculata), Kluyveromyces(K. lactis, K. marxianus), Metschnikowia (M. pulcherrima, Candidapulcherrima), Pichia (P. anomala, P. fermentans, Candida pelli-culosa, C. valida) Saccharomyces (S. bayanus, S. cerevisiae, S.paradoxus, S. pastorianus, Candida robusta), Saccharomycodes(S. ludwigii) Schizosaccharomyces (S. pombe), Torulaspora (T.delbrueckii, Candida colliculosa), Zygosaccharomyces (Z. bailii).Quando si parla di “biodiversità” bisogna tener presente che essa
  16. 16. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… può riguardare sia la “biodiversità interspecifica”, che comporta lo studio dell’ecologia dei microrganismi a livello di specie, che la “biodiversità intraspecifica”, dedicata al riconoscimento dei diver- si ceppi microbici appartenenti alla medesima specie. La compo- sizione della popolazione di lieviti associata ad un ambiente eno- logico può variare notevolmente a causa di diversi fattori quali, le condizioni climatiche, la varietà d’uva e la posizione geografica (Guillamon, 1996; Martinez, 2007). In particolare, la valutazione della biodiversità inter-specifica dei lieviti è rilevante per compren- dere l’evoluzione nel processo di vinificazione e di conseguenza aumentare la capacità di controllo del processo fermentativo. Divisione Ascomycota Classe: Archiascomycetes Ordine: Schizosaccharomycetales Famiglia: Schizosaccharomycetaceae Genere: Schizosaccharomyces18 Classe: Hemiascomycetes Genere: Ordine: Saccharomycetales Metschnikowia Famiglia: Metschnikowiaceae Famiglia: Saccharomycetaceae Genere: Debaryomyces Dekkera Issatchenkia Kluyveromyces Pichia Saccharomyces Torulaspora Zygosaccharomyces Famiglia: Saccharomycodaceae Genere: Hanseniaspora Saccharomycodes Famiglia: Candidaceae Genere: Brettanomyces Candida Kloeckera Tabella 2.1 I lieviti di interesse enologico (Kurtzman e Fell, 1998).
  17. 17. Capitolo 2. Indagine sull’ecologia di lieviti enologici in Franciacorta ed Oltrepò Pavese Lo sviluppo ed il miglioramento delle tecniche di biologia mo-lecolare hanno contribuito in modo significativo allo studio dellabiodiversità e delle caratteristiche genetiche dei lieviti. Attual-mente, le sequenze di DNA che vengono analizzate per l’identi-ficazione dei lieviti vinari sono sequenze geniche o intergenichesoggette a polimorfismi di lunghezza o di sequenza. Tra le tecni-che utilizzate vi sono:• Amplificazione degli spaziatori interni trascritti (Internal Transcri- bed Spacers, ITS) del DNA ribosomiale (rDNA);• Analisi RFLP (Restriction Fragment Length Polymorphism) degli ITS (PCR-RFLP);• Analisi della sequenza dei domini D1/D2 del 26S rDNA.• Il DNA ribosomiale (rDNA) rappresenta un target ideale per l’i- dentificazione molecolare di una vasta gamma di organismi; il processo evolutivo che lo caratterizza è relativamente lento e consente la presenza al suo interno sia di sequenze altamente conservate, anche in specie molto diverse, sia di sequenze va- riabili, utili per confrontare specie più strettamente correlate. In- 19 dividui della stessa specie si caratterizzano per una sostanziale identità di sequenza dell’rDNA (limitato polimorfismo intraspe- cifico) mentre individui appartenenti a specie diverse presen- tano un’identità di sequenza tanto minore quanto maggiore è la loro distanza evolutiva (elevato polimorfismo interspecifico). In S. cerevisiae, l’rDNA è localizzato sul XII° cromosoma, dove sono presenti fino a circa 120 unità ripetute ciascuna costituita da quattro differenti geni: 18S, 5,8S, 26S e 5S. Le sequenze 18S e 26S sono separate dalla sequenza 5,8S dagli spaziatori interni trascritti (Internal Transcribed Spacers, ITS) come si può osserva- re in Figura 2.1 (Vincenzini, 2005). Figura 1.8 Rappresentazione schematica di un’unità di DNA ribosomialeFigura 2.1 Rappresentazione schematica di un’unità di DNA ribosomiale di lievito (Vin-cenzini, 2005).
  18. 18. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… L’analisi PCR-RFLP degli ITS impiega dei primers disegnati sulla porzione 5’ del 18S rDNA e sulla porzione 3’ del 26S rDNA. Que- sti oligonucleotidi sono quindi disegnati su sequenze altamente conservate ed esterne alle regioni ITS variabili. Quest’ultima ca- ratteristica li rende universali, ossia consente il loro allineamento sul DNA stampo ad un numero elevato di specie. Il confronto dei prodotti di PCR, differenti tra le diverse specie per lunghezza e/o sequenza ne permette l’identificazione. Gli ampliconi possono essere lunghi da un minimo di 380 bp in Yarrowia lipolytica e Pi- chia pastoris ed un massimo di 1050 bp in Schizosaccharomyces pombe (Esteve- Zarzoso, 1999). Tuttavia, due o più specie possono essere caratterizzate da prodotti di amplificazione della medesima lunghezza ma di diversa sequenza; in questo caso il metodo prevede che gli amplificati vengano digeriti con enzimi di restrizione quali CfoI, HaeIII e HinfI che riconoscono sequen- ze specifiche sul DNA bersaglio e generano profili di restrizione caratteristici per ogni specie di lievito. Per accertare l’apparte-20 nenza ad una specie nel caso in cui la restrizione delle ITS non sia sufficiente ci si avvale del sequenziamento del dominio D1/ D2 del gene 26S rDNA. Questa sequenza, che misura circa 600 bp, viene riconosciuta come il principale bersaglio per l’identifi- cazione di quasi tutti gli ascomiceti attualmente noti (Kurtzman e Robnett, 1998). Il sequenziamento di questa regione e la compa- razione della sequenza ottenuta con quelle disponibili in banche dati (GenBank o EMBL), mediante l’impiego gratuito on-line di algoritmi specifici (Basic Local Alignment Search Tool), consento- no l’attribuzione della specie al ceppo indagato. Secondo un’o- pinione correntemente accettata, differenze in più di sei basi su 600 indicano che i lieviti confrontati non appartengono alla stes- sa specie (Vincenzini, 2005). Sebbene ad oggi la ricerca scientifica si è concentrata princi- palmente sul controllo della fermentazione alcolica, molti lavo- ri affrontano lo studio dell’ecologia di lieviti sulle uve, sul mosto e anche nell’aria della cantina. In particolare, è stato eviden- ziato che il succo d’uva appena pressato ospita un’ampia va- rietà di specie di lieviti, soprattutto del genere Hanseniaspora, Pichia, Candida, Metschnikowia e Kluyveromyces. Di tanto in tanto, specie di altri generi come Cryptococcus, Rhodotorula, Debaryomyces, Issatchenkia, Zygosaccharomyces, Saccha-
  19. 19. Capitolo 2. Indagine sull’ecologia di lieviti enologici in Franciacorta ed Oltrepò Paveseromycodes, Torulaspora, Dekkera, Schizosaccharomyces e Sac-charomyces sono stati isolati dalle uve (Jolly, 2006; Fleet, 2003,2008; Prakitchaiwattana, 2004; Ribéreau-Gayon, 2000). Una fer-mentazione spontanea si caratterizza per la crescita di differentispecie di lievito che provengono dall’uva. Infatti, analisi micro-biologiche sulla flora dei lieviti associate a fermentazioni spon-tanee hanno permesso di stabilire che nella maggior parte deicasi avviene un sequenziale uso del substrato: inizialmente i lievitipresenti in numero maggiore sono gli apiculati (Hanseniasporae Kloeckera), che, dopo tre-quattro giorni lasceranno il posto aS. cerevisiae (Martini, 1996; Pretorius, 2000). Il metabolismo di S.cerevisiae porta ad un accumulo di sostanze come etanolo, aci-di grassi a media catena e acetaldeide, che inibiscono le altrespecie (Edwards, 1990; Bisson, 1999; Ludovico, 2001; Fleet, 2003).L’utilizzo di colture starter è un fattore fondamentale per la con-duzione di una fermentazione controllata e per l’inibizione deilieviti indigeni. Tuttavia, diversi studi degli ultimi venticinque annidimostrano che la crescita di K. apiculata e C. stellata non sono 21completamente inibite nel corso di una fermentazione inoculatacon culture starter (Heard e Fleet, 1985; Martinez, 1989). Infine,Garijo et al. (2008) hanno studiato la presenza di microrganismidi interesse enologico (lieviti, batteri e muffe) e la loro evoluzio-ne in aria di una cantina. In questo studio i lieviti isolati dall’ariaappartenevano sia al genere Saccharomyces che al gruppo deinon-Saccharomyces. Il presente lavoro ha valutato la biodiversità dei lieviti coinvoltinel processo di produzione di vino spumante in Franciacorta edOltrepò Pavese durante le annate 2009, 2010 e 2011, dall’ariadel vigneto, da mosto allo sgrondo (prima dell’aggiunta di SO2)e in vino base. Le caratteristiche dei lieviti selezionati per l’otte-nimento di un vino base spumante non differiscono da quelledei lieviti utilizzati per la vinificazione di altri vini. Tuttavia, ceppiparticolari possono essere selezionati e utilizzati per esaltare ca-ratteristiche aromatiche attraverso la scelta di specifiche attivitàenzimatiche. I lieviti utilizzati per la produzione di spumanti otte-nuti secondo il Metodo Classico devono però possedere uno svi-luppo di tipo flocculante e capacità di autolisarsi. La floccula-zione è un processo di auto-aggregazione tra le cellule di lievitoche porta alla formazione di masse multicellulari (fiocchi), che
  20. 20. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… sedimentano velocemente nei mezzi liquidi in cui sono sospese o galleggiano (“flottano”), a seconda delle dimensioni e della for- ma del fiocco. Lo sviluppo in aggregati accelera la separazione spontanea delle due fasi, per questo è preferibile utilizzare lieviti flocculanti per la rifermentazione in bottiglia: in questo modo le cellule depositandosi e non disperdendosi, sono più facilmen- te eliminate durante la seconda fermentazione e nella fase di sboccatura o dégorgement. La capacità delle cellule di autoli- sare e la conseguente liberazione nel vino di mannoproteine e acidi grassi è fondamentale sia per il conferimento di specifiche peculiarità sensoriali, sia per la stabilità proteica e anche per le caratteristiche del “perlage” (Vincenzini, 2005). 2.2 Materiali e Metodi 2.2.1 Campionamento e tecniche colturali22 Lo studio è stato condotto durante le vendemmie 2009, 2010 e 2011 nei territori vitivinicoli lombardi di Franciacorta (Brescia) ed Oltrepò Pavese (Pavia). Per ogni anno, i campionamenti sono avvenuti nel mese di Luglio, Agosto ed Ottobre in corrispondenza con l’inizio della invaiatura dell’uva, il tempo della vendemmia e la produzione del vino base. Il piano di campionamento ha coin- volto: 13 vigneti e 8 cantine per la Franciacorta, e 11 vigneti e 11 cantine per l’Oltrepò Pavese. Campionamento dell’aria I campionamenti dell’aria sono stati realizzati durante il mese di Luglio e/o comunque quando il processo di invaiatura, con il quale inizia la maturazione delle bacche, era già abbastanza avanzato. Si ricordi che gli insetti sono i principali vettori di funghi. I campionamenti sono stati effettuati tramite l’utilizzo del cam- pionatore d’aria “SAS SUPER IAQ”, (Figura 2.2) con cui è possibile eseguire prove di tipo microbiologico, essendo dotato di suppor- to per piastra Petri.
  21. 21. Capitolo 2. Indagine sull’ecologia di lieviti enologici in Franciacorta ed Oltrepò PaveseFigura 2.2 Air Sampler “MAS 100 Eco” di VWR International utilizzato per il campiona-mento. La piastra viene posta nell’apposito supporto, priva di coper-chio, con il terreno colturale rivolto verso la parte forata dell’ap-parecchio. Da quest’ultima, costruita in acciaio e disinfettataprima di ciascun campionamento con alcol etilico, si effettua l’a-spirazione dell’aria che andrà ad impattare, con quanto in essaeventualmente disperso (microrganismi, spore) sul terreno nutriti- 23vo della piastra. Questo campionatore permette il prelevamen-to di precisi volumi, quindi l’ottenimento di risultati non soltantoqualitativi, ma anche quantitativi. Durante il campionamento lostrumento veniva trasportato manualmente tra i filari mantenen-dolo ad una distanza di circa 30 cm dalle piante e di 1-1,20 mdal suolo (in corrispondenza dei grappoli). Per ogni anno, gli stessivigneti (tredici in Franciacorta e undici in Oltrepò Pavese) sonostati analizzati e, in ogni vigneto, due aliquote da 100 e 500 litridi aria ciascuno, replicate per due volte sono stati raccolti per lesuccessive analisi microbiologiche. L’isolamento dei lieviti è statoeffettuato utilizzando il terreno colturale YEPD [1% (w/v) Estratto dilievito, 2% (w/v) Peptone, 2% (w/v) Glucosio] addizionato con 2%agar e modificato nelle seguenti caratteristiche: pH 3,6, 200 mg/LK2S2O5 e 100 mg/L cloramfenicolo. Le piastre, ottenute dal cam-pionamento dell’aria, sono state incubate a 25°C in condizionianaerobiche (Microbiologie Anaerocult®A; Merck, Darmstadt,Germania) per 5 giorni. Questa modifica è stata effettuata perevitare la crescita di muffe.
  22. 22. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… Campionamento del mosto Il campionamento del mosto è stato eseguito a partire da metà del mese di Agosto, ed è proseguito fino ai primi giorni del mese successivo, in funzione dei diversi tempi di raccolta. I campioni sono stati prelevati, quando possibile, direttamente dalla pressa con l’ausilio di pipette sterili, altrimenti dalle vasche di raccolta poco dopo la pressatura, in entrambi i casi sempre prima che ve- nisse effettuato qualsiasi tipo di trattamento, solfitazione in parti- colare. Le aliquote prelevate, due da 50 mL ciascuna, sono state conservate in beute sterili e mantenute a 2-4°C fino al momento dell’analisi. Queste beute erano dotate di un tappo in silicone forato per permettere l’inserimento di un puntale, sterile e dotato di filtro a porosità 0,22 μm, al fine di consentire lo scambio gasso- so (liberazione della CO2 eventualmente formatasi in caso di fer- mentazione della matrice) mantenendo le condizioni di sterilità, quindi impedendo la contaminazione da parte di microrganismi esterni. I campioni di mosto sono quindi stati opportunamente24 diluiti e piastrati su una piastra precedentemente preparata con terreno Wallerstein Laboratory Nutrient Agar (WL) (Merck, Ger- mania). Le analisi sono state eseguite in doppio. Successivamen- te un’aliquota di mosto (5 mL) è stata prelevata e trasferita in una beuta contenente 45 mL di brodo “YEPD selettivo” e l’insieme è stato messo ad incubare ad una temperatura di 25°C per 72-96 h in aerobiosi. Campionamento del vino base Il campionamento del vino base è stato eseguito approssimati- vamente verso la seconda metà del mese di Ottobre; il prodotto è stato prelevato (per ciascun campione sono state acquisite due aliquote da 10 mL ognuna) dalle vasche nelle quali ha fermenta- to ed è stato trasferito in provette sterili con tappo a vite per poter essere trasportato, previa refrigerazione e mantenimento a 2-4°C. Da ogni campione è stata allestita una serie di opportune dilui- zioni decimali in acqua peptonata che sono poi state piastrate su agar WL e messe ad incubare a 25°C per 72-96 h in aerobiosi. Conta in piastra I campioni di mosto e vino base sono stati opportunamente diluiti con acqua peptonata e 0,1 mL delle diluizioni sono stati se-
  23. 23. Capitolo 2. Indagine sull’ecologia di lieviti enologici in Franciacorta ed Oltrepò Paveseminati, per spatolamento, in piastre contenenti terreno agar WL.Le piastre sono state poi messe ad incubare a 25° C per 72-96 hper permettere il completo sviluppo delle colonie. Il numero del-le unità formanti colonia (UFC) si ottiene applicando la formuladella media ponderale: ∑c UFC/mL = ( 1 x n1 + 0.1 x n2) x d1 dove: c: numero di colonie delle piastre contabili; n1: numero di piastre della prima diluizione considerata contabile; n2: numero di piastre della seconda diluizione considerata con-tabile; d1: fattore di diluizione relativo alla prima diluizione considerata 25contabile; Si considerano contabili le piastre che presentano tra 10 e 300UFC.Allestimento della collezione di lievito Dopo un un primo striscio della colonia interessata e succes-siva incubazione a 25°C per 3 giorni, si è effettuato un secon-do striscio per assicurarsi della purezza della coltura e succes-siva incubazione a 25°C per 3 giorni. Tutti gli isolati così ottenutisono allora stati preparati per la conservazione in modo stabi-le a -80°C inoculando una colonia isolata dal secondo striscioin brodo YEPD a 25°C per 48-72 h. Verificata l’uniformità dellecolonie e l’assenza di contaminazione al microscopio, e quindil’effettiva purezza della coltura, si è centrifugato a 3500 g per 15minuti (Hettich Zentrifugen, rotina 380r), eliminato il surnatante,risospeso con brodo YEPD addizionato con 20% (v/v) di glice-rolo. Si è quindi in ultimo distribuito in provette e conservate a-80°C.
  24. 24. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… 2.2.2 Tecniche molecolari Estrazione del DNA genomico Il protocollo per l’estrazione degli acidi nucleici da lievito utiliz- zato in questo lavoro è stato quello proposto da Querol (1992). In breve, le cellule sono state coltivate overnight in YEPD aggiunto di 0,1 g/Ll di cloramfenicolo. La coltura è stata centrifugata a 3500 rpm (Zentrifugen Hettich, Rotina 380r, Germania) per 15 min. Il pellet è stato sospeso in 500 μL di una soluzione contenente 0,9 M sorbitolo-EDTA 0,1 M, pH 7,5 a cui sono stati aggiunti 500 mg/ mL di zymolyase 100T (USBiological, USA) e 14mM ß-mercapto- etanolo. Le provette sono state incubate a 37°C per 60 min per lisare la parete cellulare. Gli sferoplasti così ottenuti sono stati centrifugati a 3500 g (Hettich Zentrifugen, Mikro 200, Germania) per 15 min e il pellet è stato sospeso in 0,5 mL di Tris-HCl 0,05 M, 0,02M EDTA pH 7,5. Dopo risospensione, 0,05 mL di sodio dodecil solfato (SDS) al 10% stato aggiunto e la miscela è stata incubata26 a 65°C per 30 min. Subito dopo, 0,2 mL di acetato di potassio 5 M è stato aggiunto e le provette sono state poste in ghiaccio per 30 min. Il lisato è stato quindi centrifugato a 14000 g in una per 5 min. I surnatanti sono stati trasferiti in provette nuove ed il DNA è stato precipitato mediante aggiunta di 1 volume di iso- propanolo. Le provette sono state nuovamente centrifugate a 14000 g per 10 min. Il DNA è stato lavato con etanolo al 70%, e poi centrifugato a 14000 g per 5 min. Il pellet è stato essiccato a 50°C per 15 min, dissolto in 50 μL di TE (10 mM Tris-HCl, 1 mM EDTA, pH 7,5) e mantenuto a 4°C per 12 h. L’estratto è stato trattato con 0,5 mg/mL RNasi (Fermentas, Lituania) a 37°C per 30 min. Infine, il DNA è stato conservato a -20°C. La concentrazione e la purezza di DNA è stata determinata misurando l’A260nm e l’A280nm. Amplificazione delle regione ribosomiale ITS1-5.8S-ITS2 L’amplificazione degli spaziatori interni (Internal Transcribed Spacer) compresi tra i geni 18S e 26S rDNA (ITS1-5.8S-ITS2) è stata eseguita in una miscela di 25 μL di reazione contenente: 1X di tampone (5 Prime, Amburgo), 2,5 mM di MgCl2 (5 Prime, Ambur- go), 200 mM di dNTPs (Fermentas, Lituania), 0,5 μM dei primers ITSL1 (5’GTTTCCGTAGGTGAACCTGC3’) e ITSL2 (5’ ATATGCTTA-
  25. 25. Capitolo 2. Indagine sull’ecologia di lieviti enologici in Franciacorta ed Oltrepò PaveseAGTTCAGCGG-GT 3’) (Montrocher, 1998), 2 U di Taq DNA poli-merasi (5 Prime, Amburgo) e 80 ng di DNA. Dopo una fase inizialedi denaturazione del DNA a 95°C per 5 min, sul termociclatore(Eppendorf,) è stato impostato il seguente ciclo termico cheveniva ripetuto per 35 cicli: denaturazione del DNA a 95°C per5 min, appaiamento a 50°C per 1 min, estensione della doppiaelica di DNA a 72°C per 1 min. Al termine dell’amplificazione èstata effettuata una fase di estensione finale a 72°C per 5 minal fine di permettere alla polimerasi di terminare le reazioni. Gliamplificati sono quindi stati controllati in elettroforesi su gel diagarosio 1% (w/v) in tampone TAE 1X (40 mM Tris-acetato, pH8,2, 1 mM EDTA), 0,4 μg/mL di bromuro di etidio. Le immaginisono state acquisite con un transilluminatore UV GelDoc (Bio-Rad, Hercules, CA, USA).Analisi di restrizione delle ITS (ITS-RFLP) Successivamente, i prodotti di PCR sono stati sottoposti adanalisi di restrizione al fine di valutare i possibili polimorfismi ge- 27netici (ITS-RFLP). Il protocollo utilizzato è stato quello descritto daEsteve-Zarzoso (1999) dove l’enzima CfoI è stato sostituito dall’i-soenzima di restrizione Hin6I (Fermentas, Lituania). I profili di re-strizione sono stati separati e visualizzati su gel di agarosio 1,5%(w/v) in tampone TAE 1X, 0,4 μg/mL di bromuro di etidio. Gli isolatiche mostravano lo stesso profilo genetico sono stati raggruppatie circa il 10% di isolati di ogni cluster è stato sottoposto ad ampli-ficazione e parziale sequenziamento del dominio D1/D2 del 26SrDNA.Analisi di sequenza del dominio D1/D2 del 26S rDNA Le reazioni di amplificazione sono state effettuate in una mi-scela di 25 μL contenente 1X tampone (5 Prime, Amburgo), 2,5mM di MgCl2 (5 Prime, Amburgo), 200 mM di dNTPs (Fermentas,Lituania), 0,1μM dei primers NL1 (5’GCATATCAATAAG-CGGAG-GAAAAG3’) e NL4 (5’GGTCCGTGTTTCAAGACGG3’) (Kurtzman,1998), 2 U di Taq DNA polimerasi (5 Prime, Amburgo) e 80 ng diDNA. Dopo la fase di denaturazione iniziale a 94°C per 5 min, ilprofilo di temperatura è stato ripetuto per 35 cicli: denaturazio-ne a 94°C per 1 min, appaiamento a 52°C per 1 min, ed esten-sione a 72°C per 2 min. Al termine dell’amplificazione è stata ef-
  26. 26. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… fettuata una fase di estensione finale a 72°C per 5 min. I prodotti di amplificazione sono stati controllati tramite elettroforesi in gel di agarosio 1.0% (w/v), in tampone di TAE 1X, 0,4 μg/mL di bro- muro di etidio e visualizzati con un transilluminatore UV GelDoc (Bio-Rad, Hercules, CA, USA). I prodotti di PCR sono quindi stati sottoposti a sequenziamento (Primm srl Milano, Italia) e le strin- ghe nucleotidiche sono state confrontate mediante algoritmo BLAST con le sequenze parziali del 26 rDNA delle specie depo- sitate nei databases dell’NCBI (http://blast.ncbi.nlm.nih.gov/). L’attribuzione di un microrganismo ad una specie tiene in consi- derazione due percentuali risultanti dal confronto: la copertura e l’identità. Quando questi parametri sono pari o superiori al 97% può avvenire il riconoscimento a livello di specie. Discriminazione tra le specie S. cerevisiae, S. bayanus e S. pasto- rianus Un’ulteriore analisi è stata condotta su tutti gli isolati di lievito28 identificati come appartenenti alla specie S. cerevisiae tramite l’impego delle tecniche ITS-RFLP e l’analisi della sequenza del gene 26S rDNA. Questa attività si è resa necessaria in quanto queste tecniche potrebbero erroneamente classificare come S. cerevisiae alcuni isolati invece appartenenti alla specie S. ba- yanus o S. pastorianus. Infatti, essendo queste specie filogene- ticamente molto vicine a S. cerevisiae e comprese nel gruppo dei S. cerevisiae sensu stricto, esse mostrano caratteristiche me- taboliche tali da permettere loro la crescita e sopravvivenza in vino. Per l’amplificazione sono stati utilizzati i primers costruiti sul gene HO e descritti da De Melo Pereira (2010). La singola colo- nia è stata dissolta direttamente nella miscela di reazione ed è stato effettuato un trattamento di rottura cellulare a 95°C per 30 min. La reazione di PCR per la discriminazione di S. cerevi- siae da S. pastorianus è stata condotta in una miscela di 25 μL contenente 1X tampone (5 Prime, Amburgo), 2,5 mM di MgCl2 (5 Prime, Amburgo), 200 μM di dNTPs (Fermentas, Lituania), 0,5 μM dei primers ScHO-F (5’GTTAGATCCCAGGCGTAGAACAG3’) e ScHO-R (5’GCGAGTACTGGACCAAATCTTATG3’), 1 U di Taq- DNA polimerasi (5 Prime, Amburgo). Dopo una denaturazione iniziale del DNA a 94°C per 5 min, il ciclo termico è stato ripe- tuto per 35 cicli e prevedeva: 94°C per 30 sec, 61°C per 30 (S.
  27. 27. Capitolo 2. Indagine sull’ecologia di lieviti enologici in Franciacorta ed Oltrepò Pavesecerevisiae)/55°C (S. pastorianus) sec e 72°C per 2 min. Un’ul-teriore step di estensione finale a 72°C per 7 min è stata effet-tuata. La reazione di PCR per l’identificazione di S. bayanus èstata condotta nelle medesime condizioni sopra descritte maimpiegando i primers LgHO-F (5’TGGAAAGTCTACGAGAACA-AGCC3’) e LgHO-R (5’CCTCTATGTGAAGTCCGTATACTG3’) contemperatura di appaiamento a 55°C. L’elettroforesi è stata ese-guita in 0,8% (p/v) su gel di agarosio in TAE 1X tampone trattatacon 0,4 ug/mL di bromuro di etidio. I prodotti di PCR sono statifotografati sotto transilluminatore UV GelDoc (Bio-Rad, Hercules,CA, USA).2.3 Risultati e Discussione2.3.1 Collezione di ceppi di lievito Nel corso di questo studio è stato possibile creare una col-lezione di colture di lievito composta da 493 isolati riscontrati 29e coinvolti nel processo di vinificazione nei territori lombardi diFranciacorta (Brescia) ed Oltrepò Pavese (Pavia) nelle anna-te 2009, 2010, 2011 e provenienti da aria, mosto e vino base(Tabella 2.2). Attualmente, questi lieviti sono conservati a -80°Cpresso i laboratori del Dipartimento di Scienze per gli Alimenti,la Nutrizione e l’Ambiente (DeFENS) dell’Università degli Studi diMilano. I risultati riguardanti il campionamento dell’aria del vignetohanno mostrato che, sebbene il prelievo sia stato effettuato du-rante la maturazione dell’uva quando la circolazione degli inset-ti in vigneto era presente e assai favorita dalle condizioni clima-tiche, le percentuali di isolamento raggiungevano valori moltobassi e compresi tra 0-2% per entrambi i territori analizzati. Il cam-pionamento dell’aria presso i vigneti non trova molti precedentiin bibliografia: un recente lavoro svolto nella regione spagnoladella Rioja nel 2006 ha previsto, tra gli altri, il campionamento diaria per verificare la presenza di lieviti batteri e muffe, ma all’in-terno della cantina. Nel lavoro citato è stata rilevata la presenzadi molte muffe mentre lieviti e batteri in minore quantità e nonprima dell’inizio della prima fermentazione alcolica e malolatti-ca, rispettivamente (Garijo, 2008).
  28. 28. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… Vendemmia e Origine Numero di isolati Percentuale di isola- mento 2009 178 36% Franciacorta 95 19% ARIA 8 2% MOSTO 39 8% VINO BASE 48 10% Oltrepò Pavese 83 17% ARIA 9 2% MOSTO 22 4% VINO BASE 52 11% 2010 186 38% Franciacorta 112 23% MOSTO 91 18% VINO BASE 21 4% Oltrepò Pavese 74 15% ARIA 3 1%30 MOSTO 56 11% VINO BASE 15 3% 2011 129 26% Franciacorta 58 12% MOSTO 35 7% VINO BASE 23 5% Oltrepò Pavese 71 14% ARIA 6 1% MOSTO 42 9% VINO BASE 23 4% Totale 493 100% Tabella 2.2 Lieviti isolati nel corso di 3 annate in Franciacorta (FCR) ed Oltrepò Pavese (OLT). I campioni di mosto sono stati raccolti allo sgrondo e prima dell’aggiunta di solforosa. Questi criteri sono stati adottati al fine di valutare la biodiversità interspecifica dei lieviti presenti sui due territori. Perché l’isolamento fosse rappresentativo del microbiota presente sull’uva, le colonie di lievito crescite dopo l’incubazione sono state isolate previa osservazione microscopica cellulare e macroscopica della forma e colore delle colonie. Quest’ultima
  29. 29. Capitolo 2. Indagine sull’ecologia di lieviti enologici in Franciacorta ed Oltrepò Paveseoperazione era facilitata dall’uso del terreno colturale WL (Wal-lerstein Laboratory Nutrient Agar) (Green e Grey, 1950) che, sep-pur non selettivo, consente di ottenere informazioni utili attraversole variazioni di colore assunte dalle colonie. Infatti, esso contieneverde di bromocresolo, un indicatore di pH in grado di mettere inevidenza la capacità di acidificazione, e quindi le caratteristichedei prodotti finali del metabolismo primario, in relazione alle diver-se specie di lievito (Figura 2.3). 31Figura 2.3 Tipica morfologia e colorazione delle colonie di S. cerevisiae in crescita suterreno WL Agar. Le maggiori percentuali di isolamento da campioni di mostoderivano dalla vendemmia 2010 dove è stato raggiunto un va-lore del 18% per la Franciacorta e del 11% per l’Oltrepò Pavese.E’ stato invece il 2009 l’anno in cui sono stati raccolti più isolatida vino base (10% in Franciacorta e 11% in Oltrepò Pavese). Lecolonie riscontrate durante l’isolamento presentavano morfolo-gie differenti: la forma è risultata generalmente tondeggiante ela colorazione, per gran parte delle colonie, variava dal bianco,al bianco a punta verde, al verde chiaro fino al verde scuro. Nelmaggior numero degli isolati l’aspetto era liscio, seppur in qual-che situazione siano state osservate colonie dall’apparenza rugo-sa. Alcuni isolati presentavano una consistenza farinosa, mentrela maggior parte figuravano cremosi. Le colonie di colorazionerosa-lucide hanno consentito un’identificazione diretta dell’isola-to come appartenente al genere Rhodotorula. I dati riguardantila carica microbica riscontrata dalle piastre di mosto tal qualeindicano una concentrazione che si aggirava mediamente at-torno alle 105-106 UFC/mL. Il campionamento e l’isolamento di mi-
  30. 30. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… crorganismi dal vino base è stato eseguito nel mese di Ottobre. Per alcune cantine la percentuale di isolamento è risultata molto bassa e la concentrazione cellulare risultava < 103 UFC/mL con campioni talvolta intorno a10 UFC/mL. Questo risultato era dovu- to al fatto che il prelievo, per ragioni tecniche, veniva realizzato dall’alto delle vasche senza agitazione e a fine fermentazione alcolica la massa cellulare risultava ormai decantata sul fondo. In generale, per quanto riguarda il numero totale di lieviti otte- nuti da aria, mosto e vino base, è stata osservata una differenza sia temporale (2009, 2010, 2011) che geografica (Franciacorta ed Oltrepò Pavese). L’annata 2011 è risultata quella durante la quale è stato isolato il minor numero di lieviti (26%), infatti per entrambi i territori si è registrata una diminuzione del numero di isolati del 10% rispetto al 2009 e del 12% nel 2010. L’area francia- cortina ha maggiormente contribuito a questo decremento; in particolare, la maggiore diminuzione nel numero di isolamenti è stato ottenuta dal campionamento del mosto. La scarsa quan-32 tità e diversità di isolati di lievito raccolti potrebbe essere stata causata dalle negative condizioni meteorologiche che hanno caratterizzato il periodo precedente il campionamento. Di seguito è riportata la distribuzione degli isolati prelevati nei mosti e nei vini base per tutte le cantine e suddivisi per territorio (Figura 2.4) Figura 2.4 Numero di lieviti isolati (n) collezionati durante le annate 2009-2010-2011 a) nella zona di Franciacorta; b) nella zona dell’Oltrepò Pavese.
  31. 31. Capitolo 2. Indagine sull’ecologia di lieviti enologici in Franciacorta ed Oltrepò Pavese2.3.2 Biodiversità interspecifica L’identificazione di tutti e 493 isolati di lievito è stata ottenutaeffettuando in sequenza:1. Amplificazione delle regioni ITS1-5.8S-ITS2 (Internal Transcribed Spacers) (Figura 2.5);2. Digestione degli amplificati con enzima Hin6I (Figura 2.5);3. Costituzione di cluster in base ai profili di restrizione ottenuti;4. Conferma dei cluster attraverso una seconda digestione con enzima HaeIII di circa il 25% degli isolati di ciascun gruppo;5. Sequenziamento del gene 26S rDNA di circa il 10% degli isolati di ciascun cluster. 33Figura 2.5 Esempio di corsa elettroforetica in gel di agarosio: a) dei prodotti di amplifi-cazione delle regioni ITS1-5.8S-ITS2 di alcuni isolati da mosto (sopra). M: Marker 100 bp(5 Prime, Amburgo); 1: Metschnikowia pulcherrima - Controllo positivo; 2: Hanseniaspo-ra spp. - Controllo positivo; 3: Schizosaccharomyces pombe - Controllo positivo; 4: Rho-dotorula spp. - Controllo positivo; 5: Zygosaccharomyces bailii - Controllo positivo; 6:Saccharomyces cerevisiae - Controllo positivo; 7: Issatchenkia spp. - Controllo positivo;8: Saccharomyces bayanus – Controllo positivo; 9: Dekkera spp. - Controllo positivo;10: Controllo negativo; 11-22: campioni da mosto. b) dei prodotti di digestione conenzimi di restrizione specifici (RFLP, enzima Hin6I) degli ampliconi ITS1-5.8S-ITS2 (sotto). M:Marker 100 bp (5 Prime, Amburgo); 1: Metschnikowia pulcherrima - Controllo positivo;2: Hanseniaspora spp. - Controllo positivo; 3: Schizosaccharomyces pombe - Controllopositivo; 4: Rhodotorula spp. - Controllo positivo; 5: Zygosaccharomyces bailii - Con-trollo positivo; 6: Saccharomyces cerevisiae - Controllo positivo; 7: Issatchenkia spp.- Controllo positivo; 8: Saccharomyces bayanus – Controllo positivo; 9: Dekkera spp.- Controllo positivo; 10: pozzetto vuoto; 11-22: campioni da mosto; 23: pozzetto vuoto.
  32. 32. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… L’attribuzione della specie per il gruppo S. cerevisiae sensu stricto si è conclusa con la verifica di una specifica tecnica PCR proposto da De Melo Pereira et al. (2010). Il protocollo è rapido e semplice ed è in grado di discriminare S. cerevisiae da S. ba- yanus e S. pastorianus. Tutti gli isolati di lievito che venivano clas- sificati come S. cerevisiae tramite ITS-RFLP e analisi del 26S rDNA dunque sono stati anche sottoposti ad identificazione attraverso l’amplificazione del gene HO. La Figura 2.6 mostra un esempio del prodotto di PCR per al- cuni isolati; l’amplicone caratteristico per S. cerevisiae ha una lunghezza di 400 bp.34 Figura 2.6 Gel di agarosio 0,8% del amplificazione usando i primers specifici del gene HO di S. cerevisiae ScHO-F/ScHO-R. M: peso molecolare del DNA (GeneRuler 100 bp DNA Ladder, Fermentas, Italia); 1: S. cerevisiae (Institut Œnologique de Champagne; Collection de Levures d’intérêt Biotechnologique IOC 18-2007); 2-18: isolati di S. cere- visiae. Per quanto riguarda il campionamento dell’aria è stato possi- bile collezionare 26 isolati in tutto suddivisi in 6 differenti specie di lievito (Tabella 2.3). La più alta percentuale di isolati da aria, du- rante l’intero progetto triennale, è stata ottenuta dal prelievo del 2009 (65%). In Figura 2.7 e Figura 2.8 sono mostrate le percentuali di isolamento delle diverse specie di lievito e la loro distribuzione nelle tre annate. Il dato più interessante del campionamento ri- guarda il ritrovamento di S. cerevisiae (35% del totale degli isolati raccolti) nei campioni d’aria analizzati per le tre annate conse- cutive dallo stesso territorio. Inoltre, altre specie ambientali come Aureobasidium pullulans, Cryptococcus laurentii. Issatchenkia
  33. 33. Capitolo 2. Indagine sull’ecologia di lieviti enologici in Franciacorta ed Oltrepò Paveseterricola e Rhodotorula glutinis vengono isolate con percentua-li tra il 19-8%. Pichia fermentans e Rhodotorula nothofagy sonostate singolarmente isolate da campioni d’aria del 2010 e 2011.In particolare, nella zona di Franciacorta l’isolamento di lieviti èstato possibile solo nel corso del 2009. Vendemmia e Origine Numero di lieviti (n) Percentuale (%) 2009 17 65 Franciacorta 8 31 A. pullulans 4 15 C. laurentii 4 15 Oltrepò Pavese 9 35 S. cerevisiae 7 27 A. pullulans 1 4 I. terricola 1 4 2010 3 12 35 Oltrepò Pavese 3 12 S. cerevisiae 1 4 I. terricola 1 4 P. fermentans 1 4 2011 6 23 Oltrepò Pavese 6 23 S. cerevisiae 1 4 R. glutinis 4 15 R. nothofagi 1 4 Totale 26 100%Tabella 2.3 Identificazione degli isolati di lievito ottenuti dal campionamento dell’aria inFranciacorta (FCR) e Oltrepò Pavese (OLT), nel corso di tre annate.
  34. 34. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico…36 Figura 2.7 Biodiversità osservata nei campioni di aria in Franciacorta e Oltrepò Pavese nel corso di tre annate. Figura 2.8 Distribuzione di isolamento e permanenza delle diverse specie di lievito isola- te da aria in Franciacorta ed Oltrepò Pavese nel corso di tre annate.
  35. 35. Capitolo 2. Indagine sull’ecologia di lieviti enologici in Franciacorta ed Oltrepò Pavese Il campionamento del mosto ha portato all’isolamento di sva-riate specie di lievito. In totale, sono stati collezionati 285 isola-ti suddivisi in 25 differenti specie (Figura 2.9). I dati riguardantila loro identificazione genetica sono presentati in Tabella 2.4.L’annata 2010 è stata quella durante la quale è stato raccoltoil maggior numero di isolati da mosto con un totale di 147 lieviti,pari al 52% del totale, raccolti durante le tre annate su entrambii territori analizzati. E’ stato proprio durante questo campiona-mento, inoltre, che si è potuta osservare la più alta biodiversitàin termini di specie di lievito collezionate; 19 diverse specie sonostate isolate, tra cui S. cerevisiae corrispondeva alla più alta per-centuale (44 isolati, circa 40% del totale dei S. cerevisiae isoal-ti da mosto nel triennio). Metschnikowia fructicola e Candidarailenensis, con il 10% ed il 9% rispettivamente, raggiungevanola seconda e la terza maggiore incidenza percentuale. In par-ticolare, S. cerevisiae, Torulaspora delbrueckii ed Issatchenkiaterricola erano specie presenti su entrambe le aree, mentreMetschnikowia fructicola, Hanseniaspora uvarum, Issatchenkia 37occidentalis, Pichia anomala, Rhodotorula spp, Pichia ku-driavzevii, Pichia kluyveri, Zygoascus spp, Candida zemplinina,Candida parapsilosis, Cryptococcus flavescens e Pichia guillier-mondii erano specie presenti solo nella zona della Franciacorta.Invece, Candida railenensis, Pichia fermentans, Hanseniasporauvarum, Issatchenkia terricola, Metschnikowia pulcherrima e Pi-chia membranifaciens erano ritrovate solo in Oltrepò Pavese.Infine, delle 19 specie identificate nel 2010, 8 specie venivanoisolate solamente durante questa annata (Candida parapsi-losis, Candida railenensis, Cryptococcus flavescens, Pichia fer-mentans, Pichia guilliermondii, Pichia kudriavzevii, Rhodotorulaspp, Zygoascus spp). Altre specie di lieviti, diversi rispetto a quelli già noti, sono sta-ti isolati nel corso della vendemmia 2009: Zygosaccharomycesbailii, comunemente presente in entrambe le aree e Candidadiversa isolata solo in Oltrepò Pavese. Inoltre, entrambe questespecie si ritrovavano solamente nei mosti del 2009. Per quanto ri-guarda gli isolati del 2011, Kluyveromyces thermotolerans è statoper la prima volta isolato da entrambi i territori con una percen-tuale del 1,5%, Hanseniaspora vineae (1,8%) e Candida oleophi-la (0,4%) rappresentavano anch’esse nuovi isolamenti della sola
  36. 36. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… Franciacorta, mentre Pichia fluxum (0,6%) è stato un nuovo isola- mento per l’Oltrepò Pavese. Per quanto riguarda la permanenza di specie di lievito in cam- pioni di mosto nel corso dei tre anni sui due territori, solo poche specie sono state riscontrate in annate successive. In particolare, il solo S. cerevisiae in Franciacorta e S. cerevisiae e H. uvarum in Oltrepò Pavese, si sono dimostrate specie stabilmente presenti sulle aree (Figura 2.10). Come riportato da Jolly (2003) i lieviti presenti nel mosto pos- sono essere suddivisi in due gruppi: uno rappresentato dai “lie- viti vinari” del genere Saccharomyces, l’altro comprendente i non-Saccharomyces. I lieviti Saccharomyces sono presenti, seb- bene in basso numero, anche sui grappoli, ma derivano prin- cipalmente dalle attrezzature di cantina (Vaughan-Martini & Martini, 1995; Boulton, 1996; Martini, 1996), e vengono trasferi- ti al mosto durante la pressatura (Peynaud e Domercq, 1959;38 Lonvaud-Funel, 1996; Török, 1996; Mortimer e Polsinelli, 1999). Un’ ulteriore fonte di Saccharomyces, può essere data dalle colture starter addizionate dall’enologo. I lieviti non-Saccharomyces, si ritrovano abbondantemente sui grappoli (Martini, 1996) e pri- ma dell’inoculo con uno starter: sono i lieviti presenti in mag- gior misura nel mosto. La popolazione di non-Saccharomyces presente sui grappoli risulta molto variabile: sono stati ritrovati isolati appartenenti ai generi Brettanomyces, Candida, Cryp- tococcus, Hanseniaspora, Kloeckera, Kluyveromyces, Pichia, Rhodotorula, Torulaspora (Ribéreau-Gayon, 1985; Fleet e Heard, 1993; Pretorius, 1999; Pramateftaki, 2000; Clemente-Jiménez, 2004; Chavan, 2009). I risultati ottenuti sono in disaccordo con quanto ritrovato da Ocón (2010) indagando la presenza di lieviti non-Saccharomyces sulle superfici e sulle strumentazioni della cantina e nel mosto. L’elevata variabilità di specie ascrivibili ai generi Candida, Cryptococcus, Pichia, Zygosaccharomyces, Torulaspora e Rhodotorula da loro rilevata su superfici e attrez- zature è stata qui invece osservata nel mosto. Non essendo stati effettuati campionamenti per indagare eventuale microflora presente sulle superfici delle strutture e delle attrezzature, non si può essere certi della reale provenienza degli isolati ricono- sciuti: essi potrebbero essere indigeni del mosto, quindi derivare
  37. 37. Capitolo 2. Indagine sull’ecologia di lieviti enologici in Franciacorta ed Oltrepò Pavesedai grappoli, oppure frutto della contaminazione di quest’ulti-mo con la microflora presente in cantina, per fermentazioni giàavviate, o perché comunque presenti sulle attrezzature (pressee pompe in particolare) (Phaff e Knapp, 1956; Lachance, 1994;Mortimer e Polsinelli, 1999). Complessivamente l’analisi del mo-sto ha portato all’isolamento di 285 colonie di lievito, di cui soloil 32% risultate appartenenti alla specie S. cerevisiae. In accordocon quanto riportato in bibliografia, la maggior parte della po-polazione micetica rilevata nel mosto, apparteneva al grupponon-Saccharomyces (68%). Di particolare interesse risulta l’isola-mento della specie I. terricola che raramente è stata isolata damosto o vino in fermentazione (Sabate, 2002; Di Maro, 2007) edè stata associata ad una bassa capacità fermentativa ed ele-vata produzione di acetato d’etile, determinando la formazio-ne di off-flavours (Clemente-Jimenez, 2004). Le minori citazioni inbibliografia riguardo la specie C. zemplinina sono da attribuirealla sua recente descrizione (Sipiczki, 2003) e distinzione da C.stellata. Entrambi sono lieviti “fruttosofili”, ma la maggior espres- 39sione di tale caratteristica in C. zemplinina ha indotto un piùapprofondito studio riguardo al suo sviluppo per una potenzialericonsiderazione della specie per il controllo delle fermentazioni.Ciò sarebbe particolarmente interessante per la produzione divini ottenuti da uve botritizzate, sulle quali queste specie sonospesso ritrovate (Magyar e Tóth, 2011). Alcuni autori (Csoma eSipiczki, 2008) ritengono che sia Candida zemplinina invece diCandida stellata a trovarsi sui grappoli e nelle fermentazioni deimosti, e suggeriscono che le due specie potrebbero essere statespesso confuse nelle prime pubblicazioni; in effetti, le pubblica-zioni più recenti sulla microflora vinaria, e come anche risultatoin questo studio, riportano soltanto la presenza di C. zemplinina,senza rilevare popolazioni di C. stellata (Nisiotou, 2007; Lopan-dic, 2008; Tofalo, 2009).
  38. 38. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… Vendemmia e Origine Numero di isolati (n) Percentuale (%) 2009 61 21,4 Franciacorta 39 13,7 S. cerevisiae 22 7,7 Zygosaccharomyces bailii 11 3,9 Issatchenkia occidentalis 6 2,1 Oltrepò Pavese 22 7,7 S. cerevisiae 14 4,9 Zygosaccharomyces bailii 4 1,4 Issatchenkia terricola 1 0,4 Candida zemplinina 1 0,4 Candida diversa 1 0,4 Hanseniaspora uvarum 1 0,4 2010 147 51,6 Franciacorta 91 31,9 S. cerevisiae 27 9,5 Metschnikowia fructicola 15 5,3 Hanseniaspora uvarum 13 4,6 Pichia kluyveri 10 3,5 Issatchenkia occidentalis 5 1,8 Issatchenkia terricola 5 1,8 Torulaspora delbrueckii 4 1,440 Pichia anomala 3 1,1 Pichia kudriavzevii 2 0,7 Rhodotorula spp 2 0,7 Candida parapsilosis 1 0,4 Candida zemplinina 1 0,4 Zygoascus spp 1 0,4 Pichia guilliermondii 1 0,4 Cryptococcus flavescens 1 0,4 Oltrepò Pavese 56 19,6 S. cerevisiae 17 6,0 Candida railenensis 14 4,9 Torulaspora delbrueckii 6 2,1 Pichia fermentans 5 1,8 Hanseniaspora uvarum 4 1,4 Issatchenkia terricola 4 1,4 Metschnikowia pulcherrima 3 1,1 Issatchenkia occidentalis 2 0,7 Pichia membranifaciens 1 0,4 2011 77 27,0 Franciacorta 35 12,3 S. cerevisiae 16 5,6 Torulaspora delbrueckii 6 2,1 Hanseniaspora vineae 5 1,8 Kluyveromyces thermotolerans 3 1,1 Metschnikowia pulcherrima 2 0,7 Candida oleophila 1 0,4 Hanseniaspora uvarum 1 0,4 Candida zemplinina 1 0,4
  39. 39. Capitolo 2. Indagine sull’ecologia di lieviti enologici in Franciacorta ed Oltrepò Pavese Oltrepò Pavese 42 14,7 S. cerevisiae 16 5,6 Metschnikowia fructicola 8 2,8 Hanseniaspora uvarum 5 1,7 Candida zemplinina 3 1,0 Torulaspora delbrueckii 3 1,0 Pichia fluxum 2 0,6 Pichia anomala 1 0,4 Pichia kluyveri 1 0,4 Pichia membranifaciens 1 0,4 Candida glabrata 1 0,4 Kluyveromyces thermotolerans 1 0,4 Totale 285 100,0%Tabella 2.4 Identificazione genetica degli isolati da mosto in Franciacorta (FCR) edOltrepò Pavese (OLT), nel corso delle tre annate. 41Figura 2.9 Biodiversità osservata nei campioni di mosto in Franciacorta ed Oltrepò Pa-vese nel corso delle tre annate.
  40. 40. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico…42 Figura 2.10 Permanenza delle specie di lievito in campioni di mosto, durante le tre an- nate a) in Franciacorta; b) in Oltrepò Pavese. Dal campionamento del vino base sono stati ottenuti 182 iso- lati di lievito (circa il 37% della collezione totale di lievito); i risultati della loro identificazione genetica sono mostrati in Tabella 2.5. In totale sono state identificate 10 diverse specie di lievito (Fi- gura 2.11). Come previsto, S. cerevisiae ha rappresentato la spe-
  41. 41. Capitolo 2. Indagine sull’ecologia di lieviti enologici in Franciacorta ed Oltrepò Pavesecie dominante in vino base, a fine fermentazione alcolica, sia inFranciacorta (35%) che in Oltrepò Pavese (41%). In letteratura si riporta che questa specie, infatti, rappresenta laquasi totalità di lieviti in vino a fine fermentazione alcolica, mentrele specie H. uvarum e Zygosaccharomyces (non corrispondenteal qui ritrovato Z. bailii) risultano solo raramente isolabili (Gonzales,2007). Al termine della fermentazione alcolica anche in questocaso la popolazione di S. cerevisiae era prevalente (76%), anchese non al livello presentato da Gonzales (99%). Il secondo generepiù rappresentativo è risultato Pichia (20%), seguita dalle specieH. uvarum e Z. bailii (3%), quest’ultima una specie che può essereriscontrata a fine fermentazione più facilmente rispetto ad altre,grazie alla sua elevata alcol-tolleranza (Fleet, 2003). L’annata 2009 è stata quella in cui è stato isolato il maggiornumero lieviti; 100 isolati, di cui il 27% dal campionamento divino base della Franciacorta e 29% per Oltrepò Pavese. Durantequesta annata, un totale di 6 differenti specie di lieviti sono stateisolate (Tabella 2.5). Questo risultato potrebbe derivare dal fat- 43to che in realtà la biodiversità interspecifica più elevata è stataottenuta dal campionamento del 2010, dove sono state isola-te 8 differenti specie di lievito (Tabella 2.5). In generale, occorrenotare che in alcuni campioni di vino base è stata rilevata lapresenza di una sola specie; le condizioni del mezzo, con bassopH, presenza di SO2 ed elevata concentrazione di etanolo, costi-tuiscono fattori selettivi importanti soprattutto per le specie non-Saccharomyces. Tuttavia alcuni studi hanno dimostrato da partedi alcuni ceppi una maggior tolleranza all’etanolo; la loro con-seguente maggior persistenza nel mezzo può influenzare l’impat-to sensoriale del prodotto finale (Pramateftaki, 2000; Combina,2005; Gonzáles, 2007). Per quanto riguarda la permanenza di specie di lievito in cam-pioni di vino base nel corso delle tre annate sui due territori, solopoche specie sono state re-isolate. In particolare, S. cerevisiae eP. membranifaciens in Franciacorta ed il solo S. cerevisiae in Ol-trepò Pavese, si sono mostrate specie stabilmente presenti sullearee analizzate (Figura 2.12).
  42. 42. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… Vendemmia e Origine Numero di isolati Percentuale 2009 100 55 Franciacorta 48 27 S. cerevisiae 32 18 Pichia membranifaciens 9 5 Pichia fluxum 3 2 Zygosaccharomyces bailii 2 1 Issatchenkia occidentalis 1 1 Torulaspora delbrueckii 1 1 Oltrepò Pavese 52 29 S. cerevisiae 52 29 2010 36 20 Franciacorta 21 12 S. cerevisiae 11 6 Hanseniaspora uvarum 3 2 Pichia membranifaciens 3 2 Pichia spp 2 1 Zygosaccharomyces bailii 1 1 Issatchenkia occidentalis 1 1 Oltrepò Pavese 15 8 S. cerevisiae 6 344 Candida railenensis 4 2 Pichia fermentans 3 2 Hanseniaspora uvarum 2 1 2011 45 25 Franciacorta 23 13 S. cerevisiae 20 11 Pichia membranifaciens 3 2 Oltrepò Pavese 23 25 S. cerevisiae 16 17 Pichia fluxum 5 5 Pichia membranifaciens 1 1 Zygosaccharomyces bailii 1 1 Totale 182 100% Tabella 2.5 Identificazione genetica degli isolati da vino base in Franciacorta (FCR) ed Oltrepò Pavese (OLT), nel corso delle tre annate.
  43. 43. Capitolo 2. Indagine sull’ecologia di lieviti enologici in Franciacorta ed Oltrepò PaveseFigura 2.11 Biodiversità interspecifica osservata nei campioni di vino base in Francia-corta ed Oltrepò Pavese nel corso delle tre annate. 45
  44. 44. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico…46 Figura 2.12 Permanenza delle specie di lievito in campioni di vino base, durante le tre annate a) in Franciacorta; b) in Oltrepò Pavese.
  45. 45. Capitolo 3. Tipizzazione molecolare dei ceppi di S. cerevisiae …Capitolo 3. Tipizzazione molecolare dei ceppidi S. cerevisiae per il riconoscimento di ecotipiautoctoni3.1 Introduzione Le caratteristiche sensoriali di un vino possono dipendere dallediverse tipologie di lieviti coinvolte nel processo di fermentazio-ne, ed in particolare dai differenti ceppi di S. cerevisiae che sisuccedono durante la vinificazione (Agnolucci, 2007; Capece, 472010; Guerra, 1999, Mercado, 2007, Vilanova 2003). Lo studiodella biodiversità dei ceppi di lievito appartenenti alla stessa spe-cie ci permette di capire l’evoluzione delle popolazioni presentinel mosto durante la vinificazione per incrementarne il controllo,inoltre i ceppi autoctoni caratterizzati da tipici tratti enologici po-trebbero essere caratteristici di una particolare zona vitivinicola.La presenza di questi lieviti determina un aumento della tipicità diun vino, promuovendo la diversificazione dei prodotti vitivinicoli edella zona di origine. La maggior parte delle ricerche condottefino ad ora hanno concentrato il loro studio sul controllo dellafermentazione alcolica (Caruso, 2002; Redz epovic 2002; Versa- ˇ ´,vaud, 1995), anche se non sono mancate le indagini sullo studiodell’ecologia dei lieviti delle uve, del mosto e dell’aria presentenella cantina di vinificazione (Jolly, 2006; Fleet, 2002; Fleet, 2003;Fleet, 2008; Prakitchaiwattana, 2004; Ribéreau-Gayon, 2000; Ga-rijo, 2008). Per quanto riguarda la tipizzazione dei lieviti, sono state svilup-pate differenti metodologie, basate sullo studio dei polimorfismidel DNA, al fine di discriminare tra ceppi appartenenti alla stessaspecie (Querol, 1992, Ness, 1993; Schuller, 2004). Essendo S. cere-visiae il lievito enologico più importante, i ricercatori hanno fina-
  46. 46. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico … lizzato le loro attività sullo studio di questa specie, evidenziando significativi polimorfismi in ceppi di S. cerevisiae indigeni prove- nienti da differenti regioni vitivinicole ed una forte correlazione tra genotipo e proprietà fenotipiche (Esteve-Zarzoso, 2000; Na- dal, 1996). Nel tempo sono state sviluppate alcune tecniche molecola- ri tra cui RAPD (Random Amplified Polymorphic DNA; McGrath, 1998; Perez, 2001), l’analisi dei loci SSR (Single Sequence Repe- at; Ayoub, 2006) e l’analisi delle sequenze interdelta (Ness, 1993). Queste tecniche si sono rivelate utili per lo studio dell’evoluzione di popolazioni di lieviti nel corso di un processo fermentativo, per l’identificazione di un ceppo con caratteristiche peculiari e per la valutazione della biodiversità all’interno di un’area geografica. L’analisi delle sequenze interdelta è stata proposta per la pri- ma volta da Ness (1993) per la tipizzazione di ceppi di S. cerevi- siae tramite l’analisi del polimorfismo interdelta (IDM, interdelta48 marker). Il genoma di S. cerevisiae contiene sequenze ripetute di DNA, le sequenze delta, associate al trasposone Ty1 (Came- ron, 1979). Gli elementi trasponibili o trasposoni sono frammenti di DNA che hanno in comune la capacità di muoversi da un punto all’altro del genoma e di amplificare il proprio numero di copie all’interno dell’ospite. Gli elementi delta costituiscono le ripetizioni terminali (LTR) della sequenza dei trasposoni Ty1 e Ty2 in lievito; questi si possono trovare sia associati al retrotrasposo- ne, sia dispersi nel genoma, in questo caso prendono il nome di “elementi delta” (Legras e Karst, 2003). Eventi di ricombinazio- ne possono espellere la sequenza centrale del retrotrasposone lasciando nella posizione originaria una singola LTR, spiegando la presenza di molte copie di LTR, prive del trasposone, disper- se nel genoma. Il genoma di S. cerevisiae è caratterizzato dalla presenza di 5 famiglie di retrotrasposoni, di cui quattro rientrano nella categoria degli elementi di tipo “Ty1-copia” (Ty1, Ty2, Ty4, Ty5) ed uno (Ty3) nella categoria degli elementi di tipo “gypsy”. Entrambe le classi presentano un’organizzazione simile a quella dei retrovirus (Boeke e Corces, 1989; Doolittle, 1989), ma differi- scono tra loro per la disposizione dei geni: mentre negli elementi tipo “gypsy” la funzione integrasica (INT, importante per l’integra- zione del trasposone nell’ospite) è localizzata all’estremità di Pol
  47. 47. Capitolo 3. Tipizzazione molecolare dei ceppi di S. cerevisiae …(parte della sequenza che codifica gli enzimi implicati nel ciclovitale del trasposone), preceduta dall’RNAasiH, in Ty1-copia INT sitrova all’interno del gene Pol, seguito dalla sequenza codifican-te per la retrotrascrittasi (RT) e da quella per l’RNAsiH (Figura 3.1).Tra queste famiglie solo Ty1, Ty2 e Ty3 risultano essere attive nellatrasposizione all’interno del genoma.Figura 3.1 Struttura del retrotrasposone di tipoTy1-copia (INT prima di RT) e Ty3-gypsy(INT dopo RH). 49 Come dimostrato da diversi autori (Legras e Karst, 2003; Schul-ler, 2004), il numero (S. cerevisiae può contenere da 2 a 30 co-pie dei 5 elementi trasponibili) e la posizione di questi elementihanno una certa variabilità intraspecifica che può essere utiliz-zato come un’impronta digitale genetica per identificare i cep-pi di S. cerevisiae (Xufre, 2011). I marcatori Interdelta sfruttanoquesto polimorfismo. Si tratta di una metodica che prevede unaamplificazione mediante PCR (Polymerase Chain Reaction) diframmenti di DNA situati tra due trasposoni (Ness, 1993). Ai finidell’amplificazione, è necessario progettare dei primers (sequen-ze omologhe al DNA) che si appaino ad entrambe le estremitàdelta (δ). L’amplificazione delle sequenze interdelta è conosciuta peressere altamente specifica per l’identificazione di ceppi di S.cerevisiae rispetto ad altri lieviti (Ness, 1993). Pramateftaki (2000)analizzando le sequenze δ di 500 isolati di un’area vitivinicola del-la Grecia ha ottenuto dei profili di amplificazione esclusivamenteda isolati di S. cerevisiae. Poiché l’amplificazione delle sequenze inter-δ sembra essereefficace per la tipizzazione, molti studi ne sono seguiti per otti-mizzare la tecnica. Infatti, Legras e Karst (2003) progettando una
  48. 48. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico … nuova coppia di primers hanno ottenuto un netto miglioramento del polimorfismo dei profili genetici. Tristezza (2009) ha adottato la tecnica dell’elettroforesi capillare ai marcatori Interdelta per la genotipizzazione di ceppi di S. cerevisiae, ottenendo un miglio- ramento nella sensibilità e precisione della tecnica. Un ampio studio delle biodiversità intraspecifica di S. cerevisiae porta alla possibilità di isolare nuovi ceppi indigeni che potreb- bero sostituire quelli attualmente in commercio impiegati nella produzione di vino, considerando che quelli indigeni risultano più adatti alla crescita in uno specifico mosto e riflettono maggior- mente la biodiversità di una regione vitivinicola. Per questo mo- tivo, nazioni come Argentina (Combina, 2005; Mercado, 2007), Spagna (Blanco, 2006; Garijo, 2008; Gonzales, 2007; Torija, 2001; Sabate, 2002), Francia (Valero, 2007), Austria (Lopandic, 2007), Croazia (Redz epovic 2002), Slovenia (Raspor, 2006), Ungheria ˇ ´, (Csoma, 2010), Grecia (Nikolaou, 2007; Nisiotou e Nychas, 2007), Sud Africa (Jolly, 2003; Pretorius, 1999), India (Chavan, 2009) e50 Giappone (Shinohara, 2003) hanno condotto ricerche volte a valutare la biodiversità dei lieviti da vino in alcune delle principali regioni vitivinicole. In Italia, medesimi studi sono stati condotti nel- le regioni Marche (Guerra, 1999), Basilicata (Caruso, 2002), Puglia (Cappello, 2004) e Sicilia (Romancino, 2000). Dal momento che la regione Lombardia è una delle più impor- tanti regioni italiane per la produzione di vino spumante, lo scopo di questo lavoro è stato la valutazione della biodiversità intraspe- cifica degli isolati di S. cerevisiae raccolti durante il processo di produzione del vino in Franciacorta (Brescia) ed Oltrepò Pavese (Pavia). Una caratterizzazione molecolare a livello di ceppo è stata condotta tramite l’utilizzo della tecnica molecolare IDM per gli isolati di S. cerevisiae campionati da aria, mosto e vino duran- te le stagioni produttive del 2009, 2010 e 2011. 3.2 Materiale e Metodi Isolamento dei campioni La tipizzazione è stata condotta per tutti i 272 isolati di S. cerevi- siae collezionati nel corso del progetto (Tabella 3.1). Nello studio è stata inclusa l’analisi di 48 lieviti commerciali, alcuni dei quali

×