VALORIZZAZIONE DELLE D.O.C.G.
Upcoming SlideShare
Loading in...5
×
 

Like this? Share it with your network

Share

VALORIZZAZIONE DELLE D.O.C.G.

on

  • 789 views

VALORIZZAZIONE DELLE D.O.C.G. FRANCIACORTA ...

VALORIZZAZIONE DELLE D.O.C.G. FRANCIACORTA
ED OLTREPÒ PAVESE METODO CLASSICO
MEDIANTE IMPIEGO DI LIEVITI AUTOCTONI
PER IL MIGLIORAMENTO DELLE PRODUZIONI
E COME MARCATORI DI TIPICITÀ

Statistics

Views

Total Views
789
Views on SlideShare
741
Embed Views
48

Actions

Likes
0
Downloads
7
Comments
0

2 Embeds 48

http://www.riccagioia.it 31
http://www.riccagioia.com 17

Accessibility

Categories

Upload Details

Uploaded via as Adobe PDF

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

VALORIZZAZIONE DELLE D.O.C.G. Document Transcript

  • 1. Department of Food Environmental Consorzio per la tutela Consorzio Tutela Vini and Nutritional Sciences del Franciacorta Oltrepò Pavese www.regione.lombardia.it VALORIZZAZIONE DELLE D.O.C.G. FRANCIACORTA ED OLTREPÒ PAVESE METODO CLASSICO MEDIANTE IMPIEGO DI LIEVITI AUTOCTONI PER IL MIGLIORAMENTO DELLE PRODUZIONI E COME MARCATORI DI TIPICITÀ Quaderni della Ricerca n. 148 - novembre 2012
  • 2. Sperimentazione condotta nell’ambito del progetto di ricerca n. 1315“Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico mediante impiego di lieviti autoctoni per il miglioramento delle produzioni ecome marcatori di tipicità” (d.g.r. 30/3/2009 n. VIII/9182 - Piano per la ricerca e lo sviluppo 2009). Hanno realizzato le attività sperimentali: Università degli Studi di Milano Dipartimento di Scienze per gli Alimenti, la Nutrizione e l’Ambiente via Celoria, 2 - 20133 Milano referente: prof. Roberto Foschino, roberto.foschino@unimi.it Consorzio per Tutela del Franciacorta Via Verdi, 53 - 25030 Erbusco (BS) referente: dr.ssa Monica Faccincani, ufficio.tecnico@franciacorta.net Consorzio Tutela Vini Oltrepò Pavese piazza Vittorio Veneto, 24 - 27043 Broni (PV) referente: dr.ssa Alice Colombo, ufficio.tecnico@vinoltrepo.it Per Informazioni: Regione Lombardia - Direzione Generale Agricoltura U.O. Innovazione, cooperazione e valorizzazione delle produzioni Struttura Ricerca, innovazione tecnologica e servizi alle imprese Piazza Città di Lombardia 1 - 20124 Milano tel: +39.02.6765.3790 fax: +39.02.6765.8056 e-mail: agri_ricerca@regione.lombardia.it referente: Rossana Tonesi - tel: +39.02.6765.3737 e-mail: rossana_tonesi@regione.lombardia.it © Copyright Regione Lombardia
  • 3. Department of Food Environmental Consorzio per la tutela Consorzio Tutela Vini and Nutritional Sciences del Franciacorta Oltrepò PaveseVALORIZZAZIONE DELLE D.O.C.G. FRANCIACORTA ED OLTREPÒ PAVESE METODO CLASSICO MEDIANTE IMPIEGO DI LIEVITI AUTOCTONI PER IL MIGLIORAMENTO DELLE PRODUZIONI E COME MARCATORI DI TIPICITÀ A cura di: Roberto Foschino Ileana Vigentini Gabriella De Lorenzis Claudia Picozzi Shirley Barrera Cardenas Vincenzo Fabrizio Quaderni della Ricerca n. 148 - novembre 2012
  • 4. IndiceIndicePresentazione 7Capitolo 1. Analisi dei fabbisogni, 5stato dell’arte e obiettivi 9Capitolo 2. Indagine sull’ecologia di lieviti enologiciin Franciacorta ed Oltrepò Pavese 17Capitolo 3. Tipizzazione molecolare dei ceppidi S. cerevisiae per il riconoscimento di ecotipi autoctoni 47Capitolo 4. Selezione dei ceppie prove di microvinificazione 64Capitolo 5. Il destino del DNA nello spumante 95Capitolo 6. Considerazioni finali 120Bibliografia 125Ringraziamenti 134
  • 5. PresentazionePresentazione La Lombardia è regione leader nel- la produzione di vino spumante di alta qualità rappresentando oltre il 60% del prodotto nazionale realizzato con me- todo classico. Nel settore vitivinicolo le bollicine lombarde sono da anni in co- stante crescita, grazie al continuo mi- glioramento del livello qualitativo e al trainante successo imprenditoriale del 7 “modello” Franciacorta. Con il recen- te riconoscimento della Denominazio- ne d’Origine Controllata e Garantita conferito all’Oltrepò Pavese Metodo Classico la Lombardia può vantare unaproduzione di eccellenza negli spumanti D.O.C.G. con un poten-ziale di oltre 13 milioni di bottiglie. Occorre tuttavia riconoscere che il mondo dell’enologia ita-liana sta attraversando una fase di forte trasformazione e crisi,determinata un profondo cambiamento delle preferenze e del-le abitudini al consumo e accompagnata da una importanteriduzione delle disponibilità economiche del pubblico. Inoltrel’ingresso di nuovi Paesi produttori ha ulteriormente innalzato lacompetizione commerciale, soprattutto sul mercato estero. Percontro, con tendenza positiva, si va affermando tra i consumato-ri una maggior attenzione alla qualità, alla tipicità del vino e agliaspetti sensoriali ed emozionali della degustazione. È tempo dunque di riflettere, progettare e reagire per indiriz-zare le risorse, da un lato, verso il miglioramento e la differenzia-zione qualitativa, valorizzando soprattutto vini che esprimano unlegame con il territorio di appartenenza, dall’altro lato verso la
  • 6. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… penetrazione dei nostri prodotti nei mercati emergenti incremen- tando l’attività di promozione all’estero. Su questa linea strategica si inserisce il progetto di ricerca Eno- track che, a tre anni dal suo avvio, presenta in questo volume i suoi risultati, frutto della fattiva collaborazione tra il Dipartimento di Scienze per gli Alimenti, la Nutrizione e l’Ambiente dell’Universi- tà degli Studi di Milano, il Consorzio per Tutela del Franciacorta e il Consorzio Tutela Vini Oltrepò Pavese. Per valorizzare le D.O.C.G. metodo classico della Franciacor- ta e dell’Oltrepò Pavese la ricerca ha sperimentato l’impiego di lieviti autoctoni per il miglioramento qualitativo delle produzioni e come marcatori della tipicità. Giuseppe Elias Assessore all’Agricoltura Regione Lombardia8
  • 7. Capitolo 1. Analisi dei fabbisogni, stato dell’arte e obiettiviCapitolo 1. Analisi dei fabbisogni, stato dell’artee obiettivi All’interno della regione Lombardia, Franciacorta ed OltrepòPavese costituiscono le aree geografiche trainanti la produzionedi vino spumante realizzato con metodo classico, rappresentan-do quasi due terzi dei “bollicine” a marchio D.O.C.G. fabbricatisul territorio nazionale. Il continuo miglioramento del livello qua-litativo del prodotto lombardo e l’attenzione alla promozionedell’immagine, sapientemente considerati come obiettivi fon- 9damentali da entrambi i Consorzi e dalla maggioranza dei pro-duttori, sono comprovati dall’incremento costante delle vendite,anche in questi anni di crisi economica. La valorizzazione dei pro-dotti di origine, realizzati e percepiti come meglio legati al territo-rio, può emergere come linea strategica di successo, soprattuttoper le attività rivolte al rafforzamento della comunicazione e allapenetrazione del mercato estero, naturale destino di uno svilup-po commerciale futuro.1.1 Analisi dei fabbisogni Il Franciacorta D.O.C.G., viene preparato a partire da uveChardonnay e/o Pinot bianco e/o Pinot nero coltivate in provin-cia di Brescia su una superficie di circa 2000 ettari; 160 sono gliaderenti al Consorzio di Tutela del Franciacorta, 74 le aziende diimbottigliamento. L’ Oltrepò Pavese Metodo Classico, è prodot-to da uve Pinot Nero in purezza o in miscela con Chardonnaycoltivate in provincia di Pavia per un’estensione di circa 2000 et-tari; il Consorzio Tutela Vini Oltrepò Pavese conta 250 associati,con 1300 viticoltori conferenti, 6 le cantine sociali.
  • 8. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… Gli areali della Franciacorta e dell’Oltrepò Pavese rappresen- tano zone di particolare interesse per l’applicazione di nuove tec- nologie nel settore viti-vinicolo come effetto della convergenza di fattori positivi e strategici per il successo delle innovazioni quali, la grande perizia tecnica ed il buon livello socio-culturale degli operatori, l’atteggiamento di apertura verso la sperimentazione senza tralasciare il valore della tradizione, l’elevata vocazionalità dei territori, l’orientamento della filiera verso produzioni vinicole di pregio. Entrambi i vini , Franciacorta D.O.C.G. e Oltrepò Pavese Me- todo Classico, si ottengono da una lavorazione che dura non meno di 2 anni dalla vendemmia, di cui almeno 15 mesi (per la denominazione Oltrepò Pavese) e 18 mesi (per la denominazio- ne Franciacorta) di lenta rifermentazione in bottiglia a contatto con cellule di lievito. L’utilizzo di preparati commerciali di lievito è una pratica ormai universalmente diffusa presso le cantine della nostra Regione10 poiché offre garanzie di una conduzione ininterrotta e completa della fermentazione e della rifermentazione. Tuttavia le colture di Saccharomyces attualmente utilizzate per le spumantizzazioni (starter) sono in numero ridotto, talvolta lo stesso ceppo assume sigle diverse perché attribuito a marchi diversi, e comunque trat- tasi di ceppi isolati e selezionati in territorio francese sulla base delle caratteristiche qualitative dello Champagne o per adat- tarsi alla produzione di una ampia gamma di preparazioni vina- rie, non tenendo conto delle specifiche proprietà sensoriali dei prodotti lombardi. La sostituzione dei ceppi starter d’oltralpe con ceppi di nuovo isolamento in territorio lombardo, appositamente selezionati per caratteri tecnologici e di qualità, può condurre alla produzione di vini con proprietà sensoriali migliorate e co- munque valorizzanti il prodotto finito, attraverso il riconoscimento di una relazione diretta con l’area geografica di produzione. Nel- lo specifico caso degli spumanti fatti secondo il metodo classico, la tecnica di rifermentazione in bottiglia comporta il vantaggio che i residui cellulari permangono nel prodotto fino al consumo. Per conseguenza il DNA di lievito, grazie alla sua natura di mole- cola informativa, può costituire un idoneo bersaglio analitico e la sua decodificazione può risultare un potente strumento per l’indi- viduazione e la certificazione dell’origine territoriale del prodotto.
  • 9. Capitolo 1. Analisi dei fabbisogni, stato dell’arte e obiettivi Il crescente e continuato utilizzo di starter commerciali costituitida un esiguo numero di ceppi per la rifermentazione tende aduniformare le caratteristiche sensoriali dei vini omologando i pro-dotti di Franciacorta e di Oltrepò Pavese agli spumanti di altrezone produttive. Infatti, il dominio fermentativo e la dispersioneambientale delle colture starter selezionate di provenienza este-ra conducono sostanzialmente a due conseguenze:• la prima, di tipo enologico, è legata al fatto che i lieviti autoc- toni, a seguito della loro inferiore concentrazione iniziale e/o della competizione nutrizionale, non riescono ad apportare il loro contributo metabolico alla qualità del prodotto finale;• la seconda, di tipo ecologico, è che le forme indigene pos- sono scomparire dall’habitat del vigneto e della cantina, pur possedendo caratteristiche elettive in termini di apporto sen- soriale verso i prodotti. Il recupero di tali ceppi, mediante una campagna program-mata ed estesa di campionamento sui territori coinvolti, vieneproposto per salvaguardare le forme microbiche rimaste che 11possono essere impiegate nella valorizzazione e tutela dei pro-dotti attuali e che, in futuro, potrebbero venire utilizzate per nuo-ve applicazioni. Il terzo problema che l’idea progettuale si propone di affronta-re è quello di fornire un potente strumento di verifica per i sistemidi tracciabilità adottati a garanzia della qualità ed autenticitàdel prodotto lombardo. L’impegno è quello di sviluppare un pro-tocollo analitico, in tecnica qPCR basato sull’analisi del DNA e alsuo utilizzo per la tutela delle produzioni di spumante D.O.C.G..Attraverso l’analisi della sequenza nucleotidica o la determina-zione di alcuni target genici specifici, questo metodo consen-tirebbe di individuare il ceppo di lievito che è stato impiegatonella rifermentazione, rappresentando un vero e proprio “mes-saggio nella bottiglia” per la durata della vita commerciale delprodotto.1.2 Stato dell’arte Lo spumante è un vino che forma spuma all’atto della mescitain conseguenza della liberazione di anidride carbonica ottenuta
  • 10. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… da fermentazione operata da lieviti. Da un punto di vista tec- nologico la produzione dei vini spumanti può essere suddivisa in due fasi: la formulazione del vino base, realizzata allestendo una miscela di differenti vini preparati con tecnica di vinificazione in bianco, e la spumantizzazione, ottenuta per rifermentazione di zuccheri da parte di ceppi di Saccharomyces in contenitori chiusi. Nel metodo classico (metodo champenoise) la presa di spuma avviene direttamente in bottiglia, inoculando il vino base con idoneo innesto microbico (> 106 UFC/ml) e sciroppo zucche- rino (20-24 g/L) in modo da raggiungere una sovrappressione di CO2 di 5-6 atmosfere. La maturazione del prodotto sulle fecce avviene a basse temperature (a circa 12°C-14°C) e si protrae per un tempo prolungato (≥ 15 mesi); in questo periodo avvengono trasformazioni biochimiche operate da enzimi sintetizzati dai lie- viti, fenomeni di diffusione di sostanze tra cellule e mezzo, lisi delle cellule, che permettono il conferimento delle peculiari caratteri- stiche aromatiche. Nel metodo Charmat la spumantizzazione del12 vino base, addizionato di zucchero e lieviti, avviene in autocla- vi a temperature più elevate (20-25°C) e per tempi brevi (pochi giorni) che non consentono l’ottenimento delle qualità sensoriali che si raggiungono mediante l’affinamento in bottiglia. In effetti è proprio nel metodo classico per la produzione di spumanti, più che in ogni altra tecnica enologica, che l’azione dei lieviti non si esaurisce con il compimento della sola fermenta- zione alcolica, ma si esalta con la formazione di composti secon- dari (es. alcoli superiori e loro esteri, esteri etilici di acidi grassi, po- lisaccaridi parietali), con la modifica di composti nativi dell’uva (es. acido malico, glicosidi, tioli alifatici ramificati, acidi fenolici) (Lambrechts e Pretorius, 2000) e prosegue con la cessione di so- stanze attraverso il fenomeno dell’autolisi cellulare (aminoacidi, oligopeptidi). La quantità di ciascuno di questi composti è spes- so difficilmente correlabile al gradimento finale, che è funzione della percezione complessiva che offre il vino, ed è dipendente in larga misura dal ceppo di Saccharomyces utilizzato oltre che dalle condizioni ambientali di sviluppo del lievito (Ribereau-Ga- yon, 1998). La possibilità di selezionare ceppi autoctoni con proprietà tec- nologiche utili e caratteristiche di qualità idonee al tipo di pro- dotto (potere fermentativo, purezza fermentativa, flocculenza,
  • 11. Capitolo 1. Analisi dei fabbisogni, stato dell’arte e obiettiviprofilo aromatico) soddisfa l’obiettivo della difesa della comuni-tà microbica indigena e contemporaneamente suggella la va-lorizzazione del prodotto tipico attraverso l’evidenza del legametra territorio e prodotto finito. L’isolamento e l’identificazione dilieviti è oggi facilitata dallo disponibilità di tecniche molecola-ri sufficientemente rapide ed affidabili (Eigel e Feldmann, 1982;Querol, 1992; Granchi,1999; Mannazzu et al., 2002; Marinangeliet al. 2004a; Marinangeli et al. 2004b; Foschino e Vigentini, 2006).Saccharomyces cerevisiae è stata la prima specie eucariota il cuigenoma è stato sequenziato totalmente (Goffeau et al., 1996) etuttavia il settore enologico non ha ancora sfruttato pienamen-te questa enorme potenzialità informativa. Le moderne tecni-che di analisi genetica forniscono dunque adeguati strumentiscientifici per individuare nuovi ceppi autoctoni (Ayoub, 2006,Baleiras Couto, 1996; Egli, 1998; Pretorius, 2000; Ciani, 2004) le cuiproprietà tecnologiche e metaboliche hanno già consentito ilmiglioramento qualitativo del vino e la salvaguardia delle popo-lazioni autoctone in alcune regioni italiane, quali il Veneto (Ciani, 131997; Torriani, 1999; Zilio, 2000; Bocca, 2004; Zilio, 2004), le Marche(Guerra, 1999), la Toscana (Rosi,1998) e la Sicilia (Giudici, 1997).I parametri analitici adottati per la selezione di ceppi enologicidi lievito fra quelli di nuovo isolamento sono stati ampiamentedescritti (Giudici e Zambonelli, 1992; Steger e Lambrechts, 2000;Masneuf , 2003; Cavazza, 2006) per gli aspetti metabolici (vigorefermentativo, completezza della fermentazione degli zuccheri,resa in alcol, metabolismo dell’acido malico, formazione di com-posti secondari della fermentazione, metabolismi degli ammino-acidi, dei grassi e dei fenoli) e tecnologici generali (tolleranzaall’alcol e al biossido di zolfo, criotolleranza, produzione/sensibi-lità al “fattore killer”) o specifici per l’impiego nella spumantiz-zazione (attitudine alla flocculazione, potere schiumogeno, ca-pacità autolitica). Tuttavia, solo valutando il comportamento delceppo in vinificazione è possibile garantire che il vino possa trarregiovamento dal nuovo agente biologico fermentativo ritrovato(Rosi, 2005). Pertanto l’introduzione di una valutazione sensorialedi vinificazioni e spumantizzazioni ad-hoc rappresenta un fattoredeterminante per una conclusione positiva ed efficace in questoambito di ricerca. Allo stato delle conoscenze non sono noti studi di selezione di
  • 12. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… Saccharomyces autoctoni per la produzione di spumante lom- bardi benché questi prodotti rappresentino in Italia una quota di mercato preponderante tra le D.O.G.C. Anche lavori sperimen- tali riguardanti la condizione e lo stato degli acidi nucleici nei vini e in generale nelle matrici enologiche (Savazzini e Martinelli, 2006; Vigentini, 2007), non sono numerosi sebbene tali molecole costituiscano un interessante componente biologica, assai utile per il riconoscimento delle specie. Il caso specifico dello spuman- te fatto con metodo classico rappresenta un ottimo modello per l’applicazione di sistemi di tracciabilità che sfruttano la presen- za ed il ruolo dei microrganismi nel processo produttivo. Infatti poiché la rifermentazione avviene in bottiglia, e cioè nell’ultimo contenitore ermetico che non subisce ulteriori trattamenti tecno- logici, è assai probabile che il DNA sia presente nelle poche cel- lule residue o sia fuoriuscito nel mezzo in seguito alla lisi cellulare, rimanendo nel prodotto finito in quantità e qualità utili per l’ese- cuzione di saggi molecolari. L’idea originale di questo program-14 ma di ricerca è quella di sfruttare questa frazione di acidi nucleici come marcatori molecolari per individuare il ceppo rifermentan- te e indirettamente “tracciare” le produzioni. Infine si ricorda come il dibattito sui lieviti autoctoni è tuttora aperto e che, in ogni caso, la messa a punto di protocolli analiti- ci per l’individuazione accurata di ceppi costituenti le comunità microbiche che intervengono nel processo fermentativo, costitu- isce il presupposto metodologico per la dimostrazione oggettiva di un eventuale legame esistente tra prodotto e territorio. 1.3 Obiettivi del progetto e risultati attesi Il progetto si è prefisso i seguenti obiettivi: • isolare, caratterizzare e conservare in maniera stabile i ceppi di Saccharomyces “ecotipi-specifici” delle zone vitivinicole della Lombardia vocate alla produzione di spumanti; • identificare, fra i ceppi riconosciuti come autoctoni sia dell’a- rea Franciacorta che dell’area Oltrepò, quelli con adeguata attitudine alla vinificazione e spumantizzazione sulla base di caratteristiche tecnologiche ed aromatiche; • formulare starter di rifermentazione con ceppi autoctoni, re-
  • 13. Capitolo 1. Analisi dei fabbisogni, stato dell’arte e obiettivi lativi a ciascuna area di produzione, la cui idoneità sia stata validata mediante vinificazioni e spumantizzazioni secondo la prassi produttiva prevista dai rispettivi disciplinari di produzione di Franciacorta ed Oltrepò Pavese;• definire protocolli di estrazione ed amplificazione del DNA fun- gino da spumante per l’identificazione delle specie ed even- tuale riconoscimento del ceppo utilizzato in rifermentazione. I risultati attesi dall’esecuzione del progetto sono stati rispettati;in particolare sono stati ottenuti i seguenti prodotti:• Allestimento e disponibilità di una collezione di ceppi autoc- toni lombardi a vocazione enologica. Le colture sono conser- vate allo stato congelato presso il DeFENS dell’Università degli Studi di Milano.• Preparazione di starter costituiti da colture di lieviti autoctoni da impiegare per i vini spumanti. La formulazione dello starter è un punto chiave per la fase di rifermentazione in bottiglia poiché le cellule del lievito inserite nel liqueur de tirage sono gli agenti 15 biologici per l’ottenimento di profili aromatici nuovi e peculiari nonché costituiranno il materiale bersaglio per l’applicazione delle tecniche molecolari utili alla verifica della tracciabilità. Sono state preparate otto differenti colture starter, quattro per ciascuna area di produzione, Franciacorta e Oltrepò Pavese.• Produzione, affinamento e valutazione sensoriale di vino speri- mentale prodotto con spumantizzazioni in scala ridotta per la verifica della performance delle colture starter sopra citate. La produzione dello spumante è stata realizzata presso otto strutture produttive, cinque per il Consorzio per la Tutela del Franciacorta e tre per il Consorzio Tutela Vini Oltrepò Pavese. Sono state previste diverse sedute di degustazione a differenti età del prodotto in affinamento, organizzate dai Consorzi e re- alizzate da panel di assaggiatori esperti.• Protocollo sperimentale per l’estrazione ed amplificazione di DNA da vino spumante e riconoscimento della specie utilizza- ta in rifermentazione. L’idea era quella di realizzare un meto- do che potesse impiegarsi come strumento per identificare il/i ceppo/i impiegato/i in rifermentazione e dunque per verificare la presenza di un elemento oggettivo al fine di garantire il mar- chio di denominazione.
  • 14. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… • Attività di divulgazione tecnica e scientifica attraverso pubbli- cazioni su riviste di settore a livello nazionale e internazionale, siti internet, per l’aumento delle conoscenze in enologia, ed ecologia microbica e a tutela della fruibilità universale dei risul- tati. Organizzazione di un convegno al termine della sperimen- tazione atto a divulgare i risultati del progetto presso le imprese della Regione, gli enologi, i tecnici dei servizi agricoli regionali al fine di diffondere l’innovazione introdotta. I destinatari diretti dei risultati sono gli operatori della filiera enologica in Lombardia, con particolare riguardo ai produtto- ri di D.O.C.G. Franciacorta e D.O.C.G. Oltrepò Pavese Metodo Classico, per i quali l’innovazione tecnologica adottata potreb- be comportare un vantaggio competitivo in termini di migliora- mento qualitativo e raggiungimento dell’evidenza di una relazio- ne diretta tra prodotto finito e territorio, fattori determinanti per il successo commerciale del prodotto.16 Altri destinatari potranno essere le aziende di produzione di fer- menti per l’industria enologica, anch’esse diffusamente presenti in Lombardia, qualora si assumano l’incarico di rendere dispo- nibili commercialmente le formulazioni di starter prodotte dalla ricerca, previo accordo con i partner del progetto. I destinatari indiretti sono i consumatori finali del vino e più in generale il sistema economico regionale che si avvantaggia nel fornire al mercato prodotti tipici e di qualità superiore con riper- cussioni positive anche nel comparto turistico.
  • 15. Capitolo 2. Indagine sull’ecologia di lieviti enologici in Franciacorta ed Oltrepò PaveseCapitolo 2. Indagine sull’ecologia di lievitienologici in Franciacorta ed Oltrepò Pavese2.1 Introduzione Nel corso di una vinificazione sono molteplici i fattori che posso-no influenzare la qualità del vino; tra questi, la gestione del vigne-to, le tecniche enologiche e le specie di lievito utilizzate (Ciani,2009). In particolare, per quanto riguarda l’aspetto microbiologi-co, oggigiorno vi è un notevole interesse a migliorare la cono- 17scenza di base riguardante la biodiversità dei lieviti a vocazioneenologica che possono propagarsi durante la fermentazione al-colica (Agnolucci, 2007; Cappello, 2004; Guerra, 1999; Mercado,2007; Vilanova, 2003). I lieviti vinari vengono classificati tra gli asco-miceti (Tabella 2.1) e comprendono sia i lieviti sporigeni capaci diformare meiospore (teleomorfici) che i lieviti asporigeni (anamorfi-ci), di cui non si conosce la fase sessuata. Saccharomyces cerevi-siae, sebbene rappresenti l’attore principale della fermentazionealcolica, non è l’unica specie riscontrata in vinificazione; infattile principali forme di interesse enologico si ricordano quelle ap-partenenti ai generi: Candida (C. stellata, C. vini), Debaryomyces(D. hansenii, Candida famata), Dekkera (D. anomala, D. bruxel-lensis, B. bruxellensis), Issatchenkia (I. orientalis, I.terricola, Candidakrusei), Hanseniaspora (H. uvarum, K. apiculata), Kluyveromyces(K. lactis, K. marxianus), Metschnikowia (M. pulcherrima, Candidapulcherrima), Pichia (P. anomala, P. fermentans, Candida pelli-culosa, C. valida) Saccharomyces (S. bayanus, S. cerevisiae, S.paradoxus, S. pastorianus, Candida robusta), Saccharomycodes(S. ludwigii) Schizosaccharomyces (S. pombe), Torulaspora (T.delbrueckii, Candida colliculosa), Zygosaccharomyces (Z. bailii).Quando si parla di “biodiversità” bisogna tener presente che essa
  • 16. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… può riguardare sia la “biodiversità interspecifica”, che comporta lo studio dell’ecologia dei microrganismi a livello di specie, che la “biodiversità intraspecifica”, dedicata al riconoscimento dei diver- si ceppi microbici appartenenti alla medesima specie. La compo- sizione della popolazione di lieviti associata ad un ambiente eno- logico può variare notevolmente a causa di diversi fattori quali, le condizioni climatiche, la varietà d’uva e la posizione geografica (Guillamon, 1996; Martinez, 2007). In particolare, la valutazione della biodiversità inter-specifica dei lieviti è rilevante per compren- dere l’evoluzione nel processo di vinificazione e di conseguenza aumentare la capacità di controllo del processo fermentativo. Divisione Ascomycota Classe: Archiascomycetes Ordine: Schizosaccharomycetales Famiglia: Schizosaccharomycetaceae Genere: Schizosaccharomyces18 Classe: Hemiascomycetes Genere: Ordine: Saccharomycetales Metschnikowia Famiglia: Metschnikowiaceae Famiglia: Saccharomycetaceae Genere: Debaryomyces Dekkera Issatchenkia Kluyveromyces Pichia Saccharomyces Torulaspora Zygosaccharomyces Famiglia: Saccharomycodaceae Genere: Hanseniaspora Saccharomycodes Famiglia: Candidaceae Genere: Brettanomyces Candida Kloeckera Tabella 2.1 I lieviti di interesse enologico (Kurtzman e Fell, 1998).
  • 17. Capitolo 2. Indagine sull’ecologia di lieviti enologici in Franciacorta ed Oltrepò Pavese Lo sviluppo ed il miglioramento delle tecniche di biologia mo-lecolare hanno contribuito in modo significativo allo studio dellabiodiversità e delle caratteristiche genetiche dei lieviti. Attual-mente, le sequenze di DNA che vengono analizzate per l’identi-ficazione dei lieviti vinari sono sequenze geniche o intergenichesoggette a polimorfismi di lunghezza o di sequenza. Tra le tecni-che utilizzate vi sono:• Amplificazione degli spaziatori interni trascritti (Internal Transcri- bed Spacers, ITS) del DNA ribosomiale (rDNA);• Analisi RFLP (Restriction Fragment Length Polymorphism) degli ITS (PCR-RFLP);• Analisi della sequenza dei domini D1/D2 del 26S rDNA.• Il DNA ribosomiale (rDNA) rappresenta un target ideale per l’i- dentificazione molecolare di una vasta gamma di organismi; il processo evolutivo che lo caratterizza è relativamente lento e consente la presenza al suo interno sia di sequenze altamente conservate, anche in specie molto diverse, sia di sequenze va- riabili, utili per confrontare specie più strettamente correlate. In- 19 dividui della stessa specie si caratterizzano per una sostanziale identità di sequenza dell’rDNA (limitato polimorfismo intraspe- cifico) mentre individui appartenenti a specie diverse presen- tano un’identità di sequenza tanto minore quanto maggiore è la loro distanza evolutiva (elevato polimorfismo interspecifico). In S. cerevisiae, l’rDNA è localizzato sul XII° cromosoma, dove sono presenti fino a circa 120 unità ripetute ciascuna costituita da quattro differenti geni: 18S, 5,8S, 26S e 5S. Le sequenze 18S e 26S sono separate dalla sequenza 5,8S dagli spaziatori interni trascritti (Internal Transcribed Spacers, ITS) come si può osserva- re in Figura 2.1 (Vincenzini, 2005). Figura 1.8 Rappresentazione schematica di un’unità di DNA ribosomialeFigura 2.1 Rappresentazione schematica di un’unità di DNA ribosomiale di lievito (Vin-cenzini, 2005).
  • 18. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… L’analisi PCR-RFLP degli ITS impiega dei primers disegnati sulla porzione 5’ del 18S rDNA e sulla porzione 3’ del 26S rDNA. Que- sti oligonucleotidi sono quindi disegnati su sequenze altamente conservate ed esterne alle regioni ITS variabili. Quest’ultima ca- ratteristica li rende universali, ossia consente il loro allineamento sul DNA stampo ad un numero elevato di specie. Il confronto dei prodotti di PCR, differenti tra le diverse specie per lunghezza e/o sequenza ne permette l’identificazione. Gli ampliconi possono essere lunghi da un minimo di 380 bp in Yarrowia lipolytica e Pi- chia pastoris ed un massimo di 1050 bp in Schizosaccharomyces pombe (Esteve- Zarzoso, 1999). Tuttavia, due o più specie possono essere caratterizzate da prodotti di amplificazione della medesima lunghezza ma di diversa sequenza; in questo caso il metodo prevede che gli amplificati vengano digeriti con enzimi di restrizione quali CfoI, HaeIII e HinfI che riconoscono sequen- ze specifiche sul DNA bersaglio e generano profili di restrizione caratteristici per ogni specie di lievito. Per accertare l’apparte-20 nenza ad una specie nel caso in cui la restrizione delle ITS non sia sufficiente ci si avvale del sequenziamento del dominio D1/ D2 del gene 26S rDNA. Questa sequenza, che misura circa 600 bp, viene riconosciuta come il principale bersaglio per l’identifi- cazione di quasi tutti gli ascomiceti attualmente noti (Kurtzman e Robnett, 1998). Il sequenziamento di questa regione e la compa- razione della sequenza ottenuta con quelle disponibili in banche dati (GenBank o EMBL), mediante l’impiego gratuito on-line di algoritmi specifici (Basic Local Alignment Search Tool), consento- no l’attribuzione della specie al ceppo indagato. Secondo un’o- pinione correntemente accettata, differenze in più di sei basi su 600 indicano che i lieviti confrontati non appartengono alla stes- sa specie (Vincenzini, 2005). Sebbene ad oggi la ricerca scientifica si è concentrata princi- palmente sul controllo della fermentazione alcolica, molti lavo- ri affrontano lo studio dell’ecologia di lieviti sulle uve, sul mosto e anche nell’aria della cantina. In particolare, è stato eviden- ziato che il succo d’uva appena pressato ospita un’ampia va- rietà di specie di lieviti, soprattutto del genere Hanseniaspora, Pichia, Candida, Metschnikowia e Kluyveromyces. Di tanto in tanto, specie di altri generi come Cryptococcus, Rhodotorula, Debaryomyces, Issatchenkia, Zygosaccharomyces, Saccha-
  • 19. Capitolo 2. Indagine sull’ecologia di lieviti enologici in Franciacorta ed Oltrepò Paveseromycodes, Torulaspora, Dekkera, Schizosaccharomyces e Sac-charomyces sono stati isolati dalle uve (Jolly, 2006; Fleet, 2003,2008; Prakitchaiwattana, 2004; Ribéreau-Gayon, 2000). Una fer-mentazione spontanea si caratterizza per la crescita di differentispecie di lievito che provengono dall’uva. Infatti, analisi micro-biologiche sulla flora dei lieviti associate a fermentazioni spon-tanee hanno permesso di stabilire che nella maggior parte deicasi avviene un sequenziale uso del substrato: inizialmente i lievitipresenti in numero maggiore sono gli apiculati (Hanseniasporae Kloeckera), che, dopo tre-quattro giorni lasceranno il posto aS. cerevisiae (Martini, 1996; Pretorius, 2000). Il metabolismo di S.cerevisiae porta ad un accumulo di sostanze come etanolo, aci-di grassi a media catena e acetaldeide, che inibiscono le altrespecie (Edwards, 1990; Bisson, 1999; Ludovico, 2001; Fleet, 2003).L’utilizzo di colture starter è un fattore fondamentale per la con-duzione di una fermentazione controllata e per l’inibizione deilieviti indigeni. Tuttavia, diversi studi degli ultimi venticinque annidimostrano che la crescita di K. apiculata e C. stellata non sono 21completamente inibite nel corso di una fermentazione inoculatacon culture starter (Heard e Fleet, 1985; Martinez, 1989). Infine,Garijo et al. (2008) hanno studiato la presenza di microrganismidi interesse enologico (lieviti, batteri e muffe) e la loro evoluzio-ne in aria di una cantina. In questo studio i lieviti isolati dall’ariaappartenevano sia al genere Saccharomyces che al gruppo deinon-Saccharomyces. Il presente lavoro ha valutato la biodiversità dei lieviti coinvoltinel processo di produzione di vino spumante in Franciacorta edOltrepò Pavese durante le annate 2009, 2010 e 2011, dall’ariadel vigneto, da mosto allo sgrondo (prima dell’aggiunta di SO2)e in vino base. Le caratteristiche dei lieviti selezionati per l’otte-nimento di un vino base spumante non differiscono da quelledei lieviti utilizzati per la vinificazione di altri vini. Tuttavia, ceppiparticolari possono essere selezionati e utilizzati per esaltare ca-ratteristiche aromatiche attraverso la scelta di specifiche attivitàenzimatiche. I lieviti utilizzati per la produzione di spumanti otte-nuti secondo il Metodo Classico devono però possedere uno svi-luppo di tipo flocculante e capacità di autolisarsi. La floccula-zione è un processo di auto-aggregazione tra le cellule di lievitoche porta alla formazione di masse multicellulari (fiocchi), che
  • 20. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… sedimentano velocemente nei mezzi liquidi in cui sono sospese o galleggiano (“flottano”), a seconda delle dimensioni e della for- ma del fiocco. Lo sviluppo in aggregati accelera la separazione spontanea delle due fasi, per questo è preferibile utilizzare lieviti flocculanti per la rifermentazione in bottiglia: in questo modo le cellule depositandosi e non disperdendosi, sono più facilmen- te eliminate durante la seconda fermentazione e nella fase di sboccatura o dégorgement. La capacità delle cellule di autoli- sare e la conseguente liberazione nel vino di mannoproteine e acidi grassi è fondamentale sia per il conferimento di specifiche peculiarità sensoriali, sia per la stabilità proteica e anche per le caratteristiche del “perlage” (Vincenzini, 2005). 2.2 Materiali e Metodi 2.2.1 Campionamento e tecniche colturali22 Lo studio è stato condotto durante le vendemmie 2009, 2010 e 2011 nei territori vitivinicoli lombardi di Franciacorta (Brescia) ed Oltrepò Pavese (Pavia). Per ogni anno, i campionamenti sono avvenuti nel mese di Luglio, Agosto ed Ottobre in corrispondenza con l’inizio della invaiatura dell’uva, il tempo della vendemmia e la produzione del vino base. Il piano di campionamento ha coin- volto: 13 vigneti e 8 cantine per la Franciacorta, e 11 vigneti e 11 cantine per l’Oltrepò Pavese. Campionamento dell’aria I campionamenti dell’aria sono stati realizzati durante il mese di Luglio e/o comunque quando il processo di invaiatura, con il quale inizia la maturazione delle bacche, era già abbastanza avanzato. Si ricordi che gli insetti sono i principali vettori di funghi. I campionamenti sono stati effettuati tramite l’utilizzo del cam- pionatore d’aria “SAS SUPER IAQ”, (Figura 2.2) con cui è possibile eseguire prove di tipo microbiologico, essendo dotato di suppor- to per piastra Petri.
  • 21. Capitolo 2. Indagine sull’ecologia di lieviti enologici in Franciacorta ed Oltrepò PaveseFigura 2.2 Air Sampler “MAS 100 Eco” di VWR International utilizzato per il campiona-mento. La piastra viene posta nell’apposito supporto, priva di coper-chio, con il terreno colturale rivolto verso la parte forata dell’ap-parecchio. Da quest’ultima, costruita in acciaio e disinfettataprima di ciascun campionamento con alcol etilico, si effettua l’a-spirazione dell’aria che andrà ad impattare, con quanto in essaeventualmente disperso (microrganismi, spore) sul terreno nutriti- 23vo della piastra. Questo campionatore permette il prelevamen-to di precisi volumi, quindi l’ottenimento di risultati non soltantoqualitativi, ma anche quantitativi. Durante il campionamento lostrumento veniva trasportato manualmente tra i filari mantenen-dolo ad una distanza di circa 30 cm dalle piante e di 1-1,20 mdal suolo (in corrispondenza dei grappoli). Per ogni anno, gli stessivigneti (tredici in Franciacorta e undici in Oltrepò Pavese) sonostati analizzati e, in ogni vigneto, due aliquote da 100 e 500 litridi aria ciascuno, replicate per due volte sono stati raccolti per lesuccessive analisi microbiologiche. L’isolamento dei lieviti è statoeffettuato utilizzando il terreno colturale YEPD [1% (w/v) Estratto dilievito, 2% (w/v) Peptone, 2% (w/v) Glucosio] addizionato con 2%agar e modificato nelle seguenti caratteristiche: pH 3,6, 200 mg/LK2S2O5 e 100 mg/L cloramfenicolo. Le piastre, ottenute dal cam-pionamento dell’aria, sono state incubate a 25°C in condizionianaerobiche (Microbiologie Anaerocult®A; Merck, Darmstadt,Germania) per 5 giorni. Questa modifica è stata effettuata perevitare la crescita di muffe.
  • 22. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… Campionamento del mosto Il campionamento del mosto è stato eseguito a partire da metà del mese di Agosto, ed è proseguito fino ai primi giorni del mese successivo, in funzione dei diversi tempi di raccolta. I campioni sono stati prelevati, quando possibile, direttamente dalla pressa con l’ausilio di pipette sterili, altrimenti dalle vasche di raccolta poco dopo la pressatura, in entrambi i casi sempre prima che ve- nisse effettuato qualsiasi tipo di trattamento, solfitazione in parti- colare. Le aliquote prelevate, due da 50 mL ciascuna, sono state conservate in beute sterili e mantenute a 2-4°C fino al momento dell’analisi. Queste beute erano dotate di un tappo in silicone forato per permettere l’inserimento di un puntale, sterile e dotato di filtro a porosità 0,22 μm, al fine di consentire lo scambio gasso- so (liberazione della CO2 eventualmente formatasi in caso di fer- mentazione della matrice) mantenendo le condizioni di sterilità, quindi impedendo la contaminazione da parte di microrganismi esterni. I campioni di mosto sono quindi stati opportunamente24 diluiti e piastrati su una piastra precedentemente preparata con terreno Wallerstein Laboratory Nutrient Agar (WL) (Merck, Ger- mania). Le analisi sono state eseguite in doppio. Successivamen- te un’aliquota di mosto (5 mL) è stata prelevata e trasferita in una beuta contenente 45 mL di brodo “YEPD selettivo” e l’insieme è stato messo ad incubare ad una temperatura di 25°C per 72-96 h in aerobiosi. Campionamento del vino base Il campionamento del vino base è stato eseguito approssimati- vamente verso la seconda metà del mese di Ottobre; il prodotto è stato prelevato (per ciascun campione sono state acquisite due aliquote da 10 mL ognuna) dalle vasche nelle quali ha fermenta- to ed è stato trasferito in provette sterili con tappo a vite per poter essere trasportato, previa refrigerazione e mantenimento a 2-4°C. Da ogni campione è stata allestita una serie di opportune dilui- zioni decimali in acqua peptonata che sono poi state piastrate su agar WL e messe ad incubare a 25°C per 72-96 h in aerobiosi. Conta in piastra I campioni di mosto e vino base sono stati opportunamente diluiti con acqua peptonata e 0,1 mL delle diluizioni sono stati se-
  • 23. Capitolo 2. Indagine sull’ecologia di lieviti enologici in Franciacorta ed Oltrepò Paveseminati, per spatolamento, in piastre contenenti terreno agar WL.Le piastre sono state poi messe ad incubare a 25° C per 72-96 hper permettere il completo sviluppo delle colonie. Il numero del-le unità formanti colonia (UFC) si ottiene applicando la formuladella media ponderale: ∑c UFC/mL = ( 1 x n1 + 0.1 x n2) x d1 dove: c: numero di colonie delle piastre contabili; n1: numero di piastre della prima diluizione considerata contabile; n2: numero di piastre della seconda diluizione considerata con-tabile; d1: fattore di diluizione relativo alla prima diluizione considerata 25contabile; Si considerano contabili le piastre che presentano tra 10 e 300UFC.Allestimento della collezione di lievito Dopo un un primo striscio della colonia interessata e succes-siva incubazione a 25°C per 3 giorni, si è effettuato un secon-do striscio per assicurarsi della purezza della coltura e succes-siva incubazione a 25°C per 3 giorni. Tutti gli isolati così ottenutisono allora stati preparati per la conservazione in modo stabi-le a -80°C inoculando una colonia isolata dal secondo striscioin brodo YEPD a 25°C per 48-72 h. Verificata l’uniformità dellecolonie e l’assenza di contaminazione al microscopio, e quindil’effettiva purezza della coltura, si è centrifugato a 3500 g per 15minuti (Hettich Zentrifugen, rotina 380r), eliminato il surnatante,risospeso con brodo YEPD addizionato con 20% (v/v) di glice-rolo. Si è quindi in ultimo distribuito in provette e conservate a-80°C.
  • 24. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… 2.2.2 Tecniche molecolari Estrazione del DNA genomico Il protocollo per l’estrazione degli acidi nucleici da lievito utiliz- zato in questo lavoro è stato quello proposto da Querol (1992). In breve, le cellule sono state coltivate overnight in YEPD aggiunto di 0,1 g/Ll di cloramfenicolo. La coltura è stata centrifugata a 3500 rpm (Zentrifugen Hettich, Rotina 380r, Germania) per 15 min. Il pellet è stato sospeso in 500 μL di una soluzione contenente 0,9 M sorbitolo-EDTA 0,1 M, pH 7,5 a cui sono stati aggiunti 500 mg/ mL di zymolyase 100T (USBiological, USA) e 14mM ß-mercapto- etanolo. Le provette sono state incubate a 37°C per 60 min per lisare la parete cellulare. Gli sferoplasti così ottenuti sono stati centrifugati a 3500 g (Hettich Zentrifugen, Mikro 200, Germania) per 15 min e il pellet è stato sospeso in 0,5 mL di Tris-HCl 0,05 M, 0,02M EDTA pH 7,5. Dopo risospensione, 0,05 mL di sodio dodecil solfato (SDS) al 10% stato aggiunto e la miscela è stata incubata26 a 65°C per 30 min. Subito dopo, 0,2 mL di acetato di potassio 5 M è stato aggiunto e le provette sono state poste in ghiaccio per 30 min. Il lisato è stato quindi centrifugato a 14000 g in una per 5 min. I surnatanti sono stati trasferiti in provette nuove ed il DNA è stato precipitato mediante aggiunta di 1 volume di iso- propanolo. Le provette sono state nuovamente centrifugate a 14000 g per 10 min. Il DNA è stato lavato con etanolo al 70%, e poi centrifugato a 14000 g per 5 min. Il pellet è stato essiccato a 50°C per 15 min, dissolto in 50 μL di TE (10 mM Tris-HCl, 1 mM EDTA, pH 7,5) e mantenuto a 4°C per 12 h. L’estratto è stato trattato con 0,5 mg/mL RNasi (Fermentas, Lituania) a 37°C per 30 min. Infine, il DNA è stato conservato a -20°C. La concentrazione e la purezza di DNA è stata determinata misurando l’A260nm e l’A280nm. Amplificazione delle regione ribosomiale ITS1-5.8S-ITS2 L’amplificazione degli spaziatori interni (Internal Transcribed Spacer) compresi tra i geni 18S e 26S rDNA (ITS1-5.8S-ITS2) è stata eseguita in una miscela di 25 μL di reazione contenente: 1X di tampone (5 Prime, Amburgo), 2,5 mM di MgCl2 (5 Prime, Ambur- go), 200 mM di dNTPs (Fermentas, Lituania), 0,5 μM dei primers ITSL1 (5’GTTTCCGTAGGTGAACCTGC3’) e ITSL2 (5’ ATATGCTTA-
  • 25. Capitolo 2. Indagine sull’ecologia di lieviti enologici in Franciacorta ed Oltrepò PaveseAGTTCAGCGG-GT 3’) (Montrocher, 1998), 2 U di Taq DNA poli-merasi (5 Prime, Amburgo) e 80 ng di DNA. Dopo una fase inizialedi denaturazione del DNA a 95°C per 5 min, sul termociclatore(Eppendorf,) è stato impostato il seguente ciclo termico cheveniva ripetuto per 35 cicli: denaturazione del DNA a 95°C per5 min, appaiamento a 50°C per 1 min, estensione della doppiaelica di DNA a 72°C per 1 min. Al termine dell’amplificazione èstata effettuata una fase di estensione finale a 72°C per 5 minal fine di permettere alla polimerasi di terminare le reazioni. Gliamplificati sono quindi stati controllati in elettroforesi su gel diagarosio 1% (w/v) in tampone TAE 1X (40 mM Tris-acetato, pH8,2, 1 mM EDTA), 0,4 μg/mL di bromuro di etidio. Le immaginisono state acquisite con un transilluminatore UV GelDoc (Bio-Rad, Hercules, CA, USA).Analisi di restrizione delle ITS (ITS-RFLP) Successivamente, i prodotti di PCR sono stati sottoposti adanalisi di restrizione al fine di valutare i possibili polimorfismi ge- 27netici (ITS-RFLP). Il protocollo utilizzato è stato quello descritto daEsteve-Zarzoso (1999) dove l’enzima CfoI è stato sostituito dall’i-soenzima di restrizione Hin6I (Fermentas, Lituania). I profili di re-strizione sono stati separati e visualizzati su gel di agarosio 1,5%(w/v) in tampone TAE 1X, 0,4 μg/mL di bromuro di etidio. Gli isolatiche mostravano lo stesso profilo genetico sono stati raggruppatie circa il 10% di isolati di ogni cluster è stato sottoposto ad ampli-ficazione e parziale sequenziamento del dominio D1/D2 del 26SrDNA.Analisi di sequenza del dominio D1/D2 del 26S rDNA Le reazioni di amplificazione sono state effettuate in una mi-scela di 25 μL contenente 1X tampone (5 Prime, Amburgo), 2,5mM di MgCl2 (5 Prime, Amburgo), 200 mM di dNTPs (Fermentas,Lituania), 0,1μM dei primers NL1 (5’GCATATCAATAAG-CGGAG-GAAAAG3’) e NL4 (5’GGTCCGTGTTTCAAGACGG3’) (Kurtzman,1998), 2 U di Taq DNA polimerasi (5 Prime, Amburgo) e 80 ng diDNA. Dopo la fase di denaturazione iniziale a 94°C per 5 min, ilprofilo di temperatura è stato ripetuto per 35 cicli: denaturazio-ne a 94°C per 1 min, appaiamento a 52°C per 1 min, ed esten-sione a 72°C per 2 min. Al termine dell’amplificazione è stata ef-
  • 26. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… fettuata una fase di estensione finale a 72°C per 5 min. I prodotti di amplificazione sono stati controllati tramite elettroforesi in gel di agarosio 1.0% (w/v), in tampone di TAE 1X, 0,4 μg/mL di bro- muro di etidio e visualizzati con un transilluminatore UV GelDoc (Bio-Rad, Hercules, CA, USA). I prodotti di PCR sono quindi stati sottoposti a sequenziamento (Primm srl Milano, Italia) e le strin- ghe nucleotidiche sono state confrontate mediante algoritmo BLAST con le sequenze parziali del 26 rDNA delle specie depo- sitate nei databases dell’NCBI (http://blast.ncbi.nlm.nih.gov/). L’attribuzione di un microrganismo ad una specie tiene in consi- derazione due percentuali risultanti dal confronto: la copertura e l’identità. Quando questi parametri sono pari o superiori al 97% può avvenire il riconoscimento a livello di specie. Discriminazione tra le specie S. cerevisiae, S. bayanus e S. pasto- rianus Un’ulteriore analisi è stata condotta su tutti gli isolati di lievito28 identificati come appartenenti alla specie S. cerevisiae tramite l’impego delle tecniche ITS-RFLP e l’analisi della sequenza del gene 26S rDNA. Questa attività si è resa necessaria in quanto queste tecniche potrebbero erroneamente classificare come S. cerevisiae alcuni isolati invece appartenenti alla specie S. ba- yanus o S. pastorianus. Infatti, essendo queste specie filogene- ticamente molto vicine a S. cerevisiae e comprese nel gruppo dei S. cerevisiae sensu stricto, esse mostrano caratteristiche me- taboliche tali da permettere loro la crescita e sopravvivenza in vino. Per l’amplificazione sono stati utilizzati i primers costruiti sul gene HO e descritti da De Melo Pereira (2010). La singola colo- nia è stata dissolta direttamente nella miscela di reazione ed è stato effettuato un trattamento di rottura cellulare a 95°C per 30 min. La reazione di PCR per la discriminazione di S. cerevi- siae da S. pastorianus è stata condotta in una miscela di 25 μL contenente 1X tampone (5 Prime, Amburgo), 2,5 mM di MgCl2 (5 Prime, Amburgo), 200 μM di dNTPs (Fermentas, Lituania), 0,5 μM dei primers ScHO-F (5’GTTAGATCCCAGGCGTAGAACAG3’) e ScHO-R (5’GCGAGTACTGGACCAAATCTTATG3’), 1 U di Taq- DNA polimerasi (5 Prime, Amburgo). Dopo una denaturazione iniziale del DNA a 94°C per 5 min, il ciclo termico è stato ripe- tuto per 35 cicli e prevedeva: 94°C per 30 sec, 61°C per 30 (S.
  • 27. Capitolo 2. Indagine sull’ecologia di lieviti enologici in Franciacorta ed Oltrepò Pavesecerevisiae)/55°C (S. pastorianus) sec e 72°C per 2 min. Un’ul-teriore step di estensione finale a 72°C per 7 min è stata effet-tuata. La reazione di PCR per l’identificazione di S. bayanus èstata condotta nelle medesime condizioni sopra descritte maimpiegando i primers LgHO-F (5’TGGAAAGTCTACGAGAACA-AGCC3’) e LgHO-R (5’CCTCTATGTGAAGTCCGTATACTG3’) contemperatura di appaiamento a 55°C. L’elettroforesi è stata ese-guita in 0,8% (p/v) su gel di agarosio in TAE 1X tampone trattatacon 0,4 ug/mL di bromuro di etidio. I prodotti di PCR sono statifotografati sotto transilluminatore UV GelDoc (Bio-Rad, Hercules,CA, USA).2.3 Risultati e Discussione2.3.1 Collezione di ceppi di lievito Nel corso di questo studio è stato possibile creare una col-lezione di colture di lievito composta da 493 isolati riscontrati 29e coinvolti nel processo di vinificazione nei territori lombardi diFranciacorta (Brescia) ed Oltrepò Pavese (Pavia) nelle anna-te 2009, 2010, 2011 e provenienti da aria, mosto e vino base(Tabella 2.2). Attualmente, questi lieviti sono conservati a -80°Cpresso i laboratori del Dipartimento di Scienze per gli Alimenti,la Nutrizione e l’Ambiente (DeFENS) dell’Università degli Studi diMilano. I risultati riguardanti il campionamento dell’aria del vignetohanno mostrato che, sebbene il prelievo sia stato effettuato du-rante la maturazione dell’uva quando la circolazione degli inset-ti in vigneto era presente e assai favorita dalle condizioni clima-tiche, le percentuali di isolamento raggiungevano valori moltobassi e compresi tra 0-2% per entrambi i territori analizzati. Il cam-pionamento dell’aria presso i vigneti non trova molti precedentiin bibliografia: un recente lavoro svolto nella regione spagnoladella Rioja nel 2006 ha previsto, tra gli altri, il campionamento diaria per verificare la presenza di lieviti batteri e muffe, ma all’in-terno della cantina. Nel lavoro citato è stata rilevata la presenzadi molte muffe mentre lieviti e batteri in minore quantità e nonprima dell’inizio della prima fermentazione alcolica e malolatti-ca, rispettivamente (Garijo, 2008).
  • 28. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… Vendemmia e Origine Numero di isolati Percentuale di isola- mento 2009 178 36% Franciacorta 95 19% ARIA 8 2% MOSTO 39 8% VINO BASE 48 10% Oltrepò Pavese 83 17% ARIA 9 2% MOSTO 22 4% VINO BASE 52 11% 2010 186 38% Franciacorta 112 23% MOSTO 91 18% VINO BASE 21 4% Oltrepò Pavese 74 15% ARIA 3 1%30 MOSTO 56 11% VINO BASE 15 3% 2011 129 26% Franciacorta 58 12% MOSTO 35 7% VINO BASE 23 5% Oltrepò Pavese 71 14% ARIA 6 1% MOSTO 42 9% VINO BASE 23 4% Totale 493 100% Tabella 2.2 Lieviti isolati nel corso di 3 annate in Franciacorta (FCR) ed Oltrepò Pavese (OLT). I campioni di mosto sono stati raccolti allo sgrondo e prima dell’aggiunta di solforosa. Questi criteri sono stati adottati al fine di valutare la biodiversità interspecifica dei lieviti presenti sui due territori. Perché l’isolamento fosse rappresentativo del microbiota presente sull’uva, le colonie di lievito crescite dopo l’incubazione sono state isolate previa osservazione microscopica cellulare e macroscopica della forma e colore delle colonie. Quest’ultima
  • 29. Capitolo 2. Indagine sull’ecologia di lieviti enologici in Franciacorta ed Oltrepò Paveseoperazione era facilitata dall’uso del terreno colturale WL (Wal-lerstein Laboratory Nutrient Agar) (Green e Grey, 1950) che, sep-pur non selettivo, consente di ottenere informazioni utili attraversole variazioni di colore assunte dalle colonie. Infatti, esso contieneverde di bromocresolo, un indicatore di pH in grado di mettere inevidenza la capacità di acidificazione, e quindi le caratteristichedei prodotti finali del metabolismo primario, in relazione alle diver-se specie di lievito (Figura 2.3). 31Figura 2.3 Tipica morfologia e colorazione delle colonie di S. cerevisiae in crescita suterreno WL Agar. Le maggiori percentuali di isolamento da campioni di mostoderivano dalla vendemmia 2010 dove è stato raggiunto un va-lore del 18% per la Franciacorta e del 11% per l’Oltrepò Pavese.E’ stato invece il 2009 l’anno in cui sono stati raccolti più isolatida vino base (10% in Franciacorta e 11% in Oltrepò Pavese). Lecolonie riscontrate durante l’isolamento presentavano morfolo-gie differenti: la forma è risultata generalmente tondeggiante ela colorazione, per gran parte delle colonie, variava dal bianco,al bianco a punta verde, al verde chiaro fino al verde scuro. Nelmaggior numero degli isolati l’aspetto era liscio, seppur in qual-che situazione siano state osservate colonie dall’apparenza rugo-sa. Alcuni isolati presentavano una consistenza farinosa, mentrela maggior parte figuravano cremosi. Le colonie di colorazionerosa-lucide hanno consentito un’identificazione diretta dell’isola-to come appartenente al genere Rhodotorula. I dati riguardantila carica microbica riscontrata dalle piastre di mosto tal qualeindicano una concentrazione che si aggirava mediamente at-torno alle 105-106 UFC/mL. Il campionamento e l’isolamento di mi-
  • 30. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… crorganismi dal vino base è stato eseguito nel mese di Ottobre. Per alcune cantine la percentuale di isolamento è risultata molto bassa e la concentrazione cellulare risultava < 103 UFC/mL con campioni talvolta intorno a10 UFC/mL. Questo risultato era dovu- to al fatto che il prelievo, per ragioni tecniche, veniva realizzato dall’alto delle vasche senza agitazione e a fine fermentazione alcolica la massa cellulare risultava ormai decantata sul fondo. In generale, per quanto riguarda il numero totale di lieviti otte- nuti da aria, mosto e vino base, è stata osservata una differenza sia temporale (2009, 2010, 2011) che geografica (Franciacorta ed Oltrepò Pavese). L’annata 2011 è risultata quella durante la quale è stato isolato il minor numero di lieviti (26%), infatti per entrambi i territori si è registrata una diminuzione del numero di isolati del 10% rispetto al 2009 e del 12% nel 2010. L’area francia- cortina ha maggiormente contribuito a questo decremento; in particolare, la maggiore diminuzione nel numero di isolamenti è stato ottenuta dal campionamento del mosto. La scarsa quan-32 tità e diversità di isolati di lievito raccolti potrebbe essere stata causata dalle negative condizioni meteorologiche che hanno caratterizzato il periodo precedente il campionamento. Di seguito è riportata la distribuzione degli isolati prelevati nei mosti e nei vini base per tutte le cantine e suddivisi per territorio (Figura 2.4) Figura 2.4 Numero di lieviti isolati (n) collezionati durante le annate 2009-2010-2011 a) nella zona di Franciacorta; b) nella zona dell’Oltrepò Pavese.
  • 31. Capitolo 2. Indagine sull’ecologia di lieviti enologici in Franciacorta ed Oltrepò Pavese2.3.2 Biodiversità interspecifica L’identificazione di tutti e 493 isolati di lievito è stata ottenutaeffettuando in sequenza:1. Amplificazione delle regioni ITS1-5.8S-ITS2 (Internal Transcribed Spacers) (Figura 2.5);2. Digestione degli amplificati con enzima Hin6I (Figura 2.5);3. Costituzione di cluster in base ai profili di restrizione ottenuti;4. Conferma dei cluster attraverso una seconda digestione con enzima HaeIII di circa il 25% degli isolati di ciascun gruppo;5. Sequenziamento del gene 26S rDNA di circa il 10% degli isolati di ciascun cluster. 33Figura 2.5 Esempio di corsa elettroforetica in gel di agarosio: a) dei prodotti di amplifi-cazione delle regioni ITS1-5.8S-ITS2 di alcuni isolati da mosto (sopra). M: Marker 100 bp(5 Prime, Amburgo); 1: Metschnikowia pulcherrima - Controllo positivo; 2: Hanseniaspo-ra spp. - Controllo positivo; 3: Schizosaccharomyces pombe - Controllo positivo; 4: Rho-dotorula spp. - Controllo positivo; 5: Zygosaccharomyces bailii - Controllo positivo; 6:Saccharomyces cerevisiae - Controllo positivo; 7: Issatchenkia spp. - Controllo positivo;8: Saccharomyces bayanus – Controllo positivo; 9: Dekkera spp. - Controllo positivo;10: Controllo negativo; 11-22: campioni da mosto. b) dei prodotti di digestione conenzimi di restrizione specifici (RFLP, enzima Hin6I) degli ampliconi ITS1-5.8S-ITS2 (sotto). M:Marker 100 bp (5 Prime, Amburgo); 1: Metschnikowia pulcherrima - Controllo positivo;2: Hanseniaspora spp. - Controllo positivo; 3: Schizosaccharomyces pombe - Controllopositivo; 4: Rhodotorula spp. - Controllo positivo; 5: Zygosaccharomyces bailii - Con-trollo positivo; 6: Saccharomyces cerevisiae - Controllo positivo; 7: Issatchenkia spp.- Controllo positivo; 8: Saccharomyces bayanus – Controllo positivo; 9: Dekkera spp.- Controllo positivo; 10: pozzetto vuoto; 11-22: campioni da mosto; 23: pozzetto vuoto.
  • 32. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… L’attribuzione della specie per il gruppo S. cerevisiae sensu stricto si è conclusa con la verifica di una specifica tecnica PCR proposto da De Melo Pereira et al. (2010). Il protocollo è rapido e semplice ed è in grado di discriminare S. cerevisiae da S. ba- yanus e S. pastorianus. Tutti gli isolati di lievito che venivano clas- sificati come S. cerevisiae tramite ITS-RFLP e analisi del 26S rDNA dunque sono stati anche sottoposti ad identificazione attraverso l’amplificazione del gene HO. La Figura 2.6 mostra un esempio del prodotto di PCR per al- cuni isolati; l’amplicone caratteristico per S. cerevisiae ha una lunghezza di 400 bp.34 Figura 2.6 Gel di agarosio 0,8% del amplificazione usando i primers specifici del gene HO di S. cerevisiae ScHO-F/ScHO-R. M: peso molecolare del DNA (GeneRuler 100 bp DNA Ladder, Fermentas, Italia); 1: S. cerevisiae (Institut Œnologique de Champagne; Collection de Levures d’intérêt Biotechnologique IOC 18-2007); 2-18: isolati di S. cere- visiae. Per quanto riguarda il campionamento dell’aria è stato possi- bile collezionare 26 isolati in tutto suddivisi in 6 differenti specie di lievito (Tabella 2.3). La più alta percentuale di isolati da aria, du- rante l’intero progetto triennale, è stata ottenuta dal prelievo del 2009 (65%). In Figura 2.7 e Figura 2.8 sono mostrate le percentuali di isolamento delle diverse specie di lievito e la loro distribuzione nelle tre annate. Il dato più interessante del campionamento ri- guarda il ritrovamento di S. cerevisiae (35% del totale degli isolati raccolti) nei campioni d’aria analizzati per le tre annate conse- cutive dallo stesso territorio. Inoltre, altre specie ambientali come Aureobasidium pullulans, Cryptococcus laurentii. Issatchenkia
  • 33. Capitolo 2. Indagine sull’ecologia di lieviti enologici in Franciacorta ed Oltrepò Paveseterricola e Rhodotorula glutinis vengono isolate con percentua-li tra il 19-8%. Pichia fermentans e Rhodotorula nothofagy sonostate singolarmente isolate da campioni d’aria del 2010 e 2011.In particolare, nella zona di Franciacorta l’isolamento di lieviti èstato possibile solo nel corso del 2009. Vendemmia e Origine Numero di lieviti (n) Percentuale (%) 2009 17 65 Franciacorta 8 31 A. pullulans 4 15 C. laurentii 4 15 Oltrepò Pavese 9 35 S. cerevisiae 7 27 A. pullulans 1 4 I. terricola 1 4 2010 3 12 35 Oltrepò Pavese 3 12 S. cerevisiae 1 4 I. terricola 1 4 P. fermentans 1 4 2011 6 23 Oltrepò Pavese 6 23 S. cerevisiae 1 4 R. glutinis 4 15 R. nothofagi 1 4 Totale 26 100%Tabella 2.3 Identificazione degli isolati di lievito ottenuti dal campionamento dell’aria inFranciacorta (FCR) e Oltrepò Pavese (OLT), nel corso di tre annate.
  • 34. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico…36 Figura 2.7 Biodiversità osservata nei campioni di aria in Franciacorta e Oltrepò Pavese nel corso di tre annate. Figura 2.8 Distribuzione di isolamento e permanenza delle diverse specie di lievito isola- te da aria in Franciacorta ed Oltrepò Pavese nel corso di tre annate.
  • 35. Capitolo 2. Indagine sull’ecologia di lieviti enologici in Franciacorta ed Oltrepò Pavese Il campionamento del mosto ha portato all’isolamento di sva-riate specie di lievito. In totale, sono stati collezionati 285 isola-ti suddivisi in 25 differenti specie (Figura 2.9). I dati riguardantila loro identificazione genetica sono presentati in Tabella 2.4.L’annata 2010 è stata quella durante la quale è stato raccoltoil maggior numero di isolati da mosto con un totale di 147 lieviti,pari al 52% del totale, raccolti durante le tre annate su entrambii territori analizzati. E’ stato proprio durante questo campiona-mento, inoltre, che si è potuta osservare la più alta biodiversitàin termini di specie di lievito collezionate; 19 diverse specie sonostate isolate, tra cui S. cerevisiae corrispondeva alla più alta per-centuale (44 isolati, circa 40% del totale dei S. cerevisiae isoal-ti da mosto nel triennio). Metschnikowia fructicola e Candidarailenensis, con il 10% ed il 9% rispettivamente, raggiungevanola seconda e la terza maggiore incidenza percentuale. In par-ticolare, S. cerevisiae, Torulaspora delbrueckii ed Issatchenkiaterricola erano specie presenti su entrambe le aree, mentreMetschnikowia fructicola, Hanseniaspora uvarum, Issatchenkia 37occidentalis, Pichia anomala, Rhodotorula spp, Pichia ku-driavzevii, Pichia kluyveri, Zygoascus spp, Candida zemplinina,Candida parapsilosis, Cryptococcus flavescens e Pichia guillier-mondii erano specie presenti solo nella zona della Franciacorta.Invece, Candida railenensis, Pichia fermentans, Hanseniasporauvarum, Issatchenkia terricola, Metschnikowia pulcherrima e Pi-chia membranifaciens erano ritrovate solo in Oltrepò Pavese.Infine, delle 19 specie identificate nel 2010, 8 specie venivanoisolate solamente durante questa annata (Candida parapsi-losis, Candida railenensis, Cryptococcus flavescens, Pichia fer-mentans, Pichia guilliermondii, Pichia kudriavzevii, Rhodotorulaspp, Zygoascus spp). Altre specie di lieviti, diversi rispetto a quelli già noti, sono sta-ti isolati nel corso della vendemmia 2009: Zygosaccharomycesbailii, comunemente presente in entrambe le aree e Candidadiversa isolata solo in Oltrepò Pavese. Inoltre, entrambe questespecie si ritrovavano solamente nei mosti del 2009. Per quanto ri-guarda gli isolati del 2011, Kluyveromyces thermotolerans è statoper la prima volta isolato da entrambi i territori con una percen-tuale del 1,5%, Hanseniaspora vineae (1,8%) e Candida oleophi-la (0,4%) rappresentavano anch’esse nuovi isolamenti della sola
  • 36. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… Franciacorta, mentre Pichia fluxum (0,6%) è stato un nuovo isola- mento per l’Oltrepò Pavese. Per quanto riguarda la permanenza di specie di lievito in cam- pioni di mosto nel corso dei tre anni sui due territori, solo poche specie sono state riscontrate in annate successive. In particolare, il solo S. cerevisiae in Franciacorta e S. cerevisiae e H. uvarum in Oltrepò Pavese, si sono dimostrate specie stabilmente presenti sulle aree (Figura 2.10). Come riportato da Jolly (2003) i lieviti presenti nel mosto pos- sono essere suddivisi in due gruppi: uno rappresentato dai “lie- viti vinari” del genere Saccharomyces, l’altro comprendente i non-Saccharomyces. I lieviti Saccharomyces sono presenti, seb- bene in basso numero, anche sui grappoli, ma derivano prin- cipalmente dalle attrezzature di cantina (Vaughan-Martini & Martini, 1995; Boulton, 1996; Martini, 1996), e vengono trasferi- ti al mosto durante la pressatura (Peynaud e Domercq, 1959;38 Lonvaud-Funel, 1996; Török, 1996; Mortimer e Polsinelli, 1999). Un’ ulteriore fonte di Saccharomyces, può essere data dalle colture starter addizionate dall’enologo. I lieviti non-Saccharomyces, si ritrovano abbondantemente sui grappoli (Martini, 1996) e pri- ma dell’inoculo con uno starter: sono i lieviti presenti in mag- gior misura nel mosto. La popolazione di non-Saccharomyces presente sui grappoli risulta molto variabile: sono stati ritrovati isolati appartenenti ai generi Brettanomyces, Candida, Cryp- tococcus, Hanseniaspora, Kloeckera, Kluyveromyces, Pichia, Rhodotorula, Torulaspora (Ribéreau-Gayon, 1985; Fleet e Heard, 1993; Pretorius, 1999; Pramateftaki, 2000; Clemente-Jiménez, 2004; Chavan, 2009). I risultati ottenuti sono in disaccordo con quanto ritrovato da Ocón (2010) indagando la presenza di lieviti non-Saccharomyces sulle superfici e sulle strumentazioni della cantina e nel mosto. L’elevata variabilità di specie ascrivibili ai generi Candida, Cryptococcus, Pichia, Zygosaccharomyces, Torulaspora e Rhodotorula da loro rilevata su superfici e attrez- zature è stata qui invece osservata nel mosto. Non essendo stati effettuati campionamenti per indagare eventuale microflora presente sulle superfici delle strutture e delle attrezzature, non si può essere certi della reale provenienza degli isolati ricono- sciuti: essi potrebbero essere indigeni del mosto, quindi derivare
  • 37. Capitolo 2. Indagine sull’ecologia di lieviti enologici in Franciacorta ed Oltrepò Pavesedai grappoli, oppure frutto della contaminazione di quest’ulti-mo con la microflora presente in cantina, per fermentazioni giàavviate, o perché comunque presenti sulle attrezzature (pressee pompe in particolare) (Phaff e Knapp, 1956; Lachance, 1994;Mortimer e Polsinelli, 1999). Complessivamente l’analisi del mo-sto ha portato all’isolamento di 285 colonie di lievito, di cui soloil 32% risultate appartenenti alla specie S. cerevisiae. In accordocon quanto riportato in bibliografia, la maggior parte della po-polazione micetica rilevata nel mosto, apparteneva al grupponon-Saccharomyces (68%). Di particolare interesse risulta l’isola-mento della specie I. terricola che raramente è stata isolata damosto o vino in fermentazione (Sabate, 2002; Di Maro, 2007) edè stata associata ad una bassa capacità fermentativa ed ele-vata produzione di acetato d’etile, determinando la formazio-ne di off-flavours (Clemente-Jimenez, 2004). Le minori citazioni inbibliografia riguardo la specie C. zemplinina sono da attribuirealla sua recente descrizione (Sipiczki, 2003) e distinzione da C.stellata. Entrambi sono lieviti “fruttosofili”, ma la maggior espres- 39sione di tale caratteristica in C. zemplinina ha indotto un piùapprofondito studio riguardo al suo sviluppo per una potenzialericonsiderazione della specie per il controllo delle fermentazioni.Ciò sarebbe particolarmente interessante per la produzione divini ottenuti da uve botritizzate, sulle quali queste specie sonospesso ritrovate (Magyar e Tóth, 2011). Alcuni autori (Csoma eSipiczki, 2008) ritengono che sia Candida zemplinina invece diCandida stellata a trovarsi sui grappoli e nelle fermentazioni deimosti, e suggeriscono che le due specie potrebbero essere statespesso confuse nelle prime pubblicazioni; in effetti, le pubblica-zioni più recenti sulla microflora vinaria, e come anche risultatoin questo studio, riportano soltanto la presenza di C. zemplinina,senza rilevare popolazioni di C. stellata (Nisiotou, 2007; Lopan-dic, 2008; Tofalo, 2009).
  • 38. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… Vendemmia e Origine Numero di isolati (n) Percentuale (%) 2009 61 21,4 Franciacorta 39 13,7 S. cerevisiae 22 7,7 Zygosaccharomyces bailii 11 3,9 Issatchenkia occidentalis 6 2,1 Oltrepò Pavese 22 7,7 S. cerevisiae 14 4,9 Zygosaccharomyces bailii 4 1,4 Issatchenkia terricola 1 0,4 Candida zemplinina 1 0,4 Candida diversa 1 0,4 Hanseniaspora uvarum 1 0,4 2010 147 51,6 Franciacorta 91 31,9 S. cerevisiae 27 9,5 Metschnikowia fructicola 15 5,3 Hanseniaspora uvarum 13 4,6 Pichia kluyveri 10 3,5 Issatchenkia occidentalis 5 1,8 Issatchenkia terricola 5 1,8 Torulaspora delbrueckii 4 1,440 Pichia anomala 3 1,1 Pichia kudriavzevii 2 0,7 Rhodotorula spp 2 0,7 Candida parapsilosis 1 0,4 Candida zemplinina 1 0,4 Zygoascus spp 1 0,4 Pichia guilliermondii 1 0,4 Cryptococcus flavescens 1 0,4 Oltrepò Pavese 56 19,6 S. cerevisiae 17 6,0 Candida railenensis 14 4,9 Torulaspora delbrueckii 6 2,1 Pichia fermentans 5 1,8 Hanseniaspora uvarum 4 1,4 Issatchenkia terricola 4 1,4 Metschnikowia pulcherrima 3 1,1 Issatchenkia occidentalis 2 0,7 Pichia membranifaciens 1 0,4 2011 77 27,0 Franciacorta 35 12,3 S. cerevisiae 16 5,6 Torulaspora delbrueckii 6 2,1 Hanseniaspora vineae 5 1,8 Kluyveromyces thermotolerans 3 1,1 Metschnikowia pulcherrima 2 0,7 Candida oleophila 1 0,4 Hanseniaspora uvarum 1 0,4 Candida zemplinina 1 0,4
  • 39. Capitolo 2. Indagine sull’ecologia di lieviti enologici in Franciacorta ed Oltrepò Pavese Oltrepò Pavese 42 14,7 S. cerevisiae 16 5,6 Metschnikowia fructicola 8 2,8 Hanseniaspora uvarum 5 1,7 Candida zemplinina 3 1,0 Torulaspora delbrueckii 3 1,0 Pichia fluxum 2 0,6 Pichia anomala 1 0,4 Pichia kluyveri 1 0,4 Pichia membranifaciens 1 0,4 Candida glabrata 1 0,4 Kluyveromyces thermotolerans 1 0,4 Totale 285 100,0%Tabella 2.4 Identificazione genetica degli isolati da mosto in Franciacorta (FCR) edOltrepò Pavese (OLT), nel corso delle tre annate. 41Figura 2.9 Biodiversità osservata nei campioni di mosto in Franciacorta ed Oltrepò Pa-vese nel corso delle tre annate.
  • 40. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico…42 Figura 2.10 Permanenza delle specie di lievito in campioni di mosto, durante le tre an- nate a) in Franciacorta; b) in Oltrepò Pavese. Dal campionamento del vino base sono stati ottenuti 182 iso- lati di lievito (circa il 37% della collezione totale di lievito); i risultati della loro identificazione genetica sono mostrati in Tabella 2.5. In totale sono state identificate 10 diverse specie di lievito (Fi- gura 2.11). Come previsto, S. cerevisiae ha rappresentato la spe-
  • 41. Capitolo 2. Indagine sull’ecologia di lieviti enologici in Franciacorta ed Oltrepò Pavesecie dominante in vino base, a fine fermentazione alcolica, sia inFranciacorta (35%) che in Oltrepò Pavese (41%). In letteratura si riporta che questa specie, infatti, rappresenta laquasi totalità di lieviti in vino a fine fermentazione alcolica, mentrele specie H. uvarum e Zygosaccharomyces (non corrispondenteal qui ritrovato Z. bailii) risultano solo raramente isolabili (Gonzales,2007). Al termine della fermentazione alcolica anche in questocaso la popolazione di S. cerevisiae era prevalente (76%), anchese non al livello presentato da Gonzales (99%). Il secondo generepiù rappresentativo è risultato Pichia (20%), seguita dalle specieH. uvarum e Z. bailii (3%), quest’ultima una specie che può essereriscontrata a fine fermentazione più facilmente rispetto ad altre,grazie alla sua elevata alcol-tolleranza (Fleet, 2003). L’annata 2009 è stata quella in cui è stato isolato il maggiornumero lieviti; 100 isolati, di cui il 27% dal campionamento divino base della Franciacorta e 29% per Oltrepò Pavese. Durantequesta annata, un totale di 6 differenti specie di lieviti sono stateisolate (Tabella 2.5). Questo risultato potrebbe derivare dal fat- 43to che in realtà la biodiversità interspecifica più elevata è stataottenuta dal campionamento del 2010, dove sono state isola-te 8 differenti specie di lievito (Tabella 2.5). In generale, occorrenotare che in alcuni campioni di vino base è stata rilevata lapresenza di una sola specie; le condizioni del mezzo, con bassopH, presenza di SO2 ed elevata concentrazione di etanolo, costi-tuiscono fattori selettivi importanti soprattutto per le specie non-Saccharomyces. Tuttavia alcuni studi hanno dimostrato da partedi alcuni ceppi una maggior tolleranza all’etanolo; la loro con-seguente maggior persistenza nel mezzo può influenzare l’impat-to sensoriale del prodotto finale (Pramateftaki, 2000; Combina,2005; Gonzáles, 2007). Per quanto riguarda la permanenza di specie di lievito in cam-pioni di vino base nel corso delle tre annate sui due territori, solopoche specie sono state re-isolate. In particolare, S. cerevisiae eP. membranifaciens in Franciacorta ed il solo S. cerevisiae in Ol-trepò Pavese, si sono mostrate specie stabilmente presenti sullearee analizzate (Figura 2.12).
  • 42. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… Vendemmia e Origine Numero di isolati Percentuale 2009 100 55 Franciacorta 48 27 S. cerevisiae 32 18 Pichia membranifaciens 9 5 Pichia fluxum 3 2 Zygosaccharomyces bailii 2 1 Issatchenkia occidentalis 1 1 Torulaspora delbrueckii 1 1 Oltrepò Pavese 52 29 S. cerevisiae 52 29 2010 36 20 Franciacorta 21 12 S. cerevisiae 11 6 Hanseniaspora uvarum 3 2 Pichia membranifaciens 3 2 Pichia spp 2 1 Zygosaccharomyces bailii 1 1 Issatchenkia occidentalis 1 1 Oltrepò Pavese 15 8 S. cerevisiae 6 344 Candida railenensis 4 2 Pichia fermentans 3 2 Hanseniaspora uvarum 2 1 2011 45 25 Franciacorta 23 13 S. cerevisiae 20 11 Pichia membranifaciens 3 2 Oltrepò Pavese 23 25 S. cerevisiae 16 17 Pichia fluxum 5 5 Pichia membranifaciens 1 1 Zygosaccharomyces bailii 1 1 Totale 182 100% Tabella 2.5 Identificazione genetica degli isolati da vino base in Franciacorta (FCR) ed Oltrepò Pavese (OLT), nel corso delle tre annate.
  • 43. Capitolo 2. Indagine sull’ecologia di lieviti enologici in Franciacorta ed Oltrepò PaveseFigura 2.11 Biodiversità interspecifica osservata nei campioni di vino base in Francia-corta ed Oltrepò Pavese nel corso delle tre annate. 45
  • 44. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico…46 Figura 2.12 Permanenza delle specie di lievito in campioni di vino base, durante le tre annate a) in Franciacorta; b) in Oltrepò Pavese.
  • 45. Capitolo 3. Tipizzazione molecolare dei ceppi di S. cerevisiae …Capitolo 3. Tipizzazione molecolare dei ceppidi S. cerevisiae per il riconoscimento di ecotipiautoctoni3.1 Introduzione Le caratteristiche sensoriali di un vino possono dipendere dallediverse tipologie di lieviti coinvolte nel processo di fermentazio-ne, ed in particolare dai differenti ceppi di S. cerevisiae che sisuccedono durante la vinificazione (Agnolucci, 2007; Capece, 472010; Guerra, 1999, Mercado, 2007, Vilanova 2003). Lo studiodella biodiversità dei ceppi di lievito appartenenti alla stessa spe-cie ci permette di capire l’evoluzione delle popolazioni presentinel mosto durante la vinificazione per incrementarne il controllo,inoltre i ceppi autoctoni caratterizzati da tipici tratti enologici po-trebbero essere caratteristici di una particolare zona vitivinicola.La presenza di questi lieviti determina un aumento della tipicità diun vino, promuovendo la diversificazione dei prodotti vitivinicoli edella zona di origine. La maggior parte delle ricerche condottefino ad ora hanno concentrato il loro studio sul controllo dellafermentazione alcolica (Caruso, 2002; Redz epovic 2002; Versa- ˇ ´,vaud, 1995), anche se non sono mancate le indagini sullo studiodell’ecologia dei lieviti delle uve, del mosto e dell’aria presentenella cantina di vinificazione (Jolly, 2006; Fleet, 2002; Fleet, 2003;Fleet, 2008; Prakitchaiwattana, 2004; Ribéreau-Gayon, 2000; Ga-rijo, 2008). Per quanto riguarda la tipizzazione dei lieviti, sono state svilup-pate differenti metodologie, basate sullo studio dei polimorfismidel DNA, al fine di discriminare tra ceppi appartenenti alla stessaspecie (Querol, 1992, Ness, 1993; Schuller, 2004). Essendo S. cere-visiae il lievito enologico più importante, i ricercatori hanno fina-
  • 46. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico … lizzato le loro attività sullo studio di questa specie, evidenziando significativi polimorfismi in ceppi di S. cerevisiae indigeni prove- nienti da differenti regioni vitivinicole ed una forte correlazione tra genotipo e proprietà fenotipiche (Esteve-Zarzoso, 2000; Na- dal, 1996). Nel tempo sono state sviluppate alcune tecniche molecola- ri tra cui RAPD (Random Amplified Polymorphic DNA; McGrath, 1998; Perez, 2001), l’analisi dei loci SSR (Single Sequence Repe- at; Ayoub, 2006) e l’analisi delle sequenze interdelta (Ness, 1993). Queste tecniche si sono rivelate utili per lo studio dell’evoluzione di popolazioni di lieviti nel corso di un processo fermentativo, per l’identificazione di un ceppo con caratteristiche peculiari e per la valutazione della biodiversità all’interno di un’area geografica. L’analisi delle sequenze interdelta è stata proposta per la pri- ma volta da Ness (1993) per la tipizzazione di ceppi di S. cerevi- siae tramite l’analisi del polimorfismo interdelta (IDM, interdelta48 marker). Il genoma di S. cerevisiae contiene sequenze ripetute di DNA, le sequenze delta, associate al trasposone Ty1 (Came- ron, 1979). Gli elementi trasponibili o trasposoni sono frammenti di DNA che hanno in comune la capacità di muoversi da un punto all’altro del genoma e di amplificare il proprio numero di copie all’interno dell’ospite. Gli elementi delta costituiscono le ripetizioni terminali (LTR) della sequenza dei trasposoni Ty1 e Ty2 in lievito; questi si possono trovare sia associati al retrotrasposo- ne, sia dispersi nel genoma, in questo caso prendono il nome di “elementi delta” (Legras e Karst, 2003). Eventi di ricombinazio- ne possono espellere la sequenza centrale del retrotrasposone lasciando nella posizione originaria una singola LTR, spiegando la presenza di molte copie di LTR, prive del trasposone, disper- se nel genoma. Il genoma di S. cerevisiae è caratterizzato dalla presenza di 5 famiglie di retrotrasposoni, di cui quattro rientrano nella categoria degli elementi di tipo “Ty1-copia” (Ty1, Ty2, Ty4, Ty5) ed uno (Ty3) nella categoria degli elementi di tipo “gypsy”. Entrambe le classi presentano un’organizzazione simile a quella dei retrovirus (Boeke e Corces, 1989; Doolittle, 1989), ma differi- scono tra loro per la disposizione dei geni: mentre negli elementi tipo “gypsy” la funzione integrasica (INT, importante per l’integra- zione del trasposone nell’ospite) è localizzata all’estremità di Pol
  • 47. Capitolo 3. Tipizzazione molecolare dei ceppi di S. cerevisiae …(parte della sequenza che codifica gli enzimi implicati nel ciclovitale del trasposone), preceduta dall’RNAasiH, in Ty1-copia INT sitrova all’interno del gene Pol, seguito dalla sequenza codifican-te per la retrotrascrittasi (RT) e da quella per l’RNAsiH (Figura 3.1).Tra queste famiglie solo Ty1, Ty2 e Ty3 risultano essere attive nellatrasposizione all’interno del genoma.Figura 3.1 Struttura del retrotrasposone di tipoTy1-copia (INT prima di RT) e Ty3-gypsy(INT dopo RH). 49 Come dimostrato da diversi autori (Legras e Karst, 2003; Schul-ler, 2004), il numero (S. cerevisiae può contenere da 2 a 30 co-pie dei 5 elementi trasponibili) e la posizione di questi elementihanno una certa variabilità intraspecifica che può essere utiliz-zato come un’impronta digitale genetica per identificare i cep-pi di S. cerevisiae (Xufre, 2011). I marcatori Interdelta sfruttanoquesto polimorfismo. Si tratta di una metodica che prevede unaamplificazione mediante PCR (Polymerase Chain Reaction) diframmenti di DNA situati tra due trasposoni (Ness, 1993). Ai finidell’amplificazione, è necessario progettare dei primers (sequen-ze omologhe al DNA) che si appaino ad entrambe le estremitàdelta (δ). L’amplificazione delle sequenze interdelta è conosciuta peressere altamente specifica per l’identificazione di ceppi di S.cerevisiae rispetto ad altri lieviti (Ness, 1993). Pramateftaki (2000)analizzando le sequenze δ di 500 isolati di un’area vitivinicola del-la Grecia ha ottenuto dei profili di amplificazione esclusivamenteda isolati di S. cerevisiae. Poiché l’amplificazione delle sequenze inter-δ sembra essereefficace per la tipizzazione, molti studi ne sono seguiti per otti-mizzare la tecnica. Infatti, Legras e Karst (2003) progettando una
  • 48. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico … nuova coppia di primers hanno ottenuto un netto miglioramento del polimorfismo dei profili genetici. Tristezza (2009) ha adottato la tecnica dell’elettroforesi capillare ai marcatori Interdelta per la genotipizzazione di ceppi di S. cerevisiae, ottenendo un miglio- ramento nella sensibilità e precisione della tecnica. Un ampio studio delle biodiversità intraspecifica di S. cerevisiae porta alla possibilità di isolare nuovi ceppi indigeni che potreb- bero sostituire quelli attualmente in commercio impiegati nella produzione di vino, considerando che quelli indigeni risultano più adatti alla crescita in uno specifico mosto e riflettono maggior- mente la biodiversità di una regione vitivinicola. Per questo mo- tivo, nazioni come Argentina (Combina, 2005; Mercado, 2007), Spagna (Blanco, 2006; Garijo, 2008; Gonzales, 2007; Torija, 2001; Sabate, 2002), Francia (Valero, 2007), Austria (Lopandic, 2007), Croazia (Redz epovic 2002), Slovenia (Raspor, 2006), Ungheria ˇ ´, (Csoma, 2010), Grecia (Nikolaou, 2007; Nisiotou e Nychas, 2007), Sud Africa (Jolly, 2003; Pretorius, 1999), India (Chavan, 2009) e50 Giappone (Shinohara, 2003) hanno condotto ricerche volte a valutare la biodiversità dei lieviti da vino in alcune delle principali regioni vitivinicole. In Italia, medesimi studi sono stati condotti nel- le regioni Marche (Guerra, 1999), Basilicata (Caruso, 2002), Puglia (Cappello, 2004) e Sicilia (Romancino, 2000). Dal momento che la regione Lombardia è una delle più impor- tanti regioni italiane per la produzione di vino spumante, lo scopo di questo lavoro è stato la valutazione della biodiversità intraspe- cifica degli isolati di S. cerevisiae raccolti durante il processo di produzione del vino in Franciacorta (Brescia) ed Oltrepò Pavese (Pavia). Una caratterizzazione molecolare a livello di ceppo è stata condotta tramite l’utilizzo della tecnica molecolare IDM per gli isolati di S. cerevisiae campionati da aria, mosto e vino duran- te le stagioni produttive del 2009, 2010 e 2011. 3.2 Materiale e Metodi Isolamento dei campioni La tipizzazione è stata condotta per tutti i 272 isolati di S. cerevi- siae collezionati nel corso del progetto (Tabella 3.1). Nello studio è stata inclusa l’analisi di 48 lieviti commerciali, alcuni dei quali
  • 49. Capitolo 3. Tipizzazione molecolare dei ceppi di S. cerevisiae …sono utilizzati per la produzione di vino spumante nelle cantinecoinvolte nella sperimentazione. Francia- Oltrepò Pa- Anno Totale corta vese 2009 - 7 7 Aria 2010 - 1 1 2011 - 1 1 2009 22 14 36 Mosto 2010 28 17 45 2011 26 19 45 2009 32 52 84 Vino 2010 11 6 17 2011 18 18 36 Totale 137 135 275 51Tabella 3.1 Isolati di S. cerevisiae da aria, mosto e vino provenienti da Franciacorta edOltrepò Pavese raccolti durante le annate produttive 2009, 2010, 2011. Nello studio è stata inclusa l’analisi di 48 ceppi di lieviti com-merciali impiegati nelle colture starter, alcuni dei quali sono utiliz-zati per la produzione di vino spumante nelle cantine coinvoltenella sperimentazione.Tipizzazione di S. cerevisiae La tipizzazione è stata condotta per tutti gli isolati di S. cerevi-siae basandosi sullo studio del marcatore molecolare Interdelta(δ-PCR), come da protocollo proposto da Legras e Karst (2003).Il protocollo sperimentale prevede l’amplificazione di specifichezone del genoma comprese tra due sequenze delta (δ) tramitel’utilizzo di primers specifici, separazione elettroforetica dei pro-dotti di amplificazione per valutarne la qualità e successiva se-parazione dei medesimi frammenti al sequenziatore a capillareper delineare con maggiore accuratezza il profilo genetico diogni isolato. La coppia di primers specifici utilizzata per l’analisi delle se-quenze interdelta è quella riportata da Legras e Karst (2003), co-
  • 50. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico … struita sulle sequenze delta no. YOLC delta3 (Tabella 3.2). In ac- cordo con quanto riportato da Tristezza (2009), il primer delta21 è stato marcato in posizione 5’ con il fluoroforo 6-Carbossifluore- sceina (6-FAM, Primm, Milan, Italy), al fine di separare i prodotti di amplificazione con elettroforesi capillare. Per l’estrazione del DNA da lievito è stato seguito un protocollo proposto da Querol (1992). Per maggiori dettagli sulle fasi che caratterizzano questo protocollo si rimanda al capitolo 2. La rea- zione di PCR è stata condotta partendo dal DNA genomico degli isolati di S. cerevisiae in un volume finale di 25 μL contenente 1X Buffer (5 Prime, Amburgo), 2 mM di MgCl2 (5 Prime, Amburgo), 200 µM di dNTPs (Fermentas, Lituania), 1 mM per ogni primer, 1U di Taq-DNA Polymerase (5 Prime, Amburgo) e 80 ng di DNA. Il ci- clo di amplificazione utilizzato è stato il seguente: 5 cicli di dena- turazione a 95°C per 30 s, allineamento dei primers a 42°C per 30 s ed estensione dei frammenti amplificati a 72°C per 2 min, seguiti da 30 cicli di denaturazione a 95°C per 30 s, allineamento dei pri-52 mers a 42°C per 30 s ed estensione a 72°C for 2 min. La reazione di amplificazione è stata terminata con uno step finale a 72°C per 30 min. I prodotti di amplificazione sono stati separati tramite corsa elettroforetica su gel di agarosio al 2,0% (p/v) in 1X TAE buf- fer, utilizzando come riferimento un marker di pesi molecolari noti (100 bp XL Ladder, 5 PRIME, Italy). La separazione dei frammenti è stata eseguita a 100V per circa 90 min. Primer Sequenza nucleotidica (5’-3’) Riferimento DELTA 12 TCAACAATGGAATCCCAAC Legras e Karst, 2003 DELTA 21 CATCTTAACACCGTATATGA* Tabella 3.2 Coppia di primers utilizzata per la tipizzazione degli isolati di S. cerevisiae. Elettroforesi capillare La determinazione della lunghezza degli ampliconi ottenuti dall’analisi δ-PCR è stata determinata utilizzando il sequenziatore a capillare ABI Prism 310 Genetic Analyzer (Applied Biosystems – Life Technologies, United States). Per la corsa sono necessari: POP-4 polymer (Applied Biosystems) per facilitare la migrazione dei frammenti di amplificazione all’interno del capillare; 310 Ge-
  • 51. Capitolo 3. Tipizzazione molecolare dei ceppi di S. cerevisiae …netic Analyzer Buffer with EDTA (Applied Biosystems) per garantireil passaggio di corrente durante le analisi; capillare da 47 cm x 50μm capillary (Applied Biosystems) per la migrazione dei frammen-ti. I campioni sono stati preparati in una soluzione contenente 0,9µL del prodotto di δ-PCR diluito 10-3 (per evitare che il segnaledei frammenti maggiormente amplificati sia fuori scala), 20 µL diformammide (Applied Biosystems) e 0,75 µL di GeneScan-1200LIZ (Applied Biosystems), un marcatore di pesi noti. La soluzioneè stata incubata a 95°C per 3 min per denaturare i frammenti diDNA e successivamente raffreddata in ghiaccio per 3-5 min alfine di stabilizzare i frammenti denaturati. Ogni campione è sta-to iniettato nel capillare per 20 s a 1,5 kV e separato a 8 kV per80 min a 60°C. L’elaborazione dei dati è stata condotta trami-te il software ABI PRISM GeneMapper 3.7 (Applied Biosystems) ingrado di determinare la dimensione in paia di basi (bp) di ogniframmento. I frammenti compresi nel range 50-1200bp sono statiutilizzati per determinare il profilo Interdelta di ogni isolato di S.cerevisiae. 53Analisi dei dati I profili elettroforetici ottenuti con GeneMapper 3.7 sono statitrasformati in matrici binarie di presenza/assenza di un determi-nato frammento di PCR (1 presenza, 0 assenza) e utilizzati pergenerare una matrice di similarità. Il programma MEGA 4.0 (Ta-mura, 2007) è stato utilizzato per generare dei raggruppamen-ti sulla base dei dati di similarità (coefficiente di “Dice”; Dice,1945), i quali sono stati rappresentati in un dendrogramma ditipo UPGMA (unweighted pair group method with arithmeticmeans). L’Analisi delle Componenti Principali (PCA) è stato utiliz-zata per catturare la correlazione esistente tra i ceppi di S. cere-visiae, partendo dalla matrice di similarità ottenuta per l’analisia cluster. Le analisi sono state effettuate con il software GenAlEx6.3 (Peakall e Smouse, 2006) e i dati sono stati visualizzati in ungrafico 3D.Ripetibilità del metodo Per valutare la ripetibilità del metodo, il DNA genomico di 4distinti ceppi commerciali di S. cerevisiae (SC1, SC2, SC3, SC4)è stato utilizzato come templato per 3 indipendenti reazioni di
  • 52. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico … amplificazione (per il protocollo di PCR si rimanda al paragrafo ‘Tipizzazione di S. cerevisiae’). I prodotti di PCR sono stati sepa- rati in elettroforesi di gel di agarosio (2,0% w/v, 1X TAE buffer) e successivamente separati in elettroforesi capillare come ripor- tato nel paragrafo ‘Elettroforesi capillare’. La similarità geneti- ca tra le 3 repliche appartenenti al medesimo ceppo di lievito è stata calcolata sulla base del coefficiente di “Dice” e i dati relativi a questo valore sono stati rappresentati in un dendro- gramma, come riportato nel paragrafo ‘Analisi dei dati’. Come soglia di discriminazione tra i ceppi di S. cerevisiae è stata indi- viduata la percentuale minore di similarità che hanno eviden- ziato i replicati di uno stesso ceppo. Isolati che presentano una percentuale di similarità maggiore saranno considerati cloni dello stesso ceppo. 3.3 Risultati54 Al fine di valutare la biodiversità di ceppi di S. cerevisiae coin- volti nella produzioni di vino nelle cantine della Franciacorta e dell’Oltrepò Pavese in Lombardia, in totale, 275 isolati ascritti alla specie S. cerevisiae sono stati sottoposti ad analisi; a que- sti campioni sono stati aggiunti 48 lieviti commerciali di S. cere- visiae. La biodiversità intraspecifica degli isolati di S. cerevisiae è stata investigata attraverso i profili di amplificazioni generati dall’analisi δ-PCR. Questi sono stati generati utilizzando la cop- pia di primers delta12/delta21 (Legras e Karst 2003), apportando una modifica nella regione 5’ del primer delta21, l’aggiunta del fluorocromo 6-Carbossifluoresceina (6-FAM) come suggerito da Tristezza (2009), al fine di analizzare i prodotti di amplificazione con elettroforesi capillare. In Figura 3.2 e 3.3 sono riportate le immagini dei profili interdelta ottenute dopo separazione elet- troforetica per alcuni isolati di S. cerevisiae isolati in Franciacorta ed Oltrepò Pavese durante la stagione produttiva del 2010.
  • 53. Capitolo 3. Tipizzazione molecolare dei ceppi di S. cerevisiae … M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 MFigura 3.2 Separazione dei frammenti interdelta su gel d’agarosio al 2,0% per isolati diS. cerevisiae da mosto e vino durante la stagione produttiva 2010 in Franciacorta. 1-23:Isolati. M: Marcatore di pesi molecolari (100 bp XL Ladder, 5 PRIME, Italy). M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 M 55Figura 3.3 Separazione dei frammenti interdelta su gel d’agarosio al 2,0% per isolati di S.cerevisiae da aria, mosto e vino durante la stagione produttiva 2010 in Oltrepò Pavese.1-24: Isolati. M: Marcatore di pesi molecolari (100 bp XL Ladder, 5 PRIME, Italy). Lo step successivo è stato quello di dimensionare accurata-mente i frammenti di amplificazione ottenuti dall’analisi δ-PCRtramite una separazione dei prodotti di PCR al sequenziatore acapillari (ABI Prism 310 Genetic Analyzer).
  • 54. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico … La ripetibilità del metodo è stata condotta attraverso un test che ha permesso di determinare la soglia di similarità al di so- pra della quale isolati appartenenti ad un medesimo raggrup- pamento possono potenzialmente essere considerati cloni dello stesso ceppo. L’esperimento è stato condotto per 4 differenti ceppi commerciali di S. cerevisiae (SC1, SC2, SC3, SC4), ana- lizzando ogni ceppo con 3 amplificazioni δ-PCR indipendenti e separando i frammenti di amplificazione in elettroforesi su gel di agarosio e successivamente in elettroforesi capillare. I profili di amplificazione (Figura 3.4) sono stati trasformati in matrici binarie (1 presenza, 0 assenza) e usate per creare una matrice di simi- larità ed il rispettivo dendrogramma di tipo UPGMA (Figura 3.5). Size (bases)56 SC1 SC2 SC3 SC4 Fluorescents intensity Figura 3.4 Valutazione della ripetibilità del metodo di elettroforesi capillare. Destra: separazione dei frammenti di amplificazione δ-PCR in gel di agarosio al 2,0% per 4 differenti ceppi di S. cerevisiae (SC1, SC2, SC3 e SC4 in triplicato). Marcatore di pesi molecolari: 100 bp XL Ladder. Sinistra: elettroforesi capillare; esempio di ferogrammi di 3 repliche del ceppo SC1 di S. cerevisiae. Asse X: pesi molecolari espressi in paia di basi (bp); Asse Y: fluorescenza.
  • 55. Capitolo 3. Tipizzazione molecolare dei ceppi di S. cerevisiae … 98.5% 57Figura 3.5 Dendrogramma relativo alla determinazione della ripetibilità dell’elettrofo-resi capillare. L’asse orizzontale rappresenta il coefficiente di similarità tra i ceppi di S.cerevisiae. 98.5% è la soglia di similarità oltre la quale i campioni possono essere consi-derati cloni dello stesso ceppo. Dall’esperimento di ripetibilità è stata osservata una differen-za di 2 bp tra i frammenti delle repliche di un medesimo cep-po. Considerando questi frammenti come stessa forma allellica,questo valore è stato utilizzato come criterio per raggruppare iframmenti ottenuti in seguito all’elettroforesi capillare prima del-la trasformazione in matrice binaria, sia per i ceppi di S. cerevi-siae utilizzati per determinare la ripetibilità della tecnica, sia per ilgruppo di isolati da aria, mosto e vino. La valutazione della ripe-tibilità dell’elettroforesi capillare ha evidenziato una similarità del98,5% per i replicati del medesimo ceppo. Questo valore è statoconsiderato come valore soglia per la discriminazione degli iso-lati di S. cerevisiae nelle annate 2009, 2010 e 2011. Gli isolati chepresentano un valore di similarità maggiore saranno consideraticloni del medesimo ceppo (Figura 3.5). I profili elettroforetici sono stati valutati nell’intervallo di pesi mo-lecolari tra 50-1200bp. In media sono state identificate 25 bandepotenzialmente polimorfiche per ceppo isolato, con un minimo di
  • 56. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico … 17 ed un massimo di 42 bande, per un totale di 200 bande poli- morfiche. La banda maggiormente rappresentata è stata quella di dimensioni pari a 460 bp, condivisa da 280 su 323 isolati (8%). Non sono state identificate bande monomorfiche, ossia della stessa lun- ghezza e presenti in tutti gli isolati. Il confronto dei profili elettroforeti- ci ha permesso di identificare isolati con profili genetici identici, per un totale di 167 genotipi, corrispondenti al 52% dei lieviti analizzati. Il profilo elettroforetico più comune è stato condiviso da 23 ceppi: 7 starter commerciali, 3 isolati nell’annata 2009 in Oltrepò, 6 in Fran- ciacorta 2009, 4 in Franciacorta 2010 e 3 in Franciacorta 2011. I pro- fili elettroforetici dei 48 starter sono stati raggruppati in 18 genotipi. Quarantanove isolati di S. cerevisiae hanno evidenziato un profilo elettroforetico identico a quello degli starter commerciali. La trasformazione dei profili elettroforetici interdelta in una matri- ce di presenza/assenza ha permesso di costruire un dendrogram- ma (metodo di clustering: UPGMA) per evidenziare la similarità genetica degli isolati presi in esame. Il risultato dell’analisi a cluster58 condotta sui 323 isolati di S. cerevisiae è rappresentato grafica- mente nel dendrogramma di Figura 3.6. In accordo con la soglia del 98,5% di similarità genetica ottenuta sulla base della ripetibilità del metodo, 161 isolati possono essere considerati cloni dello stes- so ceppo, riducendo a 159 il numero di isolati aventi un genotipo differente. L’intervallo di similarità genetica, ottenuto sulla base del calcolo del coefficiente di Dice, è compreso tra 73 e 100%. L’analisi a cluster ha identificato 3 cluster principali, in grado di raggruppa- re il 72% degli isolati. Il restante 38% degli isolati è stato raggruppato in cluster minori, alcuni dei quali rappresentati da un solo ceppo. I 3 cluster principali si separano ad un livello di similarità pari all’87%. Il cluster A (verde), che a sua volta si divide in 3 sub-cluster, ha rag- gruppato 110 isolati, mentre i cluster B (azzurro) e C (viola) hanno raggruppato 18 e 102 isolati, rispettivamente, a loro volta dividen- do gli isolati in 3 sub-cluster. La maggior parte dei profili elettrofo- retici degli starter commerciali sono stati raggruppati nel cluster C. Basandosi sulla provenienza geografica è possibile notare l’as- senza di raggruppamenti specifici per area, poiché gli isolati si di- stribuiscono casualmente tra i diversi cluster, sebbene siano ricono- scibili delle tendenze: il cluster C è composto per il 91% da starter commerciali e ceppi isolati in Franciacorta; tra gli isolati più diffe- renti, con un indice di similarità compreso tra 78 e 73%, sono stati
  • 57. Capitolo 3. Tipizzazione molecolare dei ceppi di S. cerevisiae …raggruppati gli isolati provenienti dalla Franciacorta (Figura 3.7A).Sulla base della suddivisione in annata, il cluster A ha raggruppa-to in massima parte ceppi isolati nel 2010 e nel 2011, mentre lamaggior parte degli isolati nell’anno 2009 sono stati raggruppatinei restanti cluster minori (Figura 3.7B). Basandosi sulla tipologia, iceppi isolati da mosto sono predominanti nel cluster A, mentre ilcluster B risulta interamente caratterizzato da ceppi isolati da vino,come anche la maggior parte dei cluster minori. I ceppi isolati daaria sono stati raggruppati nei cluster minori (Figura 3.7C). 59Figura 3.6 Dendrogramma (UPGMA) ottenuto dall’analisi a cluster dei profili Interdeltadi 48 starter commerciali (SC#) e 275 ceppi di S. cerevisiae (C#) isolati da aria, mostoe vino nelle annate 2009, 2010 e 2011 in Fraciacorta ed Oltrepò Pavese. Verde: clusterA; azzurro: cluster B; viola: cluster C.
  • 58. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico … A B60 Franciacorta Oltrepò Starters 2009 Figura 3.7 A Dendrogramma ottenuto dai profili Interdelta di 275 ceppi di S. cerevisiae e 48 starter commerciali. I cluster sono stati evidenziati: per area geografica (A); anno di isolamento (B); tipologia di substrato (C).
  • 59. Capitolo 3. Tipizzazione molecolare dei ceppi di S. cerevisiae … B C 61Starters 2009 2010 2011 Starters Mosto Figura 3.7 B Dendrogramma ottenuto dai profili Interdelta di 275 ceppi di S. cerevisiae e 48 starter commerciali. I cluster sono stati evidenziati: per area geografica (A); anno di isolamento (B); tipologia di substrato (C).
  • 60. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico … C 62Starters Mosto Vino Aria Starters Figura 3.7 C Dendrogramma ottenuto dai profili Interdelta di 275 ceppi di S. cerevisiae e 48 starter commerciali. I cluster sono stati evidenziati: per area geografica (A); anno di isolamento (B); tipologia di substrato (C). Sulla base della matrice di distanza genetica ottenuta dai pro- fili interdelta è stata determinata l’analisi delle componenti prin- cipali (PCA), al fine di visualizzare le relazioni genetiche esistenti tra i ceppi di S. cerevisiae. Le relazioni tra gli isolati sono state visualizzate in base alle prime 3 componenti principali (Figura 3.8). La variabilità spiegata dalle prime 3 componenti principali è pari al 66,29% della variabilità totale. Come ottenuto dall’ana- lisi a cluster, anche l’analisi delle componenti principali non ha evidenziato particolari raggruppamenti specifici, infatti gli isolati
  • 61. Capitolo 3. Tipizzazione molecolare dei ceppi di S. cerevisiae …provenienti da aree geografiche differenti risultano dispersi in ununico gruppo. Tuttavia, la componente nr. 1 ha differenziato par-te dei ceppi appartenenti al gruppo degli starter commerciali,che risultano come un raggruppamento separato dai restanticeppi. Analogamente, l’assenza di raggruppamenti specifici èstata evidenziata considerando l’anno di isolamento (2009, 2010,2011) e la tipologia di substrato da cui sono stati isolati i ceppi(aria, mosto, vino). 63Figura 8. Presentazione grafica dell’Analisi delle Componenti Principali (PCA) ottenutadai polimorfismi Interdelta di 275 ceppi di S. cerevisiae e 48 starter commerciali.
  • 62. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… Capitolo 4. Selezione dei ceppi e prove di microvinificazione 4.1 Introduzione Negli ultimi anni le ricerche in campo enologico si sono focaliz- zate sulla selezione di ceppi potenzialmente ritenuti autoctoni di Saccharomyces cerevisiae, da impiegare come starter nella pro- duzione di vini in particolari regioni (Lopes, 2002; Pretorius, 1999;64 Torija, 2001), con l’obiettivo di fornire caratteristiche sensoriali ri- conducibili al territorio di appartenenza. La selezione dei ceppi ha lo scopo di ottenere colture di lievito capaci di condurre il processo fermentativo con risultati prede- terminati; pertanto, tali ceppi devono possedere caratteristiche specifiche di vocazione enologica. I caratteri desiderabili per una coltura starter possono essere differenti a seconda delle diverse tecnologie di vinificazione da adottare e dalle differenti tipologie di prodotto che si vogliono ottenere (Giudici e Zambonelli, 1992). Alcuni tra i più importanti criteri impiegati in questo progetto per la selezione risultano essere (Perez-Coello, 1999; Esteve-Zarzoso, 2000): • Potere fermentativo: esprime la quantità massima di etanolo che un ceppo può formare durante la fermentazione in pre- senza di un eccesso di zuccheri; • Vigore fermentativo: esprime la prontezza con cui un ceppo dà il via alla fermentazione e la velocità con cui la porta a termine; • Resistenza alla SO2: esprime la capacità da parte del ceppo di mantenere inalterata o sufficientemente elevata la velocità di fermentazione in presenza di dosi selettive di SO2;
  • 63. Capitolo 4. Selezione dei ceppi e prove di microvinificazione• Produzione di glicerolo: uno dei principali componenti dell’e- stratto secco dei vini che va ad influenzare direttamente il co- siddetto “corpo”. Esso imprime al vino i caratteri di dolcezza, corposità e pienezza.• Produzione di composti solforati: costituiti per lo più da idroge- no solforato e anidride solforosa, derivanti dalla riduzione dei solfati presenti nel mosto. Questi possono comportare odori sgradevoli o problemi di stabilità nel prodotto finito;• Produzione di acidi volatili.• Produzione di sostanze aromatiche Il primo step per la selezione di nuovi ceppi, dopo la caratte-rizzazione molecolare, è stata la valutazione di tali caratteristi-che attraverso prove di microvinificazione a livello di laboratorio;queste hanno permesso di valutare le capacità del ceppo didominare la fermentazione e di determinare l’espressione dellecaratteristiche organolettiche nel vino (Capece, 2010; Guerra,1999; Lopes, 2002). 654.2 Selezione dei ceppi I ceppi autoctoni, sottoposti a prove di microvinificazione,sono stati selezionati dalla collezione conservata nei laborato-ri dell’Università di Milano, previa preliminare caratterizzazionedelle principali capacità enologiche precedentemente descrit-te. Questi ceppi sono provenienti dalla raccolta dei campionidella vendemmia 2009 effettuata sia nel territorio della Francia-corta che nel territorio dell’Oltrepò Pavese. Essi sono stati identi-ficati mediante amplificazione delle regioni ITS (in accordo conEsteve-Zarzoso,1999) e conservati, sotto forma di glicerinati, a-80 °C. In particolare, i ceppi impiegati sono risultati geneticamentediversi dagli starter impiegati nelle cantine coinvolte nella speri-mentazione (Tabella 4.1).
  • 64. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… Ceppo Origine C91 Vb*- cantina 6 - Fcr C90 Vb- cantina 7- Fcr C114 Vb- cantina 4- Fcr C273 FA- cantina 3- Fcr C278 FA- cantina 3- Fcr C277 FA- cantina 3- Fcr C276 FA- cantina 3- Fcr C275 FA- cantina 3- Fcr C48 Vb- cantina A- Olt C58 Vb- cantina B- Olt C61 Vb- cantina B- Olt C101 Vb- cantina F- Olt C49 Vb- cantina F- Olt66 C70 Vb- cantina I- Olt C67 Vb- cantina L- Olt C94 Vb- cantina M- Olt S1 OEC1 S2 Lalvin2 Tabella 4.1 Elenco dei ceppi impiegati in prove di microvinificazione. * Vb = isolati da vino base, Fcr = Franciacorta vendemmia 2009, Olt = Oltrepò Pavese vendemmia 2009, FA = isolati durante il monitoraggio della fermentazione alcolica 1 Institut Oenologique De Champagne-Collection de Levures d’Intérêt Biotechnologique. 2 http://www.lalvinyeast.com/images/library/EC1118_Yeast.pdf Questi ceppi sono stati saggiati in prove di microvinificazione utili a valutarne le caratteristiche tecnologiche e qualitative per le successive prove di rifermentazione. 4.3 Prove di microvinificazione Per evitare contaminazioni sono state utilizzate provette Er- lenmeyer da 250 ml che presentano particolari valvole in grado di garantire da una parte la sterilità e dall’altra il corretto scam- bio di gas. Le prove di microvinificazione sono state condotte in 100 ml di mosto bianco (proveniente da uva Pignoletto), sotto-
  • 65. Capitolo 4. Selezione dei ceppi e prove di microvinificazioneposto a sterilizzazione per eliminare eventuali microrganismi cheavrebbero potuto condizionare i risultati. Ciascuna coltura dilievito è stata inoculata ad una concentrazione pari a 106 UFC/ml, a partire da una pre-coltura sviluppatasi nello stesso tipo dimosto per 48 ore. La prova è stata condotta alla temperatura di18 °C.Determinazione dei caratteri tecnologici Per determinare il potere ed il vigore fermentativo dei ceppiimpiegati nell’analisi è stata misurata ogni giorno la perdita dipeso delle provette Erlenmeyer fino all’ottenimento di un pesocostante per due giorni consecutivi. Il vigore fermentativo è sta-to espresso in termini di grammi di CO2 prodotte nelle prime 48ore, seguenti l’inoculo del mosto, mentre il potere fermentativoè stato espresso come % v/v di etanolo prodotto, impiegando laseguente formula: [ ( Δpeso (g) / 44 (g/mol CO2 ) x 46,7 (g/mol EtOH) ] / 0,789 (g/ml EtOH) 67Determinazione dei caratteri qualitativi I caratteri qualitativi valutati sono stati: produzione di glicerolo,produzione di acido acetico e produzione di H2S. Al termine della fermentazione, aliquote di campioni di vinosono state centrifugate (Hettich zentrifugen, rotina 380r, Ger-many) a 3500 g e il surnatante è stato sottoposto ad analisi; perciascun campione, valutato in tre repliche, la produzione di gli-cerolo e di acido acetico sono state misurate attraverso l’impie-go di kit enzimatici (kit 148270 e 148261, rispettivamente; Boehrin-ger-Mannheim, Germany). La purezza della fermentazione è stata espressa in termini digrammi di acido acetico/100 ml di etanolo. Per ciò che riguarda la produzione di H2S, tutti i ceppi sono statipiastrati su terreno Bismuth Sulfite Glucose Glycine Yeast agar-BiGGY (BD, France). In questo terreno il colore delle colonie èdeterminato dalla riduzione del solfito a solfuro che legandosi albismuto, provoca cambiamento di colore delle colonie (da bei-ge a nero). In accordo con Redzepovic (2002) il grado di colo-razione, associato alla crescita delle colonie di lievito in BIGGY-agar, è determinato dalla seguente scala:
  • 66. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… • 1=bianco; • 2=crema; • 3=beige; • 4=marrone; • 5=marrone tendente al nero; • 6=nero. Test di sniffing Le caratteristiche sensoriali dei campioni al termine delle prove di microvinificazione, sono state valutate effettuando delle pro- ve definite di “sniffing” nelle quali i campioni sono stati classificati in funzione del profumo e quindi delle sostanze aromatiche vola- tili, che sono state prodotte durante la fermentazione dei lieviti. La prova è stata eseguita da un panel di assaggiatori al quale è stato chiesto di valutare i campioni attraverso la compilazione del modulo riportato di seguito (Figura 4.1). Soltanto i punteggi (da 0 a 10), inerenti l’intensità olfattiva e la68 gradevolezza, sono stati impiegati per la successiva analisi stati- stica; i dati ottenuti sono stati elaborati attraverso il software per l’analisi statistica Statgraphics Centurion Plus 5.1 che ha permes- so di effettuare l’analisi della varianza multifattoriale, al fine di determinare quali fattori (ceppi e/o giudici) avevano un effetto significativo sulla valutazione.
  • 67. Capitolo 4. Selezione dei ceppi e prove di microvinificazione 69Figura 4.1 Scheda per la valutazione del profilo aromatico dei vini attraverso test disniffing
  • 68. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… 4.4 Preparazione della biomassa di lievito starter (ceppi autoc- toni) Sulla base dei risultati del test di sniffing e delle caratteristiche tecnologiche e qualitative, 2 differenti ceppi autoctoni di S. ce- revisiae (denominati ceppo X e ceppo Y), per ciascuna area produttiva, sono stati scelti per essere impiegati come starter nel- le prove di tirage 2011. Le cantine che hanno partecipato alla sperimentazione, per ciascuna area produttiva, sono riportate nella tabella 4.2. Cantina Località Area C1 Rodengo Saiano (BS) Franciacorta C2 Erbusco (BS) Franciacorta C3 Erbusco (BS) Franciacorta70 C4 Erbusco (BS) Franciacorta C5 Erbusco (BS) Franciacorta C6 Rocca de’ Giorgi (PV) Oltrepò Pavese C7 Pietra de’ Giorgi (PV) Oltrepò Pavese C8 Santa Giuletta (PV) Oltrepò Pavese Tabella 4.2 Cantine produttrici di vino spumante coinvolte nella sperimentazione (BS= Brescia, Lombardia, PV= Pavia, Lombardia) Ciascun ceppo è stato fatto crescere in 20 ml di brodo YEPD (la cui composizione è riportata in tabella 4.3) per 16 ore, in agi- tazione costante; successivamente, la concentrazione cellulare è stata determinata misurando la densità ottica (OD) a 660 nm e 2 ml di questa coltura sono stati trasferiti in provette Enlermeyer, contenenti 200 ml di YEPD. Queste sono state incubate a 25 °C per 48 ore, in continua agitazione. Dopo l’incubazione, è stata effettuata una seconda misura- zione dell’OD e un volume corrispondente ad una concentrazio- ne di 5.109 cellule è stato centrifugato (Hettich zentrifugen, rotina 380r, Germany ) a 3500 g per 10 minuti; il pellet, così ottenuto, è stato risospeso in 25 ml di brodo YEPD. Questa procedura è stata applicata anche per gli starter com-
  • 69. Capitolo 4. Selezione dei ceppi e prove di microvinificazionemerciali usualmente impiegati in ciascuna rispettiva cantina, alfine di avere una comparazione effettiva nelle medesime condi-zioni. Essi sono stati denominati con la sigla “ceppo S”. COMPOSIZIONE BRODO YEPD (g/L) 10 g estratto di lievito 20 g peptone 20 g glucosio 0,1 g cloranfenicolo 1l acqua distillata pH 5,5Tabella 4.3 Composizione del brodo YEPD Successivamente è stato organizzato il trasferimento delle col-ture cellulari, in condizioni strettamente refrigerate, per la realiz-zazione delle prove di tiraggio presso ciascuna delle otto can- 71tine. Tale attività ha richiesto il coinvolgimento diretto di alcunienologi franciacortini ed oltrepadani sia nella fase di formulazio-ne del pied de cuve che nella programmazione delle prove diadattamento e di inoculo.4.5 Preparazione del pied de cuve e protocollo di rifermentazione A ciascuna cantina è stato fornito un kit per la preparazionedel pied de cuve contenente:• 25 ml delle colture cellulari concentrate, dei 3 ceppi presi in esame (ceppo X,Y e S);• 7 g di attivante (Bioenologia s.r.l., Italy) di cui 1g, 2g e 4g erano suddivisi in tre differenti provette;• 3 ml di coadiuvante 83 (Station Oenotechnique de champa- gne, France), contenente bentonite necessaria per la chiarifi- cazione del vino. Il kit è stato trasferito presso ciascuna cantina e conservato aduna temperatura di 4 °C per un massimo di 3 giorni prima dell’u-tilizzo. A 50 l di vino base da rifermentare è stata aggiunta la quantità
  • 70. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… di zucchero tale da generare una pressione pari a 6 atmosfere; questo, successivamente, è stato sottoposto a filtrazione amicro- bica ed è stata impiegato nel protocollo di rifermentazione. Il protocollo di rifermentazione messo a punto prevedeva i se- guenti passaggi: • Trasferire 25 ml di coltura cellulare concentrata in 0,25 l di ac- qua a 30°C; • Dopo 30 min aggiungere 0,25 l di vino, precedentemente ri- scaldato a 24°C; • Dopo 4 ore, aggiungere 0,5 l di vino a 24°C e 1g di attivante, avendo cura di omogeneizzare; • Dopo 4 ore, aggiungere 0,5 l di vino a 24°C e 2g di attivante, avendo cura di omogeneizzare; • Dopo una notte, aggiungere 1 l di vino a 20°C e 4g di attivan- te, avendo cura di omogeneizzare; • Aggiungere 3 ml di coadiuvante ai 50 l di vino base già zuc-72 cherato e rimescolare accuratamente; • Aggiungere tutto il pied de cuvée (2,325 l) alla massa di vino da rifermentare. 4.6 Monitoraggio delle prove di tirage L’andamento della rifermentazione è stata controllato a diver- si intervalli di tempo. Da ciascuna cantina sono state prelevate 2 bottiglie per ciascun ceppo test e sono state condotte le valu- tazioni della concentrazione cellulare, le valutazioni della vitalità cellulare ed l’identificazione genetica dei ceppi. La determinazione della concentrazione cellulare è stata ef- fettuata in doppio. Ciascun campione, adeguatamente diluito in acqua peptonata tamponata, è stato piastrato su terreno WL (Merck, Germany), la cui composizione è riportata in tabella 4.4. Le piastre sono state successivamente incubate a 25 °C per 3 giorni. Dopo la conta visiva delle colonie cresciute su piastra, da ciascuna di esse sono state prelevate casualmente 3 colonie, che presentavano le tipiche caratteristiche morfologiche di S. cerevisiae; queste sono state isolate su terreno YEPD e successi- vamente impiegate per la caratterizzazione genetica.
  • 71. Capitolo 4. Selezione dei ceppi e prove di microvinificazione Per il calcolo della concentrazione cellulare in unità formanticolonia (UFC) è stata applicata la formula della media ponde-rale: COMPOSIZIONE TERRENO WL (g/L) 4g Estratto di lievito 5g Caseina idrolizzata 50 g Glucosio 0,55 g Potassio diidrogenofosfato 0,425 g Cloruro di potassio 0,125 g Cloruro di calcio 0,125 g Solfato di magnesio 0,0025 g Cloruro di ferro 0,022 g Verde di bromo cresolo 17 g Agar pH 5,5Tabella 4.4 Composizione del terreno WL 73 Per ciò che riguarda la vitalità cellulare, come descritto daDelfini e Formica (2001), la valutazione è stata fatta direttamenteattraverso conta al microscopio; 1 ml di campione è stato riso-speso in 1 ml di soluzione di blu di metilene (la cui composizioneè riportata in tabella 4.5). SOLUZIONE BLU DI METILENE (g/L) 0,2 g blu di metilene 27,2 g KH2PO4 0,071 g Na2HPO4 1l acqua distillataTabella 4.5 Composizione della soluzione blu di metilene Dopo 5 minuti, 10 μl di questa soluzione sono stati pipettati nel-la camera di Thoma (Marienfeld GmbH & Co, Germany) ed èstata eseguita la conta al microscopio (CH-2, Olympus OpticalCo. LTD, Japan). La conta finale delle cellule di lievito si è basatasulla determinazione del numero di cellule vive e morte.
  • 72. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… Al fine di determinare la permanenza dei ceppi autoctoni sele- zionati per la prova di rifermentazione le colonie isolate dalle bot- tiglie sono state identificate e tipizzate, attraverso amplificazione delle sequenze interdelta (vedi capitolo 3). I campioni sono stati assaggiati dopo 6, 12 e 18 mesi dopo il tiraggio; anche in questo caso, l’intensità e la gradevolezza sono state valutate impiegando la scheda riportata in Figura 4.1 e l’a- nalisi statistica dei dati è stata condotta come descritto in para- grafo 4.3.3 4.7 Risultati delle prove di microvinificazione per la selezione dei ceppi Sedici ceppi autoctoni di S. cerevisiae sono stati sottoposti ad un indagine preliminare, attraverso prove di microvinificazione in mosto Pignoletto, al fine di valutare quali tra questi potesse esse-74 re impiegato eventualmente come starter. I caratteri tecnologici presi in considerazione sono stati il vigore fermentativo, definito come la capacità di ciascun ceppo di avviare prontamente la fermentazione (Giudici e Zambonelli,1992) e la quantità totale di anidride carbonica prodotta durante la fermentazione, che funge da misura indiretta per ciò che riguarda la produzione di etanolo e dà indicazioni circa il potere fermentativo di ciascun ceppo. La figura 4.2 mostra l’andamento della fermentazione, in fun- zione della perdita di peso dovuta alla produzione di anidride carbonica.
  • 73. Capitolo 4. Selezione dei ceppi e prove di microvinificazione S1 S2 C273 264 C278 262 C277 C276 260perdita C275di peso 258 C91 (g) C90 256 C114 C48 254 C58 C61 252 C101 250 C49 C70 248 C67 0 24 48 72 96 120 144 168 192 216 240 264 288 C94 TEMPO (ore) 75Fig. 4.2 Andamento della fermentazione in mosto sterie bianco 4,00 Microfermentation test: fermentative vigour 3,50 3,00 2,50 2,00 C02(g) 1,50 1,00 0,50 0,00 C90|C276|C91|C277|C275|C2748|S1|C273|C114|C70|C67|C101|C49|S2|C94|C61|C58|C48Fig. 4.3 Vigore fermentativo dei ceppi in mosto sterile bianco Il vigore fermentativo (espresso come g di CO2 prodotte nelleprime 48 h a seguito dell’inoculazione del mosto) è più elevatonei ceppi C58 e C48 con, rispettivamente, 3,02 g e 3,79 g di CO2prodotta nelle prime 48 h (Figura 4.3).
  • 74. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… Per ciò che concerne la produzione di etanolo, tutti i ceppi autoctoni mostrano una produzione comparabile a quella degli starter (denominati con la sigla S1 ed S2); unicamente il ceppo C 276 mostra una produzione ridotta rispetto agli altri ceppi (Figura 4.4). 14,00 Microfermentation test: alcohol production 13,00 di etanolo (%v/v) Concentrazione 12,00 % v/v 11,00 10,00 9,00 C276|C61|C101|C90|C114|C91|S1|C278|C275|C277|C273|C58|C49|C70|S2|C67|C48|C9476 Fig. 4.4 Produzione di etanolo in mosto sterile bianco In particolare, i ceppi provenienti dal territorio della Francia- corta si collocano in un range di etanolo prodotto tra il 9,5 e il 13,2 % v/v, mentre i ceppi provenienti dal territorio dell’Oltrepò Pavese si collocano tra il 13 e il 13,8 % v/v. I caratteri qualitativi presi in considerazione sono stati le produzio- ni di glicerolo, le produzioni di acido acetico e le produzioni di H2S. Per ciò che riguarda i primi due aspetti, i risultati sono riportati in figura 4.5 e 4.6; quasi tutti i ceppi hanno prodotto quantità di gli- cerolo comparabili a quelle prodotte dallo starter mentre alcuni hanno prodotto quantità inferiori (da 0,8 a 0,25 g/l). Le produzioni di acido acetico sono state limitate per tutti i ceppi (da 0,17 a 0,37 g/l), in accordo con i massimi limiti definiti per legge.
  • 75. Capitolo 4. Selezione dei ceppi e prove di microvinificazione 0,30 Microfermentation test: glycerol production 0,25 0,20g/l 0,15 g/L 0,10 0,05 0,00 S1|C273|C67|C275|C70|C277|C276|C94|C91|C61|S2|C90|C91|C61|C48|C101|C278|C49Fig. 4.5 Produzione di glicerolo da parte dei ceppi 1 Microfermentation test: acetic acid Production 0,5 77 g/Lg/l 0 C277|C70|C67|S2|C58|C94|C61|C48|C101|C49|C91|C273|C276|S1|C278|C90|C114|C275Fig. 4.6 Produzione di acido acetico da parte dei ceppi Nel caso della produzione di H2S, valutata su terreno BIGGY-agar, la determinazione è stata fatta in base al colore delle colo-nie e in base alla scala riportata da Redzepovic (2002). La mag-gior parte dei ceppi erano caratterizzati da bassa produzione(circa il 75%) mentre il 25 % era caratterizzato da media produ-zione di H2S (Tabella 4.6).
  • 76. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… PRODUZIONE DI H2S CEPPO C273, C275, C48, C58, C67, C94, Bassa produzione C61, C101, C94, C70, C278, C277 Media produzione C276, C91, C90, C114 Tabella 4.6 Elenco dei ceppi in funzione della H2S prodotta I campioni provenienti dai test di microvinificazione, condotti con ceppi autoctoni provenienti dal territorio della Franciacorta e dal territorio dell’Oltrepò Pavese, sono stati sottoposti a test di sniffing. I risultati medi ottenuti, per quanto riguarda la gradevo- lezza in Franciacorta, sono riportati in figura 4.7.78 Fig. 4.7 Rappresentazione grafica dei valori medi di gradevolezza assegnati dai giudici ai campioni provenienti dalla Franciacorta
  • 77. Capitolo 4. Selezione dei ceppi e prove di microvinificazione L’analisi statistica dei dati, condotta sui caratteri di intensità edi gradevolezza, è stata condotta tramite analisi della varianzamultifattoriale (ANOVA). L’analisi della varianza multifattoriale ha permesso di capirequali valori erano significativamente diversi dagli altri, attraver-so il metodo LSD (Least Significant Difference); in particolare, nelcaso della gradevolezza, per ciò che riguarda il territorio dellaFranciacorta, 2 ceppi hanno mostrato di essere diversi in manierasignificativa dagli altri (C273 e C90). I risultati medi ottenuti, per ciò che riguarda la gradevolezza inOltrepò Pavese, sono riportati in figura 4.8. 79Fig. 4.8 Rappresentazione grafica dei valori medi di gradevolezza assegnati dai giudiciai campioni provenienti dall’Oltrepò Pavese
  • 78. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… Per ciò che riguarda la gradevolezza dei ceppi provenienti dall’Oltrepò Pavese, sono stati il ceppo C48 e il C58 a mostrarsi significativamente diversi dagli altri [intervallo di confidenza 95%, (p<0,05]. Nel caso dell’intensità, per ciò che riguarda il territorio della Franciacorta, i campioni significativamente diversi sono stati il C 276 e il C91 mentre per il territorio dell’Oltrepò Pavese, il campio- ne più intenso è stato il C49. 4.8 Risultati delle prove di rifermentazione Sulla base dei risultati descritti precedentemente, sono stati se- lezionati i ceppi autoctoni per le prove di rifermentazione dei vini base 2011 denominati rispettivamente X (C273 in Franciacorta, C58 in Oltrepò Pavese) e Y (C275 in Franciacorta, C48 in Oltre- pò Pavese). Questi sono stati impiegati in 5 cantine del territorio80 della Franciacorta e in 3 cantine dell’Oltrepò pavese. Gli star- ter commerciali impiegati in queste prove (denominati ceppi S) sono stati impiegati come controllo. Monitoraggio dei tiraggi in Franciacorta La rifermentazione è stata monitorata a differenti intervalli di tempo a partire dal T0, che corrisponde al primo giorno di imbot- tigliamento del vino; da ciascuna cantina sono state prelevate 2 bottiglie per ciascun ceppo test su cui sono state condotte le seguenti analisi: valutazione della concentrazione cellulare, va- lutazione della vitalità cellulare ed identificazione genetica. Per ciò che riguarda la concentrazione cellulare, essa è stata valutata tramite piastramenti in terreno WL, in duplice copia. I risultati per ciascuna cantina, della Franciacorta, sono riportati in Figura 4.9.
  • 79. Capitolo 4. Selezione dei ceppi e prove di microvinificazioneFig. 4.9 Andamento della concentrazione cellulare durante le prove di rifermentazionenelle cantine in Franciacorta Cantina 1 Franciacorta winery 1. Trend of cell concentration 1,00E+07 1,00E+06 1,00E+05 Strain X UFC/ml 1,00E+04 Strain Y Strain S 1,00E+03 1,00E+02 1,00E+01 T0 T30 T60 T90 T120 Time (days) Cantina 2 Franciacorta winery 2. Trend of cell concentration 1,00E+07 81 1,00E+06 1,00E+05 Strain X UFC/ml 1,00E+04 Strain Y Strain S 1,00E+03 1,00E+02 1,00E+01 T0 T30 T60 T90 T120 Time (days) Cantina 3 Franciacorta winery 3. Trend of cell concentration 1,00E+07 1,00E+06 1,00E+05 Strain X UFC/ml 1,00E+04 Strain Y Strain S 1,00E+03 1,00E+02 1,00E+01 T0 T30 T60 T90 T120 Time (days)
  • 80. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… Cantina 4 Franciacorta winery 4. Trend of cell concentration 1,00E+07 1,00E+06 1,00E+05 Strain X UFC/ml 1,00E+04 Strain Y 1,00E+03 1,00E+02 1,00E+01 T0 T30 T60 T90 T120 Time (days) Cantina 582 L’andamento della concentrazione cellulare dei ceppi X e Y è risultato pressoché similare, mentre per ciò che riguarda gli star- ter commerciali, in molti casi, si è evidenziato un declino veloce nel tempo, probabilmente dovuto all’elevato vigore fermentati- vo di questi ceppi. I ceppi autoctoni e gli starter commerciali non presentavano mai una fase di crescita esponenziale ma, piuttosto, un mante- nimento costante della popolazione nel tempo ed un rapido declino al termine del processo. I ceppi autoctoni presentavano un più basso vigore fermentativo rispetto agli starter e ciò spiega perché le cellule dei ceppi autoctoni sono riscontrate in piastre al tempo 120, mentre gli starter commerciali si fermano al tempo 90. Per ciò che riguarda la vitalità cellulare, il 100% di cellule vive si riscontra fino a che esse compaiono nei piastramenti, approssi- mativamente fino al termine del monitoraggio.
  • 81. Capitolo 4. Selezione dei ceppi e prove di microvinificazione Al fine di verificare i risultati inerenti l’andamento della concen-trazione cellulare in fermentazione, nonché la presenza e la pre-dominanza dei ceppi autoctoni, sia quest’ ultimi che gli startersono stati sottoposti ad identificazione e tipizzazione genetica,attraverso l’amplificazione delle regioni interdelta. A titolo d’esempio la figura 4.10, illustra i risultati al T60. M1 2 3 4 5 6 7 8 9 10 1112 131415 16 17 1819 M X Y 83Fig.4.10 Profilo interdelta dei ceppi isolati dalle bottiglie al T60, durante il tiraggio 2011condotto in FranciacortaM = Marker Ladder 100 bp XL;1 = Ceppo starter X di controllo;2-6 = Ceppi starter X, provenienti dalle bottiglie inoculate in tutte le cantine;7 = Ceppo Y di controllo;8-10 = Ceppi starter Y, provenienti dalle bottiglie inoculate, rispettivamente nella can-tina 1,2 e 3;11 = starter commerciale SC1, proveniente da bottiglie inoculate con ceppo Y nellacantina 5;12 = Ceppo starter X, proveniente da bottiglie inoculate con ceppo Y nella cantina 4;13 =starter commerciale SC1 di controllo;14-16 = starter commerciale SC1, proveniente da bottiglie inoculate con ceppo S, ri-spettivamente nelle cantine 1,3 e 5;17 = starter commerciale SC3 di controllo;18 = starter commerciale SC3, proveniente da bottiglie inoculate con ceppo S, nellacantina 2;19 = profilo elettroforetico di un isolato proveniente da bottiglie inoculate con ceppoY, nella cantina 4.
  • 82. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… I risultati ottenuti a seguito di amplificazione delle regioni inter- delta sono stati i seguenti: • Ceppo indigeno starter X: il 100% dei profili elettroforetici delle colonie analizzate corrispondono al profilo dello starter indige- no X, in tutte le cantine della Franciacorta; • Ceppo indigeno starter Y: il 60% dei profili elettroforetici delle colonie analizzate corrispondono al profilo dello starter indige- no Y, in 3 cantine. Il 20% dei profili elettroforetici corrispondono allo starter commerciale SC1 e il restante 20% dei profili elettro- foretici corrispondono al ceppo X; • I ceppi starter commerciali SC1, impiegati nelle cantine 1,3 e 5 ,dominano in tutti i test condotti, come anche il ceppo SC3 nella cantina 4; • Un solo profilo di un isolato proveniente dalle bottiglie della cantina 4 non corrisponde né ai ceppi autoctoni né agli star- ter commerciali, anche se risulta essere molto simile al ceppo84 commerciale SC3. I campioni di vino sono stati sottoposti, infine, ad assaggio a 6 mesi dal termine del tirage; la valutazione sensoriale è stata condotta sia per i campioni inoculati con ceppo X e Y che per i campioni inoculati con lo starter commerciale S. Un panel di 11 assaggiatori, compresi gli enologi di ciascuna cantina coinvolta nel test, hanno effettuato la prova. I risultati per ciò che riguarda la gradevolezza e l’intensità olfattiva, sono riportati in Figura 4.11 e 4.12.
  • 83. Capitolo 4. Selezione dei ceppi e prove di microvinificazione Pleasantness of Franciacorta wine samples at 6 months of tirage proves 10 9 8 7 C 6 BC punteggio ABCscore 5 AB 4 A 3 2 1 0 S2 Y2 X1 Y3 S3 Y4 Y1 X5 Y5 S1 X2 X3 X4 X5 S4 Fig. 4.11 Gradevolezza dei campioni di vino spumante a 6 mesi dal tirage, condotto con ceppi autoctoni provenienti dalla Franciacorta Intensity of Franciacorta wine samples at 6 months of tirage proves 10 9 8 7 BCD CD D 85 ABCD punteggio 6 AB ABC Ascore 5 4 3 2 1 0 X2 Y2 S3 Y1 Y3 Y4 X1 X4 S5 X3 X5 Y5 S2 S1 S4 Fig. 4.12 Intensità dei campioni di vino spumante a 6 mesi dal tirage, condotto con ceppi autoctoni provenienti dalla Franciacorta Per ciò che riguarda la gradevolezza, per valutare le differenze significative tra i vari campioni, è stato impiegato il metodo LSD [intervallo di confidenza del 95%, (p<0,05]. Dall’analisi dei risultati di gradevolezza è stato evidenziato che unicamente il ceppo S, proveniente dalla cantina 4 risulta diffe- rente dagli altri. Infatti, gli altri ceppi si distribuiscono in un gruppo omogeneo (A, B e C). I valori di intensità, invece, evidenziano un gruppo omogeneo (A, B, C e D), e in accordo con i risultati inerenti alla gradevolez-
  • 84. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… za, il ceppo S risulta differente dagli altri. Inoltre, il ceppo X, pro- veniente dalla cantina 2, risulta significativamente meno intenso rispetto agli altri. Comunque sia, l’80% dei ceppi X, si colloca nel gruppo BC che racchiudeva i valori maggiori di gradevolezza riscontrati durante l’assaggio; nello stesso gruppo sono presenti circa il 40% dei ceppi Y. In conclusione, si può affermare che alcuni starter autoctoni, hanno ricevuto valori più elevati sia per la gradevolezza che per l’intensità, rispetto agli starter commerciali. Monitoraggio dei tiraggi in Oltrepò Pavese I ceppi X (C58) e Y (C48) sono stati impiegati come starter in 3 cantine dell’Oltrepò Pavese. Anche in questo caso, gli star- ter commerciali impiegati comunemente da ciascuna cantina, sono stati impiegati come controlli (ceppi S). La concentrazione cellulare, mostra un andamento simile tra i86 ceppi autoctoni e gli starter nella cantina 7, mentre nelle restanti 2 cantine l’andamento è differente (Fig. 4.13); anche in questo caso, come era accaduto nel caso della Franciacorta, i ceppi autoctoni mostrano un vigore fermentativo inferiore rispetto ai ceppi starter, dando il via alla fermentazione più tardi rispetto a quest’ultimi. Cantina 6 Oltrepò Pavese winery 8. Trend of cell concentration 1,00E+08 1,00E+07 1,00E+06 Strain X UFC/ml 1,00E+05 Strain Y 1,00E+04 Strain S 1,00E+03 1,00E+02 1,00E+01 T0 T30 T60 T90 T120 Time (days)
  • 85. Capitolo 4. Selezione dei ceppi e prove di microvinificazione Cantina 7 Oltrepò Pavese winery 6. Trend of cell concentration 1,00E+08 1,00E+07 1,00E+06 Strain X UFC/ml 1,00E+05 Strain Y 1,00E+04 Strain S 1,00E+03 1,00E+02 1,00E+01 T0 T30 T60 T90 T120 Time (days) Cantina 8 Oltrepò Pavese winery 7. Trend of cell concentration 1,00E+08 1,00E+07 1,00E+06 Strain X UFC/ml 1,00E+05 87 Strain Y 1,00E+04 Strain S 1,00E+03 1,00E+02 1,00E+01 T0 T30 T60 T90 T120 Time (days)Fig. 4.13 Andamento della concentrazione cellulare durante le prove di tirage nellecantine in Oltrepò pavese Nelle cantine in Oltrepò Pavese il processo fermentativo, con-dotto dai ceppi autoctoni e dagli starter commerciali, mostracaratteristiche molto simili a quello riscontrato in Franciacorta. In-fatti, la popolazione micetica si mantiene costante nel tempo emanifesta un rapido declino al termine del processo. Anche i dati inerenti la vitalità cellulare si mostrano simili a quelliriscontrati in precedenza; infatti, nelle cantine 6 e 8 le cellule vive,nel caso dei ceppi autoctoni, si riscontrano fino al T120 , quindi ap-prossimativamente fino al termine del monitoraggio. Anche i ceppi impiegati in Oltrepò Pavese sono stati sottopo-sti ad identificazione e tipizzazione, tramite amplificazione delleregioni interdelta; qui di seguito è riportato un gel elettroforetico,riferito al T60 (Fig. 4.14)
  • 86. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… 1 2 3 4 5 6 7 8 9 10 11 12 13 14 M x y Fig. 4.14 Profilo interdelta dei ceppi isolati dalle bottiglie al T60, durante il tirage 2011 condotto in Oltrepò pavese 1 = Ceppo starter X di controllo; 2-4 = Ceppi starter X, provenienti da bottiglie a seguito di inoculazione in tutte le can-88 tine; 5 = Ceppo starter Y di controllo; 6-8 =Ceppi starter Y, provenienti da bottiglie a seguito di inoculazione in tutte le can- tine; 9= Ceppo starter commerciale SC1 di controllo; 10-11= Ceppi starter SC1, provenienti da bottiglie a seguito di inoculazione in cantine 6 e 7; 12 = Ceppo starter commerciale SC3 di controllo; 13 = Ceppi starter SC3, provenienti da bottiglie a seguito di inoculazione (denominato ceppo S) in cantina 8; 14 = profilo elettroforetico di un ceppo isolato in bottiglie inoculate con ceppo X nella cantina 6; M = Marker Ladder 100 bp XL. Dai profili elettroforetici, ottenuti attraverso amplificazione del- le regioni interdelta, è possibile confermare che entrambi i ceppi autoctoni, X e Y, hanno dominato la fermentazione al 100% in tutte le cantine. I risultati sono identici per ciò che riguarda le fer- mentazioni condotte dagli starter commerciali. Il test ha inoltre confermato l’efficacia delle procedure in cantina, dato che nel 99% dei casi, nessun tipo di contamina- zione era presente. È interessante notare, infine, come i profili interdelta dei due starter commerciali siano simili tra di loro; si potrebbe ipotizzare che appartengano allo stesso ceppo. An-
  • 87. Capitolo 4. Selezione dei ceppi e prove di microvinificazione che questi campioni di vino spumante sono stati sottoposti ad analisi delle caratteristiche sensoriali, a 6 mesi dal tirage 2011. L’intensità e la gradevolezza sono state valutate attraverso l’im- piego della scheda riportata nel paragrafo 2.3.4, da un panel di assaggiatori composto da 13 soggetti. I risultati sono mostrati in fig. 4.15 e 4.16. Pleasantness of Oltrepò pavese wine samples at 6 months of tirage proves 10 9 8 7 C BC punteggio 6 ABC ABscore 5 A 4 3 2 1 0 89 Y7 X8 X7 S6 S8 S7 Y6 X6 Y8 Fig. 4.15 Gradevolezza dei campioni di vino spumante a 6 mesi dal tirage, condotto con ceppi autoctoni provenienti dall’Oltrepò pavese Intensity of Oltrepò pavese wine samples at 6 months of tirage proves 10 9 8 7 D BCD CD punteggio 6 ABCD ABCscore 5 AB A B 4 3 2 1 0 Y7 X7 Y6 S7 X6 S6 X8 S8 Y8 Fig. 4.16 Intensità dei campioni di vino spumante a 6 mesi dal tirage, condotto con ceppi autoctoni provenienti dall’Oltrepò pavese
  • 88. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… Per ciò che riguarda la gradevolezza emergono 3 gruppi omo- genei (A, B e C), con un unico ceppo (Y proveniente dalla canti- na 8) che risulta essere significativamente più gradevole rispetto agli altri (p<0,05). I risultati inerenti l’intensità evidenziano 4 gruppi omogenei (A, B, C, e D); anche in questo caso solo il ceppo Y (cantina 8) risulta essere significativamente più intenso rispetto agli altri. Il ceppo Y, nella cantina 7 invece, si mostra significativamente meno gradevole e meno intenso rispetto agli altri. Il ceppo che ha ottenuto i migliori risultati in termini di gradevolezza, è il ceppo X della cantina 6 che eguaglia quasi tutti i campioni inoculati con starter commerciali. 4.9 Discussione e conclusioni La selezione di lieviti autoctoni da impiegare in fermentazione,90 per migliorare le caratteristiche sensoriali del prodotto finito e va- lorizzare quest’ultimo incrementandone la tipicità, è sempre più oggetto di studio. Ne è un esempio il lavoro condotto in Sicilia (Capece, 2010) in cui sono stati isolati S. cerevisiae provenienti da diverse aree del territorio. A seguito di tipizzazione, mediante RAPD-PCR sono stati selezionati due ceppi, impiegati poi in fer- mentazione. Il monitoraggio dei ceppi autoctoni inoculati, è sta- to condotto tramite restrizione enzimatica del DNA mitocondria- le. I risultati mostravano un incremento della qualità del prodotto finito, soprattutto dal punto di vista olfattivo, ma i ceppi autoc- toni impiegati come starter non dominavano la fermentazione. Stesso tipo di lavoro è stato condotto recentemente a Lecce (Tristezza, 2012), in cui sono stati selezionati due ceppi di S. ce- revisiae per condurre la fermentazione in un vino Negroamaro; l’unica variante rispetto al lavoro precedente è stato l’impiego dell’amplificazione interdelta per la tipizzazione dei ceppi, in ac- cordo con quanto effettuato in questo lavoro. Anche in questo caso i risultati sono stati positivi, con una netta predominanza dei ceppi autoctoni selezionati per la rifermentazione e un migliora- mento delle caratteristiche sensoriali del vino Negroamaro. In questo lavoro, sono state eseguite prove di microvinificazio- ne su 16 ceppi, isolati e identificati nella vendemmia 2009 sia nel
  • 89. Capitolo 4. Selezione dei ceppi e prove di microvinificazioneterritorio franciacortino che nel territorio dell’Oltrepò Pavese, chesono risultati diversi a seguito delle indagini genetiche dagli star-ter commerciali impiegati dalle cantine che hanno partecipatoalla sperimentazione. Per ciò che riguarda il potere fermentativo ed il vigore fermen-tativo, dei 16 ceppi analizzati due in particolare hanno mostratovalori elevati (C58 e C48), mentre nel caso della produzione dietanolo tutti i ceppi, tranne uno, hanno mostrato un grado ditolleranza paragonabile a quello mostrato dagli starter commer-ciali (tra 9,5 e 13,2 % v/v). Oltre ai parametri tecnologici è stata valutata la produzionedi glicerolo e di acido acetico; la produzione in mosto per quasitutti i ceppi è risultata comparabile a quella degli starter com-merciali, tranne per alcuni le cui produzioni sono state limitate(0,8-0,25 g/l); in ogni caso le quantità prodotte sono risultate piùbasse di quanto mediamente riportato in letteratura, dove si ri-scontrano in genere quantità da 1 a 15 g/l (Scanes, 1998) anchese nei vini bianchi la produzione risulta più bassa rispetto ai vini 91rossi (Pretorius, 2000). Nel caso dell’acido acetico, le produzioni sono state limitateper tutti i ceppi sottoposti ad analisi (da 0,17 a 0,37 g/l); ciò risultamolto importante in quanto produzioni oltre 1 g/l sono indice didifetto e di prodotto non gradevole. In particolare si distingue,tra i ceppi, l’isolato C 277 che ha prodotto quantità minime diquesto indesiderato acido. I campioni ottenuti a seguito delle prove di microvinificazionesono stati sottoposti a confronto olfattivo per valutarne la gra-devolezza e l’intensità aromatica, attraverso un giudizio espressoda un panel di assaggiatori composto anche da enologi delledifferenti cantine che hanno partecipato alla sperimentazione;differenti lavori riportati in letteratura confrontano le caratteristi-che sensoriali apportate al vino da starter commerciali e ceppiautoctoni (Mora, 1990; Longo, 1992; Gafner, 1993; Lema, 1996),ma pochi tra questi si focalizzano sulle differenze sensoriali attra-verso l’impiego di un panel di assaggiatori. Dai risultati ottenuti per ciò che riguarda il parametro di grade-volezza è stato possibile individuare due ceppi per ciascun ter-ritorio, che presentavano differenze significative rispetto agli altriceppi; per la Franciacorta, i ceppi C273 e C90 hanno ricevuto i
  • 90. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… valori più alti in termini di gradevolezza, mentre per l’Oltrepò Pa- vese sono stati i ceppi C48 e C58 a mostrarsi tra i migliori. Sulla base dei risultati ottenuti dalle prove di microvinificazio- ne, sia per quanto riguarda caratteristiche tecnologiche e qua- litative sia per ciò che riguarda le caratteristiche sensoriali dei campioni, sono stati selezionati due ceppi per ciascun territorio e impiegati come starter nelle prove di tirage 2011. Al fine di valutare la predominanza dei ceppi inoculati in rifer- mentazione sono state condotte prove di monitoraggio quali la determinazione della concentrazione cellulare, la vitalità cellula- re, e l’analisi delle regioni interdelta. Per ciò che riguarda la concentrazione cellulare in tutte le can- tine, di entrambi i territori, si registrano i medesimi risultati; i ceppi autoctoni, presentando un vigore fermentativo inferiore rispetto agli starter commerciali, danno il via alla fermentazione più tardi rispetto a quest’ultimi e si riscontrano in piastra in tempi superiori del monitoraggio rispetto agli starter. Questi risultati sono confer-92 mati dall’analisi della vitalità che mostra cellule vive e vitali fino al termine del monitoraggio. Inoltre al fine di verificare l’effettiva predominanza dei ceppi autoctoni inoculati in rifermentazione, è stata effettuata l’analisi delle regioni interdelta ad ogni tempo del monitoraggio. Come riportato in letteratura (Ness, 1993), la stabilità delle sequenze in- terdelta è stimata in 300 generazioni; tale risultato in natura assu- me un significato molto importante per ciò che concerne la sta- bilità genetica di sequenze, che possono essere impiegate quali target molecolari nello studio di tipizzazione di S. cerevisiae. E’ infatti improbabile, che in condizioni reali di sviluppo, un micror- ganismo possa svilupparsi un numero così elevato di volte senza incorre in condizioni ambientali avverse che ne ridurrebbero le capacità di crescita o addirittura la vitalità. I risultati ottenuti dall’amplificazione delle regioni interdelta mostrano come i ceppi selezionati per le prove di tirage con- ducano effettivamente la rifermentazione ed inoltre dimostrano come le procedure svolte nelle cantine siano efficaci, in quanto al 99% dei casi nessun tipo di contaminazione è stata riscontrata. L’ultima fase del lavoro ha previsto un’analisi sensoriale dei campioni provenienti dalle prove di rifermentazione, a 6 mesi dal termine del tirage; per ciò che riguarda la gradevolezza dei
  • 91. Capitolo 4. Selezione dei ceppi e prove di microvinificazionecampioni della Franciacorta quasi tutti hanno mostrato risultatiomogenei comparabili con quelli offerti dagli starter, tranne cheper lo starter della cantina 4 che si mostra significativamente piùgradevole rispetto agli altri. In generale stessi risultati si sono ot-tenuti per ciò che riguarda il parametro intensità, in cui lo starterdella cantina 4 anche in questo caso si mostra significativamen-te più intenso rispetto agli altri. Nel caso dell’Oltrepò Pavese, siain termini di gradevolezza che di intensità spicca uno dei dueceppi autoctoni impiegati come starter, isolato dalla cantina 8,che si mostra significativamente più gradevole e più intenso ri-spetto agli altri campioni. In conclusione, i ceppi selezionati per le prove di rifermentazio-ne mostrano performance sia qualitative che tecnologiche com-parabili a quelle degli starter attualmente impiegati dalle canti-ne coinvolte nella sperimentazione. La possibilità di selezionareceppi autoctoni con proprietà tecnologiche utili e caratteristi-che di qualità idonee al tipo di prodotto, assume un importanzanotevole, in quanto oltre a salvaguardare la comunità microbi- 93ca indigena, è possibile la valorizzazione del prodotto tipico at-traverso l’evidenza del legame tra il territorio e il prodotto finito.L’impiego di lieviti autoctoni, infatti, ha già consentito il migliora-mento qualitativo del vino e la salvaguardia delle popolazioniautoctone in svariate regioni d’Italia. Ne è un esempio il lavoro inVeneto (Torriani,1999) in cui sono stati selezionati ceppi autoctonidi S. cerevisiae, nell’area della Valpolicella, al fine di valorizzare ilvino Amarone. A ulteriore testimonianza anche i lavori condotti inSicilia (Giudici, 1997) e nelle Marche (Guerra, 1999), che presen-tavano identici scopi. La selezione di differenti ceppi diventa fondamentale in quan-to è ormai ampiamente dimostrato in letteratura, che vini ot-tenuti a partire da differenti ceppi di S. cerevisiae, presentanocaratteristiche sensoriali differenti (Nikolaou, 2007, Chavan, 2009,Tosi, 2009). A maggior ragione ciò si verifica nei vini spumantiprodotti secondo il metodo classico, in cui i lieviti non si limitanonel portare a termine la prima e la seconda fermentazione, macontribuiscono in modo fondamentale a definire ciò che sarà ilprofilo sensoriale ultimo del prodotto finito. Tutto ciò attraversola cessione di sostanze durante il fenomeno dell’autolisi cellulare(Ribereau-Gayon,1998).
  • 92. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… In definitiva, tale lavoro, rappresenta un primo passo verso la futura selezione di ceppi autoctoni da impiegare come starter durante la produzione di vino spumante, che permetterà sia al territorio della Franciacorta che al territorio dell’Oltrepò Pavese di aumentare ancor di più la qualità dei rispettivi prodotti D.O.C.G. attraverso un legame indelebile con le caratteristiche proprie dei due territori.94
  • 93. Capitolo 5. Il destino del DNA nello spumanteCapitolo 5. Il destino del DNA nello spumante5.1 Tracciabilità di Saccharomyces cerevisiae in prove di spu-mantizzazione Sia il Franciacorta D.O.C.G. che l’Oltrepò Pavese D.O.C.G.vengono preparati secondo il “metodo classico” che prevedela rifermentazione in bottiglia per la presa di spuma. Al vino base,precedentemente ottenuto dalla miscelazione di vini sotto la su-pervisione dell’enologo viene aggiunta una miscela di zucche-ro e di lieviti (liquer de tirage), con successiva fermentazione in 95bottiglia che terminerà entro qualche settimana, determinandoall’interno di quest’ultima una sovrapressione di almeno 3 bar,misurata a 20° C. Alla fase di rifermentazione segue la maturazione dello spu-mante sulle proprie fecce che in conseguenza dei fenomeniautolitici delle cellule di lievito, consentirà di ottenere le ca-ratteristiche sensoriali al prodotto finito. La fase di maturazioneviene protratta per tempi notevolmente variabili, a seconda deidisciplinari consorziali e dei criteri stabiliti dalle varie aziende: vada un minimo di 15 mesi a un massino di 6 anni. Ed è propriodurante questo arco di tempo che si verifica la morte cellularecon l’autolisi delle cellule di lievito (Fig. 5.1), determinata dal-la degradazione di biopolimeri intracellulari ad opera di enzimiidrolitici, che portano alla formazione di prodotti a basso pesomolecolare.
  • 94. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… Fig. 5.1 Cellule di lievito durante il processo di autolisi96 I tre fenomeni che caratterizzano l’autolisi dei lieviti in ambien- te acido sono: • proteolisi, che comporta la degradazione delle componenti cellulari interne, coinvolgendo maggiormente le componenti proteiche; • degradazione della parete cellulare, che determina il rilascio di polisaccaridi, oligosaccaridi e monosaccaridi parietali; • formazione di composti volatili quali gli acil-esteri a corta cate- na (C3-C4) e a media catena (C6-C12); sono il maggior grup- po di composti volatili prodotti nella fase dell’autolisi. Le sostanze che scaturiscono dal processo autolitico hanno un impatto importante su quello che sarà il prodotto finito. Si anno- verano sostanze del gruppo dei carboidrati, quali gluco-manna- ni, che impartiscono allo spumante un sapore morbido, roton- do, non aggressivo anche se è presente l’anidride carbonica; sostanze azotatequali peptidi ed amminoacidi, che danno allo spumante il classico “sapore di lievito”; fosfolipidi che impattano con la consistenza e persistenza della schiuma; acidi nucleici e soprattutto nucleotidi caratteristici per la loro elevata sapidità. Durante il processo di autolisi, quindi, si liberano nel vino, an- che frazioni di acidi nucleici.
  • 95. Capitolo 5. Il destino del DNA nello spumante La possibilità di recuperare il DNA liberamente disperso nellabottiglia di spumante può risultare molto interessante qualora lapresa di spuma venga condotta da uno specifico ceppo ricono-scibile con un protocollo molecolare, da impiegarsi come ele-mento “tracciante” al fine di garantire l’autenticità del prodot-to finito. Infatti, poiché l’eliminazione del lievito viene effettuatadopo la rifermentazione attraverso il dégorgement, che consistenell’eliminazione del deposito feccioso per sboccatura, è proba-bile che il DNA fuoriuscito a seguito della lisi cellulare permanganel prodotto finito, o persista nelle poche cellule residue, in quan-tità e qualità utili per l’applicazione di saggi molecolari. Per tali ragioni si è ritenuto interessante mettere a punto un pro-tocollo di estrazione ed amplificazione del DNA blastomiceticoda vino spumante, per la sperimentazione di un saggio biomole-colare che potrebbe permettere il controllo dell’autenticità delprodotto D.O.C.G. lombardo. Al fine di raggiungere tale obiettivo sono state effettuate pro-ve per valutare l’efficienza di recupero degli acidi nucleici dalla 97matrice vino con diverse tecniche In seguito si è proceduto allaa messa a punto di un protocollo in Real-Time PCR per la rive-lazione di Saccharomyces cerevisiae sull’estratto acquoso delprodotto.5.2 Trattamento del campione per prove di estrazione del DNA Le prove hanno coinvolto 4 cantine situate nel territorio dellaFranciacorta (C1, C2, C3 e C4, cfr. capitolo 4) e 3 cantine nel ter-ritorio dell’Oltrepò Pavese (C6, C7 e C8, cfr. capitolo 4): Le bottiglie, provenienti sia dal territorio della Franciacorta chedall’Oltrepò Pavese e ottenute a seguito delle prove di tiraggiodel 2010 condotto con impiego di starter commerciali, sono sta-te sottoposte a filtrazione mediante impiego di membrane conpori di diametro pari a 0,45 μm. Da ciascuna bottiglia sono statifiltrati circa 120 ml, in triplice replica, ed il tutto è stato conservatoa -20°C. A partire dall’inoculo del pied de cuve (T0), le bottiglie sonostate analizzate a differenti tempi, a seconda della cantina trat-tata; nella tabella di seguito (Tabella 5.1) sono riportati i tempi
  • 96. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… del monitoraggio espressi in giorni di maturazione, per ciascuna cantina oggetto della sperimentazione. FRANCIACORTA CANTINA TEMPO C1 0 – 30 – 60 – 90 – 120 – 180 – 240 – 300 – 360 – 420 – 720 C2 0 – 30 – 60 – 90 – 120 – 180 – 270 – 330 – 450 – 720 C3 0 – 30 – 60 – 90 – 120 – 180 – 240 – 300 – 420 – 720 C4 0 – 30 – 60 – 90 – 120 – 180 – 210 – 240 – 300 – 360 – 420 – 72098 OLTREPO’ PAVESE CANTINA TEMPO C6 0 – 30 – 60 – 90 – 120 – 180 – 270 – 330 – 360 – 420 – 720 C7 0 – 30 – 60 – 90 – 120 – 180 – 240 – 300 – 360 – 420 – 720 C8 0 – 30 – 60 – 90 – 120 – 180 – 240 – 300 – 360 – 420 – 480 – 720 Tabella 5.1 Elenco cantine coinvolte nella sperimentazione e rispettivi tempi di filtrazio- ne delle bottiglie 5.3 Protocolli di estrazione di DNA da vino spumante L’estrazione di DNA da vino spumante ha previsto l’impiego di 4 differenti tecniche; al fine di valutare l’efficienza di estrazione di ciascun metodo, e passare quindi all’estrazione del DNA dei vini filtrati, per tutte le tipologie di protocollo è stata condotta una prova preliminare su vino a cui era stata aggiunta una quantità nota di DNA genomico di Saccharomyces cerevisiae. In particolare i protocolli investigati sono stati:
  • 97. Capitolo 5. Il destino del DNA nello spumanteApplicazione del Kit Nucleospin (Jara, 2008):• Trasferire 400 μl di campione in una eppendorf e miscelarli con un volume di etanolo 96% e un volume di buffer C4, in modo tale da creare le condizioni adeguate affinché il DNA sia in grado di legarsi alla membrana in silice, posta all’interno della colonnina;• Miscelare per 30 s e trasferire 750 μl nella colonnina, che a sua volta è inserita all’interno di una eppendorf; centrifugare a 11000 g per 1 min (centrifuga Hettich zentrigugen, mikro 200);• Eliminare la fase liquida, depositatasi sul fondo della eppen- dorf;• Effettuare le 3 fasi di lavaggio: • pipettare 400 μl di buffer CQW (cloridrato di guanidina, etanolo) nella colonnina di silice, centrifugare a 11000 g per 11 min (centrifuga Hettich zentrigugen, mikro 200) ed eliminare la fase liquida depositatasi sul fondo della ep- pendorf; • pipettare 700 μl di buffer C5 nella colonnina di silice, cen- 99 trifugare a 11000 g per 1 min ed eliminare la fase liquida depositatasi sul fondo della eppendorf; • pipettare ulteriori 200 μl di buffer C5 nella colonnina di silice e centrifugare a 11000 g per 1 min.• Posizionare la colonnina di silice in una nuova eppendorf e pi- pettare 100 μl di buffer di eluizione CE (5mM Tris/HCl, pH 8), pre- cedentemente riscaldato a 70°C. Incubare per 5 min a tempe- ratura ambiente e centrifugare a 11000 g per 1 min;• Conservare il DNA a -20° C. In alcuni casi si è resa necessaria la quantificazione agli UVdel DNA estratto; la quantificazione è stata eseguita effettuan-do la lettura a 260 nm dei campioni diluiti in acqua bi-distillata,tenendo conto del fatto che un valore di assorbanza di 1,0 conun cammino ottico di 1 cm, si hanno 50 μg/ml di DNA. Effettuan-do, inoltre, la lettura ad una lunghezza d’onda di 280 nm (pic-co d’assorbanza delle proteine, principale contaminante degliestratti) ed effettuando il rapporto tra le rispettive assorbanze a260 e 280 nm, si può ottenere una stima della purezza del DNAottenuto (in genere, in preparazioni pure tale valore si aggiraintorno all’1,8).
  • 98. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… L’elaborazione dei risultati è stata effettuata applicando la se- guente formula: 50 μg Concentrazione DNA (μg/μl) = A260 nm * 50mgμl DNA utilizzati Trattamento con soluzione di Na-acetato (Savazzini, 2006): • Aggiungere 28 ml di Na-acetato 3M (pH 5,2) a 172 ml di cam- pione; • Aggiungere 60 ml di etanolo 96% e lasciare precipitare a -20°C per 15 giorni; • Centrifugare a 13000 g per 10 min (centrifuga Hettich Zentrifu- gen, rotina 380r) a temperatura ambiente;100 • Eliminare il surnatante e risospendere il pellet in 750 μl di buffer CTAB (25mM di EDTA, 1M Tris-HCl, pH 8, 2M di NaCl e 3% p/v di CTAB); aggiungere al momento 0,2 % v/v di ß-mercaptoetano- lo e 1% p/v di polivinilpirrolidone; • Incubare a 65° C per 60 min; • Purificare con un isovolume di fenolo:cloroformio:alcol isoami- lico (25:24:1) e centrifugare a 13000 g per 5 min; • Trasferire la fase acquosa in una nuova eppendorf, aggiunge- re 0,6 volumi di isopropanolo e lasciare a -20°C o/n; • Recuperare il DNA mediante centrifugazione a 13000 g per 30 min a 10°C; • Eliminare il surnatante e lavare il DNA con 1 ml di etanolo 70%, dopodiché centrifugare a 13000 g per 30 min; • Far asciugare l’etanolo sotto cappa e risospendere il DNA in 50 μl di acqua mq sterile e filtrata; • Conservare il DNA a -20 °C. Filtrazione su membrana (Querol, 1992): • Filtrare l’intero contenuto della bottiglia in filtratori Sartorius (Mil- lipore, Bedford) mediante impiego di filtri a pori da 0,45 μm; • Posizionare il filtro in una provetta sterile a cui si aggiungono 3
  • 99. Capitolo 5. Il destino del DNA nello spumante ml di soluzione A (sorbitolo 0,9 M e EDTA 0,1M) a cui si aggiun- gono al momento 3 μl di ß-mercaptoetanolo e 250 μg/ml di zimoliasi (USBiological, Massachusetts);• Miscelare la soluzione così ottenuta e incubare o/n a 30°C, po- sizionando la provetta in modo tale che il filtro venga bagnato continuamente dalla soluzione;• Aliquotare 500 μl di lisato in una eppendorf da 2 ml;• Aggiungere 50 μl di 10% SDS p/v ed incubare a 65 °C per 30 min;• Aggiungere 200 μl di potassio acetato 5 M freddo, e lasciare l’eppendorf in ghiaccio per 30 min;• Centrifugare a 14000 g per 5 min;• Trasferire il surnatante in una nuova eppendorf e aggiungere un isovolume di isopropanolo, miscelare delicatamente e la- sciare 5 min a temperatura ambiente;• Centrifugare a 14000 g per 10 min;• Eliminare il surnatante e risospendere il pellet in 50 μl di TE (Tris- EDTA). Agitare e far riposare per 30 min; 101• Centrifugare a 14000 g per 10 min;• Lavare il pellet con 1 ml di etano 70%;• Centrifugare a 14000 g per 5 min e lasciare asciugare in stufa a 55° C per 15 min;• Risospendere in 30 μl di acqua sterile e filtrata, conservare il DNA a -20° C.Biglie magnetiche (dynabeads), impiegate in combinazionecon un’altra tecnica che prevedeva l’utilizzo di solventi organici perl’estrazione del DNA. In particolare la prima fase prevedeva le seguenti operazioni:• Portare 15 ml di vino a pH 7,0;• Aggiungere un isovolume di isopropanolo e miscelare delica- tamente. Dopodiché lasciare precipitare a -20° C o/n;• Centrifugare a 15000 g per 30 min (centrifuga Beckman, rotore JA 20) a 10° C. Eliminare il surnatante e risospendere il pellet in 1 ml di TE (Tris 10 mM, EDTA 1mM);• Lasciare solubilizzare per quattro ore;• Addizionare 10 μl di proteinasi K 20 mg/ml (Sigma-Aldrich, Ger- many) a 500 μl di sospensione;
  • 100. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… • Incubare a 37° C per circa 1 ora e mezza; • Aggiungere 500 μl di fenolo (saturato con 10 mM di Tris-HCl, pH 8,0, 1 mM EDTA) e centrifugare a 14000 g per 10 min; • Prelevare il surnatante e trasferirlo in eppendorf pulita. Addizio- nare 250 μl di fenolo più 250 μl di cloroformio/alcol isoamilico 24:1 e centrifugare a 14000 g per 10 min; • Prelevare il surnatante e trasferirlo in eppendorf pulita. Addizio- nare 500 μl di cloroformio/alcol isoamilico 24:1 e centrifugare a 14000 g per 10 min; • Prelevare il surnatante e trasferirlo in eppendorf pulita. La seconda fase prevede, invece, le seguenti operazioni: • Addizionare 200 μl di PK buffer (contenente proteinasi K in con- centrazione di 100 mg/ml) a 200 μl di campione; • Incubare a 60° C per 20 min; • Addizionare 600 μl di buffer litico e miscelare; • Aggiungere 40 μl di biglie magnetiche e 800 μl di isopropanolo102 100%. Agitare a vortex per alcuni minuti; • Posizionare la eppendorf sul supporto magnetico per 5 min; • Una volta che le biglie hanno aderito alla parete della eppen- dorf, mentre è ancora sul magnete, eliminare il surnatante; • Effettuare la fase di lavaggio con 300 μl della prima soluzione di lavaggio e riposizionare la eppendorf sul supporto magneti- co, per 1 min; • Eliminare il surnatante ed effettuare un ulteriore fase di lavag- gio con 300 μl della seconda soluzione di lavaggio; • Eliminare il surnatante e far asciugare sotto cappa per circa 10 min; • Addizionare 100 μl di buffer 1 di eluizione e incubare a 70°C per 5 min; • Addizionare 100 μl di buffer 2 di eluizione e miscelare; • Posizionare la eppendorf sul supporto magnetico per 5 min; • Trasferire il surnatante in una nuova eppendorf e conservare a -20°C.
  • 101. Capitolo 5. Il destino del DNA nello spumante5.4 Messa a punto del protocollo per Real-Time PCR Tutti i campioni, sono stati sottoposti ad amplificazione in RealTime-PCR. Per verificare che il DNA estratto, appartenesse allaspecie S. cerevisiae, sono stati costruiti appositamente primer sul-la regione ITS (Internal Trascribed Spacers), permettendo così didiscriminare questa specie da altre. Per ogni campione è statamessa a punto la seguente miscela (Tabella 5.2): Concentrazione Concentrazione Volume (μl) iniziale finale SYBR GREEN 2X 1X 10 μl (Applied Byosistem, Austin) VF1 10 μM 0,25 μM 0,5 μl (Primm, Milano) 103 VF3 10 μM 0,25 μM 0,5 μl (Primm, Milano) DMSO (Dimetil- 3% 0,6 μl solfossido) (Sigma, St. Louis) Acqua mq S.F. - - 6,14 μl DNA - - 2 μl VOLUME FINALE 20 μlTabella 5.2 Composizione miscela per amplificazione in Real-Time PRIMER SEQUENZA TEMPERATURA NUCLEOTIDICA DI MELTING VF1 5’ GGGCCCAGAGGTAACAAACAC 3’ 65,4 °C VF3 5’ CCAGTTACGAAAATTCTTGTTTTTG 3’ 62,4 °CTabella 5.3 Composizione primer per amplificazione in Real-Time
  • 102. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… CICLO TERMICO (7300 Real Time PCR System): 50 °C per 2 min 95 °C per 2 min DENATURAZIONE INIZIALE } 95 °C per 30 sec DENATURAZIONE 62 °C per 30 sec ANNEALING Per 40 cicli 72 °C per 30 sec ESTENSIONE 72 °C per 1 min ESTENSIONE FINALE Al termine della reazione di amplificazione è stato aggiunto un profilo termico per l’analisi della curva di dissociazione (o curva di Melting) al fine di valutare la specificità dei prodotti ottenuti.104 5.5 Risultati dell’estrazione di DNA da vino spumante con diffe- renti protocolli Il protocollo di estrazione del DNA mediante kit Nucleospin (protocollo 1), riportato in letteratura da Jara (2008), non ha for- nito risultati ripetibili. Solo in un occasione si è riusciti a riscontrare l’avvenuta estrazione del DNA, a seguito di amplificazione delle regioni ITS. I campioni impiegati per tale analisi, erano stati prece- dentemente arricchiti in DNA di Candida spp. e M. pulcherrima. Nelle restanti prove condotte su campioni di vino, in cui era sta- ta aggiunta una quantità nota di DNA di S. cerevisiae la quantifi- cazione agli UV del DNA estratto metteva in luce la bassa resa di estrazione di questo protocollo, per via del fatto che la quantità massima di vino che può essere caricato in colonnina in silice è di soli 2 ml. L’estrazione di DNA con sodio-acetato (protocollo 2), in ac- cordo con quanto riportato da Savazzini 2006, non ha portato a nessuna amplificazione. La causa di ciò è stata imputata al fatto che tale tecnica era focalizzata sulla ricerca di DNA libero nel vino che può essere degradato a causa del basso pH e/o di una residua attività enzimatica, tanto da essere inutilizzabile. Il DNA
  • 103. Capitolo 5. Il destino del DNA nello spumantepotrebbe anche essere completamente assente poiché separa-to dal vino nella fase del remuage. Alla luce di ciò questo tipo diesperimento è stato abbandonato. L’impiego di un protocollo che sfruttasse la filtrazione del vinoper l’estrazione del DNA (protocollo 3), nasceva dall’idea chealcune cellule di lievito potessero permanere integre, anche semorte, a fine rifermentazione all’interno della bottiglia. Di con-seguenza filtrando la bottiglia con apposite membrane e sotto-ponendo quest’ultime a protocollo di estrazione, era possibileottenere DNA amplificabile. Le cellule dunque, eventualmentetrattenute nella membrana, venivano trattate secondo proto-collo di estrazione di DNA da cellule di lievito, in accordo conquanto descritto da Querol (1992) Anche in questo caso i risultati non si sono mostrati ripetibili; in-fatti, alcune estrazioni mettevano in evidenza DNA amplificabilecome mostrato in figura 5.2, mentre altre estrazioni davano esitonegativo. 105 M 1 2 3 4 MFig. 5.2 Gel di controllo di avvenuta amplificazione ITS degli estratti ottenuti medianteestrazione con filtrazioneM = Marker Ladder 100 bp XL1= controllo positivo di S. cerevisiae2= amplificato ITS del DNA estratto mediante filtrazione nella bottiglia 1;3= amplificato ITS del DNA estratto mediante filtrazione della bottiglia 2;4=controllo negativo
  • 104. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… La scarsa ripetibilità del protocollo 3 è stata imputata alla va- riabilità del numero di cellule che possono essere presenti nelle bottiglie di vino, e dunque alle differenze che ogni cantina mani- festa nelle operazioni di remuage e degorgement; infatti, da pia- stramenti effettuati su diverse bottiglie, è emerso come alcune di queste presentassero ancora alcune cellule vitali. Anche nel caso del protocollo 4 che prevedeva l’impiego in combinazione di dynabeads e trattamento con solventi orga- nici per l’estrazione di DNA da vino, sono state condotte prove preliminari su campioni ai quali veniva aggiunta una quantità nota di DNA genomico di Saccharomyces cerevisiae. Inoltre, sono state effettuate diluizioni decimali dello stesso DNA in vino, al fine di valutarne il grado di sensibilità. Nello specifico si è arrivati alla diluizione 10-3. In particolare per estrarre il DNA da vino è stato sperimentato sia un protocollo che prevedeva l’uso di solventi organici, sia uno che prevedeva l’uso dei dynabeads (MagMAX Multi-Sample kit).106 Il DNA estratto da entrambi i metodi è stato sottoposto ad ampli- ficazione delle regioni ITS e i risultati sono riportati nel gel di con- trollo mostrato qui di seguito (Figura 5.3) M 1 2 3 4 5 6 7 8 9 10 M Figura 5.3 Gel di controllo di avvenuta amplificazione ITS, mediante estrazione con solventi organici e dynabeads (Marker 1 Kb, Fermentas) 1= Amplificato ITS del campione contenente la concentrazione tal quale del DNA vo- lutamente aggiunto ed estratto mediante impiego di dynabeads; 2= amplificato ITS della diluzione 10-1 , estratto mediante impiego di dynabeads; 3= amplificato ITS della diluzione 10-2 , estratto mediante impiego di dynabeads; 4= amplificato ITS della diluzione 10-3 , estratto mediante impiego di dynabeads;
  • 105. Capitolo 5. Il destino del DNA nello spumante5= Amplificato ITS del campione contenente la concentrazione tal quale del DNA vo-lutamente aggiunto ed estratto mediante impiego di solventi organici;6= amplificato ITS della diluzione 10-1 , estratto mediante impiego di solventi organici;7= amplificato ITS della diluzione 10-2 , estratto mediante impiego di solventi organici;8= amplificato ITS della diluzione 10-3 , estratto mediante impiego di solventi organici;9-10=controllo positivo di S. cerevisiae e controllo negativo;M= Marker 1 Kb (Fermentas) L’amplificazione ha mostrato un segnale positivo per entrambii metodi di estrazione; in particolare, si è ottenuto un frammentofino alla diluizione 10-1. In virtù di tali dati, il passo successivo è stato quello di combi-nare le due tecniche al fine di ottenere un maggior recupero diacido nucleico. In questo caso, il DNA estratto è stato sottopostoad amplificazione delle regioni ITS ed il controllo dell’avvenutaamplificazione è riportato nel gel che segue (Figura 5.4). M 1 2 3 4 5 6 M 107Fig. 5.4 Gel di controllo di avvenuta amplificazione ITS, mediante estrazione combinata“solventi organici più dynabeads”1=Amplificato ITS del campione contenente la concentrazione tal quale del DNA volu-tamente aggiunto ed estratto mediante combinazione delle due tecniche;2= amplificato ITS della diluzione 10-1 , estratto mediante combinazione delle due tecni-che;3= amplificato ITS della diluzione 10-2 , estratto mediante combinazione delle due tec-niche;4= amplificato ITS della diluzione 10-3 , estratto mediante combinazione delle due tec-niche;5= controllo positivo di S. cerevisiae;6= controllo negativo;M= Marker 1 Kb (Fermentas).
  • 106. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… I risultati mostrano che la combinazione delle due tecniche ha permesso di estrarre una quantità superiore di DNA, rispetto a quando le due tecniche erano state impiegate separatamente. Infatti è stato possibile ottenere amplificazione del campione sot- toposto a diluzione pari a 10-3. Tutte le prove sono state ripetute 2 volte al fine di determinare le ripetibilità dei metodi ed i risultati ottenuti sono mostrati in ta- bella 5.3. TECNICA MASSIMA PRIMA SECONDA DILUIZIONE REPLICA REPLICA ESTRATTA Dynabeads 10-1 + - Solventi organici 10-1 + + Solventi organici più 10-3 + +108 Dynabeads Tabella 5.3 Esiti delle prove condotte in doppio 5.5 Risultati di amplificazione del DNA di lievito in Real Time PCR Una volta ottenuto un risultato positivo in PCR qualitativa, si è proceduto con l’amplificazione in Real-Time PCR per meglio de- terminare la concentrazione di DNA amplificabile estratto impie- gando le biglie magnetiche. Infatti, la sensibilità della Real-Time PCR è superiore rispetto alla PCR qualitativa, il cui limite è stimato in 1000 copie di DNA target. La prova è stata allestita diluendo il DNA, aggiunto nel vino, fino alla 10-10 . Inizialmente sono stati impiegati i primer citati nel lavoro di Zott (2010), denominati SC1/SC2, disegnati sulle regioni ITS e specifi- ci per il genere Saccharomyces. Oltre ad un controllo negativo base, nella messa a punto della reazione di amplificazione è sta- to inserito anche un controllo negativo di Dekkera bruxellensis, al fine di valutare l’effettiva specificità dei primer. I risultati, riportati nella figura 5.5, mostrano che l’amplificazione
  • 107. Capitolo 5. Il destino del DNA nello spumanteavviene fino alla diluizione 10-10, diluizione in cui il quantitativo diDNA risulta essere troppo basso per essere rilevato anche in Real-Time PCR. Inoltre viene evidenziato un segnale positivo nel casodella Dekkera. 109Fig. 5.5 Report della Real-time PCR messa a punto con i primer SC1 e SC2Disegno dei primer A seguito dei risultati illustrati nel precedente paragrafo, i pri-mer impiegati per la realizzazione dell’amplificazione, sono statisottoposti a gradiente termico, con temperature di annealingcomprese tra 45,2 e 65°C, al fine di valutare l’eventuale forma-zione di dimeri, che potevano fornire dei falsi-positivi durante l’a-nalisi, in quanto competono con il templato target diminuendoin questo modo l’efficienza della PCR. I dimeri si formano nelcaso in cui i primer presentino sequenze complementari tra lorooppure sequenze ripetute invertite. Il risultato emerso è illustrato nel gel riportato di seguito (Figura 5.6)
  • 108. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… M 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 M Fig. 5.6 Gel di controllo del gradiente termico effettuato sui primer SC1 e SC2 M= Marker Ladder 100bp XL 2-12= campioni con T° di annealing da 45,2 a 65 °C 13-16= controlli negativi 17-27= campioni di DNA estratti mediante combinazione “solventi organici più dyna- beads”, dalla concentrazione tal quale alla diluizione 10-10110 I primer SC1 e SC2 formano effettivamente dimeri che dan- no dei falsi-positivi in sede di amplificazione in Real-Time PCR, ed inoltre danno un segnale positivo anche per ciò che riguarda la D.bruxellensis. Ragion per cui, sono stati disegnati primer specifici sulla regio- ne ITS, che fossero in grado di amplificare solo per il genere Sac- charomyces, denominati VF1 e VF3. Con questi nuovi primer è stata ripetuta la reazione di amplificazione, con le stesse condi- zioni riportate in precedenza. Oltre ad un controllo negativo base, nella messa a punto del- la reazione di amplificazione sono stati inseriti controlli negativi di Dekkera bruxellensis, Pichia pastoris, Zygosaccharomyces bai- lii, Torulaspora delbrueckii, Kluyveromyces lactis e Schizosaccha- romyces pombe al fine di valutare l’effettiva specificità dei primers. I risultati, di seguito illustrati (Fig. 5.7 e 5.8) mostrano come l’am- plificazione si fermi alla diluizione 10-8 e come le specie diverse dal genere Saccharomyces risultino negative. Inoltre anche nel campione negativo non si osserva amplificazione.
  • 109. Capitolo 5. Il destino del DNA nello spumanteFig. 5.7 Report della Real-Time PCR messa a punto con i primer VF1 e VFt31-8= diluizioni decimali del DNA di S.cerevisiae in campioni di vino; 111d= controllo negativo di Dekkera bruxellensis.Fig. 5.8 Report inerente l’amplificazione Real-time condotta al fine di valutare la speci-ficità dei primers VF1 e VF3F1=Torulaspora delbrueckii F2= Kluyveromyces lactisF3= Zygosaccharomyces bailii F4= Schizosaccharomyces pombeF5= Pichia Pastoris F6= Saccharomyces cerevisiaeF7= Controllo negativo
  • 110. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… Ripetibilità ed accuratezza della tecnica La prova che ha fornito i migliori risultati è stata ripetuta più volte al fine di verificare la ripetibilità della tecnica di estrazione. I risultati si sono mostrati sempre identici sia per ciò che riguarda la diluizione di DNA minima amplificata, sia per ciò che riguar- da l’assenza di segnale per le specie diverse dal genere Sac- charomyces, a testimonianza della specificità dei primer verso quest’ultimo. Inoltre, siccome per l’amplificazione in Real-Time PCR è stato impiegato come intercalante di base il SYBR-GREEN, che però non permette di distinguere prodotti di amplificazione specifici dai prodotti aspecifici, al termine della reazione di amplificazio- ne è stato aggiunto un profilo termico per l’analisi della curva di dissociazione (o curva di Melting) per valutare la qualità e speci- ficità dei prodotti ottenuti. Qui di seguito, è riportato a titolo d’esempio un report (Figura 5.9) ottenuto da una reazione in Real-Time PCR, in cui l’analisi112 della temperatura di melting, rispecchia effettivamente quella ottenuta da campioni, in cui veniva aggiunto volontariamente il DNA di S. cerevisiae, il cui picco della curva di dissociazione è pari a 71.7 ± 0.3 °C. Fig. 5.9 Report di una reazione di Real-Time PCR in cui compare l’analisi della T° di Melting
  • 111. Capitolo 5. Il destino del DNA nello spumanteFig. 5.10 Esempio di curva di dissociazione del DNAMonitoraggio del DNA durante l’affinamento di vino spumante 113 Una volta definita la ripetibilità della tecnica, si è passati alleprove sui campioni filtrati dalle bottiglie, provenienti dal territoriodella Franciacorta e dell’Oltrepò Pavese, appartenenti alle pro-ve di tiraggio del2010, che era stato condotto con starter com-merciali propri delle cantine oggetto della sperimentazione. Del-le 7 cantine partecipanti in ambedue i territori, sono state sceltedue cantine per territorio e su queste si è monitorata la presenzadi DNA durante l’affinamento del vino spumante. Inoltre nel casodi ogni cantina è stata condotta una prova conclusiva su botti-glie commerciali pronte al consumo. In particolare per la Franciacorta sono state scelte la canti-na C1 e C3 Agricola Mirabella, mentre per il territorio dell’Oltre-pò Pavese sono state scelte la C6 e C7. Tutte le amplificazioni inReal-Time PCR sono state condotte in triplice replica per ciascuncampione e i risultati sono riportati nella tabella che segue (Ta-bella 5.4)
  • 112. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… CANTINA TEMPO C3 C1 C6 C7 120 +++ +++ +++ +++ 180 +++ +++ +++ +++ 240 +++ +++ +++ +++ 300 +++ +++ +++ +++ 420 -++ ++- +++ 480 +++ 720 --- --- --- --- BOTTIGLIE --- --- --- --- COMMERCIALI114 Tabella 5.4 Risultati del monitoraggio del DNA durante l’affinamento dello spumante e su bottiglie commerciali in 4 differenti cantine Anche in questo caso per ogni tempo del monitoraggio, l’am- plificazione è stata ripetuta due volte al fine di confermare i ri- sultati ottenuti. Qui di seguito sono mostrati due esempi di am- plificazione in Real-Time PCR condotte su campioni filtrati della cantina C1 del territorio della Franciacorta al tempo 240, e della cantina C6 del territorio dell’Oltrepò Pavese al tempo 300 (Figura 5.11 e 5.12).
  • 113. Capitolo 5. Il destino del DNA nello spumante 115Fig. 5.11 Esempio di amplificazione in Real-time della cantina Mirabella al tempo 240Fig. 5.12 Esempio di amplificazione in Real-time della cantina Cà del Bosco al tempo 300
  • 114. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… 5.6 Discussione e conclusioni Pochi lavori in letteratura si sono focalizzati sulla possibilità di estrarre DNA da vino; uno tra questi è quello svolto in Portogallo (Faria, 2002) in cui il protocollo messo a punto per l’estrazione consisteva nella concentrazione del mosto mediante centrifuga- zione (o, nel caso delle foglie di vite, rottura delle strutture vege- tali con un pestello sterile) ed estrazione mediante CTAB (cetil trimetilammonio bromide), ß-mercaptoetanolo e differenti pas- saggi di purificazione. La sperimentazione otteneva ottimi risultati dopo un’amplificazione RAPD, tenuto conto che si partiva da un substrato molto ricco di microrganismi in quanto favorevole alla loro crescita. Questo tipo di protocollo è stato in seguito succes- sivamente migliorato dagli stessi ricercatori con risultati migliori rispetto alla prima sperimentazione (Faria, 2002). Un altro lavoro condotto a Trento (Savazzini, 2006) ha compa- rato 3 metodi di estrazione del DNA da vino finito: questi metodi116 si distinguevano tra di loro per il processo iniziale di precipitazione del DNA. La precipitazione era condotta o con NaCl 5M, o con isopropanolo o con Na-acetato; dopo la precipitazione il metodo diveniva univoco, in quanto il DNA veniva estratto mediante im- piego di buffer CTAB, con incluso ß-mercaptoetanolo e polivinilpir- rolidone. Gli estratti venivano, infine, sottoposti ad amplificazione in PCR-Real time; i risultati migliori sono stati ottenuti sfruttando il protocollo che prevedeva la precipitazione con Na-acetato. Sul- la base di tali risultati, questo metodo è stato inizialmente applica- to per estrarre il DNA da vino spumante; i risultati però sono stati negativi a causa della probabile ridotta quantità di DNA estraibile. Tuttavia in un recente lavoro (Jara, 2008) sono stati confron- tati diversi metodi per l’estrazione del DNA, condotto su batteri acetici del vino. In particolare, i metodi impiegati furono 4: me- todo Wizard, metodo con buffer CTAB, metodo di estrazione con kit Nucleospin e metodo di estrazione tramite kit Mo-Bio. I risul- tati mostravano come il metodo più efficiente di estrazione fos- se quello tramite Nucleospin. Per tale ragione questo kit è stato impiegato nell’estrazione di DNA da vino spumante, ma anche in questo caso con scarsi risultati, probabilmente dovuto al fatto che le colonnine impiegate presentavano una ridotta portata (2 ml) e quindi il recupero di DNA era estremamente ridotto.
  • 115. Capitolo 5. Il destino del DNA nello spumante A seguito di piastramenti dei vini in bottiglia sottoposti ad ana-lisi, e successive osservazioni al microscopio, è stata evidenziatala presenza di cellule in sospensione, nonostante le operazionidi remuage e sboccatura. Tale risultato è stato, quindi, sfruttatoper la messa a punto di un protocollo di estrazione di DNA cheprevedesse la preliminare separazione di tali cellule dalla fase li-quida. Tale protocollo era improntato sulla separazione delle cel-lule per filtrazione su membrana e quest’ultima veniva, in segui-to, sottoposta ad estrazione secondo quanto riportato da Querol(1993). I risultati in questo caso non si sono mostrati ripetibili; ciò èdovuto al fatto che le bottiglie a volte presentavano cellule in so-spensione, mentre a volte non le presentavano. Questo è proba-bilmente dovuto alle differenti pratiche di cantina, in particolarel’operazione di sboccatura. L’ultima tecnica impiegata per l’estrazione del DNA ha pre-visto l’impiego delle biglie magnetiche (dynabeads) che asso-ciate ad un estrazione condotta con solventi organici potevanomigliorare la resa di estrazione del DNA da vino. I campioni di 117vino sono stati dapprima sottoposti a precipitazione con isopro-panolo, trattati con proteinasi K al fine di degradare polisaccaridie proteine che potevano inibire la reazione di PCR (Nakamura,2007), purificati con solventi organici quali fenolo, cloroformioed alcol isoamilico ed infine trattati con le biglie magnetiche.Non sono riportati in letteratura studi inerenti l’impiego di dyna-beads per l’estrazione del DNA da vino, ma spesso queste bigliemagnetiche sono state sfruttate per altri prodotti alimentari. Unesempio è lo studio condotto a Fano (Amagliani, 2005) in cui lebiglie magnetiche sono state sfruttate al fine di estrarre DNA diListeria monocytogenes da latte; i risultati mostrano che il meto-do si è rivelato estremamente sensibile e specifico, permettendodi eliminare possibili componenti che avrebbero interferito con illavoro della Taq polimerasi, durante la reazione di amplificazionedel DNA precedentemente estratto. Un altro studio è stato condotto in Spagna (Cepeda, 2000) incui le dynabeads sono state, in questo caso, impiegate per l’e-strazione del DNA da Flavobacterium psychrophilum, che risultaessere un batterio patogeno contaminante per lo più i prodottiittici. Impiegando le biglie magnetiche, sul prodotto preceden-temente omogeneizzato, si sono ottenuti risultati ottimi avvalorati
  • 116. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… dal fatto che l’identificazione di questo batterio diveniva estre- mamente rapida. In virtù dei risultati riportati in letteratura, in questo lavoro sono state impiegate le biglie magnetiche associate ad un protocollo di estrazione che prevedeva l’impiego di solventi organici. Per prima cosa, sono state effettuate delle prove su campioni di vino in cui veniva aggiunto DNA a quantità nota, al fine di valutare la sensibilità del metodo; in principio per valutare l’amplificazione del DNA estratto, sono stati impiegati i primer descritti nel lavoro di Zott (2010), disegnati sulla regione ITS e specifici per il genere Saccharomyces. A seguito però di prove condotte in Real-time PCR, i primer producevano risultati falsi-positivi dovuti sia alla for- mazione di dimeri sia all’amplificazione non specifica; infatti, essi fornivano un risultato positivo qualora alla reazione di amplifica- zione venisse aggiunto DNA di specie diverse da Saccharomyces (ad esempio D. bruxellensis). In virtù di tali risultati, sono stati dise- gnati primer sulla regione ITS, denominati VF1 e VF3, con i quali118 sono stati eliminati i sopracitati problemi. Il passaggio successivo è stato quello di applicare la tecnica di estrazione ai campioni di vino filtrati, provenienti sia dal territorio della Franciacorta che dall’Oltrepò Pavese a seguito del tirage 2010. In particolare, è stato monitorato il periodo di affinamento del vino spumante a diversi tempi; sono state prese in considerazione due cantine per ciascun territorio, sulle quali il monitoraggio è stato condotto a partire dal tempo 120 fino ad arrivare al tempo 720. Inoltre sono state condotte, infine, prove atte a valutare per ciascuna can- tina il recupero di DNA da bottiglie di spumante in commercio pronte al consumo. I risultati mostrano come l’estrazione del DNA avvenga corret- tamente, in tutte le cantine trattate, fino al tempo 420; al con- trario, i risultati si mostrano negativi quando le analisi venivano condotte su bottiglie a 24 mesi di affinamento. Anche per ciò che riguarda le bottiglie in commercio non è stato in nessun caso possibile ottenere DNA amplificabile. Tenendo presente che in genere il tempo di maturazione del vino sulle proprie fecce è minimo pari a 15 - 18 mesi a seconda del disciplinare di produzione, è possibile che fino a tale termine il DNA possa essere estratto e correttamente amplificato, mentre a seguito di operazione di sboccatura esso possa essere perso o
  • 117. Capitolo 5. Il destino del DNA nello spumantenel caso delle bottiglie poste in commercio talmente degradatoda essere impossibile da recuperare ed amplificare. In conclusione i risultati ottenuti da tale lavoro mostrano comeil monitoraggio del DNA durante l’affinamento di vino spumante,avvenga correttamente fino a 16/18 mesi di maturazione in tuttele cantine oggetto della sperimentazione; ragion per cui questolavoro rappresenta un primo passo verso la definizione di saggiobiomolecolare che potrebbe rappresentare un nuovo strumentoper la valorizzazione della tipicità e permettere ai produttori ditutelare la qualità del loro prodotto. 119
  • 118. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… Capitolo 6. Considerazioni finali Come già precedentemente affermato gli obiettivi perseguiti in questo progetto sono stati di ordine ecologico, enologico e biotecnologico. Per quanto riguarda il primo e cioè lo studio e la salvaguar- dia della biodiversità dei lieviti presenti nei territori di Francia- corta ed Oltrepò Pavese, è possibile affermare come sia sta- to pienamente raggiunto con l’allestimento di una collezione ed identificazione di 493 isolati, conservati presso i laboratori120 dell’Università degli Studi di Milano. La grande variabilità blasto- micetica presente tuttora negli areali indagati è testimoniata dall’isolamento di 35 differenti specie, alcune delle quali dotate di potere fermentativo sebbene non attribuite al gruppo Sac- charomyces. Questi ceppi risultano assai interessanti tenendo conto di quanto sta accadendo in altri Paesi viti-vinicoli dove la ricerca si indirizza verso lo sviluppo di starter costituiti da specie non-Saccharomyces, da impiegare per inoculi scalari, in grado di produrre mosti con composti aromatici diversi e/o a maggior contenuto di glicerolo. La disponibilità di queste risorse naturali apre una nuova strada anche agli enologi lombardi per l’otte- nimento di prodotti differenti, disegnati sul gusto del consuma- tore target e tuttavia legati con il territorio d’appartenenza. La ricognizione e la conservazione della biodiversità dei lieviti vinari sono la base sia per l’ottenimento di colture starter in grado di sviluppare pienamente le potenzialità aromatiche del vitigno, sia per il mantenimento del patrimonio biologico necessario alla preservazione delle caratteristiche genetiche. Infine ancora nell’ambito ecologico, sorprendente e per la prima volta de- scritto, è stato il ritrovamento di S. cerevisiae nell’aria raccolta in mezzo ai vigneti; tali ceppi non hanno tuttavia manifestato caratteri enologici positivi.
  • 119. Capitolo 6. Considerazioni finali Il secondo obiettivo e cioè l’isolamento e la selezione di sacca-romiceti “autoctoni” che presentassero caratteri tecnologici e diqualità è stato quello che ha destato maggior preoccupazionee, nel contempo, grande soddisfazione nei ricercatori. Il temadelle fermentazioni spontanee e dello sfruttamento della natura-le contaminazione dovuta all’ambiente di coltivazione e trasfor-mazione sono tuttora attuali in tutto il comparto alimentare. Taletendenza si fonda su considerazioni di carattere scientifico e tec-nico che determinano un notevole impatto da un punto di vistacommerciale, visto l’enorme valenza che le tematiche legate alterroir hanno nella produzione enologica. La maggior parte delle colture di Saccharomyces attualmentein uso nel nostro Paese derivano infatti da selezione clonale o damiglioramento genetico di ceppi provenienti dall’estero, in am-bienti viti-vinicoli distanti e differenti; ciò nondimeno l’impiego ditali starter selezionati ha reso possibile la gestione controllata delprocesso fermentativo assicurando la riproducibilità della trasfor-mazione vinaria. Tuttavia i ceppi commerciali a disposizione non 121sono così numerosi come sembrano poiché spesso sul mercatosi trovano i medesimi cloni chiamati con sigle o nomi diversi aseconda delle aziende produttrici di starter; questo fenomenogià evidenziato in alcuni lavori è stato confermato anche dairisultati ottenuti in questo progetto. La conseguenza evidente diquesta pratica è l’omologazione dei caratteri sensoriali derivantidal processo fermentativo, anche in vini di qualità, spesso a di-scapito dell’originalità di aromi che gli stessi prodotti potrebberoesprimere usando in fermentazione lieviti “autoctoni”. Che cosa significa lievito “autoctono” è ancora oggetto diampio dibattito tra i tecnici e i ricercatori; è una determinazio-ne oggettivamente legata allo spazio, in quanto si ipotizza che ilceppo sia originario di un luogo delimitato, e al tempo, in quantoil ceppo debba persistere nel luogo da o per un certo periodo.Ma dove si pone il confine per discriminare l’appartenenza di unceppo ad un territorio? E quanto tempo è necessario affinché sipossa affermare che quel microrganismo appartenga e sia con-siderata espressione di quella area geografica? La seguente definizione, proposta dall’amico e collega prof.Giovanni Antonio Farris, trova attualmente il maggior consensonella comunità scientifica: “trattasi di un ceppo selvaggio (non
  • 120. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… commerciale) isolato in una cantina specifica (nicchia ecologi- ca), nella quale è dominante, persistente nell’arco di una ven- demmia, e ricorrente per più annate. Tale ceppo, utilizzato nella stessa cantina di isolamento è in grado di conferire al vino ca- ratteristiche peculiari rispondenti alla tipologia del prodotto pro- grammato”. Una forma microbica che possa influenzare effet- tivamente le caratteristiche di un vino deve essere in grado di guidare, anche in associazione, la fermentazione. Dato che “la cantina è la nicchia ecologica ove si attua la selezione, questa (l’enologo) deve procedere favorendo il ceppo più adatto allo stile o alla tecnologia impiegata; il ceppo più adatto è verosimil- mente destinato a diventare quello numericamente più rappre- sentato, tanto da divenire dominante e, se non avvengono cam- biamenti drastici nello stile o nella tecnologia, anche persistente durante diverse fasi della fermentazione in uno stesso tino o in processi fermentativi in tini diversi”. Infine il termine “ricorrente” si riferisce alla possibilità di isolare il medesimo ceppo autoctono in-122 dividuato nel corso di annate diverse (consecutive ma non solo). La possibilità di isolare, selezionare, collezionare e impiegare ceppi autoctoni con vocazione enologica può risultare un’at- tività strategica per l’impresa poiché suggella l’evidenza del le- game tra territorio, ambiente di produzione, prodotto finito. Tale attività sperimentale è fondamentale anche per i produttori di starter poiché costituisce la base di partenza per il miglioramento genetico e la formulazione di nuovi prodotti. D’altro canto occor- re ricordare come le contaminazioni con le colture commerciali già impiegate sono frequenti e incontrollabili poiché gli starter selezionati sono da molto tempo impiegati e diffusi sul territorio viticolo e nell’ambiente di trasformazione. Dunque la necessità di disporre di tecniche analitiche in grado di discriminare a livello di ceppo diventa necessaria e inderoga- bile per qualsiasi indagine o iniziativa che abbia come fine il rico- noscimento e la tutela delle forme autoctone. Un risultato molto positivo del progetto è stata la messa a punto e la validazione di un protocollo di tipizzazione molecolare, fondato sui polimorfismi ottenuti dall’amplificazione delle regioni interdelta in S. cerevi- siae con separazione degli ampliconi per elettroforesi capillare, in grado di riconoscere il singolo ceppo in maniera accurata. A tutela degli interessi dei singoli produttori di vino ma anche a
  • 121. Capitolo 6. Considerazioni finalivantaggio dei fabbricanti di starter si può ragionevolmente so-stenere la realizzazione di una “carta d’identità” di ceppo imple-mentando un sistema di certificazione, basato su tale protocolloanalitico. Un successivo obiettivo pienamente raggiunto grazie alla fat-tiva collaborazione di otto cantine, è stato quello di selezionaree saggiare due ceppi “autoctoni” da entrambi i territori (Fran-ciacorta e Oltrepò Pavese) capaci di sostenere e dominare unarifermentazione in bottiglia, secondo quanto previsto dalla nor-mativa e dai disciplinari di produzione. Le prove sperimentali ditiraggio hanno confermato le caratteristiche tecnologiche deiceppi (potere fermentativo, capacità di raggiungere 6 atm dipressione, bassa produzione di acetico, assenza di difettosità) edinoltre le valutazioni sensoriali, eseguite fino a 18 mesi di affina-mento, hanno evidenziato profili aromatici differenti, talora mi-gliorativi rispetto allo starter usualmente impiegato. Per quanto riguarda il terzo obiettivo e cioè quello di defini-re protocolli di estrazione ed amplificazione del DNA fungino 123da spumante “metodo classico” per il riconoscimento del cep-po utilizzato in rifermentazione, si attesta che è stato raggiuntoparzialmente. L’ipotesi di partenza era quella di utilizzare il DNAdi origine microbica residuo nel vino come elemento traccian-te per l’accertamento dell’autenticità del prodotto (un vero eproprio “messaggio nella bottiglia”). Questa evenienza avreb-be potuto configurarsi come una potente verifica sperimentaledei sistemi di tracciabilità, sistemi di controllo formale cui tuttoramancano elementi oggettivi come il risultato analitico. La possi-bilità di estrarre DNA di lievito amplificabile dalle bottiglie è stataottenuta, tuttavia i processi degradativi in atto durante l’affina-mento dovuti alla elevata acidità del mezzo ed alle residue at-tività endonucleasiche, nonché l’impiego delle sostanze utili perla fase di remuage, hanno compromesso il recupero di un acidonucleico integro, anche in poche copie, indispensabile per il ri-conoscimento a livello di ceppo. Invece, seppur frammentato, ilDNA residuo si è dimostrato sufficiente per il riconoscimento dellaspecie. L’esperienza maturata in questo progetto è stata notevolesia da un punto di vista professionale che umano, riuscendoa coinvolgere e ad avvicinare molte persone che nei diversi
  • 122. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… ambiti si occupano di temi legati all’enologia in Lombardia. I “frutti” della ricerca non sono stati ancora tutti colti: sono tuttora in preparazione pubblicazioni scientifiche e tecniche che descrivono più in dettaglio e con differenti livelli di approfondimento i risultati ottenuti; sono disponibili strumenti e materiali per il miglioramento dei prodotti; sono stati creati con- tatti ed interazioni che possono in futuro formare una rete più stretta di competenze e collaborazioni.124
  • 123. BibliografiaBibliografia• Agnolucci M, Scarano S, Santoro S, Sassano C, Toffanin A, Nuti M (2007) “Genetic and phenotypic diversity of autochthonous Saccharomyces spp. strains associated to natural fermentation of ‘Malvasia delle Lipari’” Lett. Appl. Microbiol. 45: 657–662.• Amagliani G, Omiccioli E, Del Campo E, Bruce IJ, Brandi G, Magnani M (2006) “Development of a magnetic capture Hybridization-PCR assay for Listeria monocytogenes direct detection in milk samples” J. Appl. Microbiol. 100: 375-383.• Ayoub MJ, Legras JL, Saliba R, Gaillardin C (2006) “Application of multi locus sequence typing to the analysis of the biodiversity of indigenous Saccharo- myces cerevisiae wine yeasts from Lebanon” J. Appl. Microbiol. 100: 699–711. 125• Baleiras Couto MM, Eijsma B, Hofstra H, Huis in ‘t Veld JHJ, van der Vossen JMBM (1996) “Evaluation of Molecular Typing Techniques to assign genetic diversity among Saccharomyces cerevisiae strains” Appl. Environ. Micro- biol., 62: 41-46.• Bisson LF (1999) “Stuck and sluggish fermentations” Am. J. Enol. Viticult. 50: 107-119.• Blanco P, Ramilo A, Cerdeira M, Orriols I (2006) “Genetic diversity of wine Saccharomyces cerevisiae strains in an experimental winery from Galicia (NW Spain)” Ant. Leeuw. 89: 351–357.• Bocca E, Zapparoli G, Suzzi G, Torriani S, Dellaglio F (2004) “Selection of the strain of autochtonous S. cerevisiae for the production of Bardolino D.O.C.G. wine” Vignevini 31: 81-85.• Boeke JD, Corces VG (1989) “Transcriptions and reverse transcriptions of retrotransposons” Ann. Rev. Microbiol. 43: 403-434.• Boulton RB, Singleton VL, Bisson LF, Kunkee RE (1996) “Principles and practi- ces of winemaking” Champman & Hall, New York• Cameron JR, Loh EY, Davis RW (1979) “Evidence for transposition of disper- sed repetitive DNA families in yeast” Cell 16: 739-751.• Capece A, Romaniello R, Siesto G, Pietrafesa R, Massari C, Poeta C, Roma- no P (2010) “Selection of indigenous Saccharomyces cerevisiae strains for Nero d’Avola wine and evaluation of selected starter implantation in pilot fermentation” Int. J. Food Microbiol. 144: 187-192.• Cappello MS, Bleve G, Grieco F, Dellaglio F, Zacheo G (2004) “Characteriza- tion of Saccharomyces cerevisiae strains isolated from must of grape grown in experimental vineyard” J. Appl. Microbiol. 97: 1274–1280.
  • 124. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… • Caruso M, Capece A, Salzano G, Romano P (2002) “Typing of Saccha- romyces cerevisiae and Kloeckera apiculata strains from Aglianico wine” Lett. Appl. Microbiol. 34: 323-328. • Cavazza A, Tini V, Zambonelli C (2006) “Microbiologia Enologica in labora- torio” Edizioni Reda, Torino. • Cepeda C, Santos Y (2000) “Rapid and low-level toxic PCR-based method for routine identification of Flavobacterium psychrophilum” Int. Microbiol. 3: 235-238. • Chavan P, Mane S, Kulkarni G, Shaikh S, Ghormade V, Nerkar DP, Shouche Y, Deshpande MV (2009) “Natural yeast flora of different varieties of grapes used for wine making in India” Food Microbiol. 26: 801–808. • Ciani M, Comitini F, Mannazzu I, Domizio P (2009) “Controlled mixed culture fermentation: a new perspective on the use of non-Saccharomyces yeasts in winemaking” FEMS Yeast Res. 1-11. • Ciani M, Maccarelli F, Martini A, Vettorello G (1997) “Selezione di starter di vinificazione autoctoni della D.O.C. prosecco di Conegliano-Valdobbiade- ne” L’Enotecnico 33: 81-88. • Ciani M, Mannazzu I, Marinangeli P, Clementi F (2004) “A contribution of winery-resident Saccharomyces cerevisiae strains to spontaneous grape must fermentation” Ant. Leeuw 85: 159-164. • Clemente-Jimenez, JM, Mingorance-Cazorla L, Martinez-Rodriguez S, Las126 Heras-Vazquez FJ, Rodriguez-Vico F (2004) “Molecular characterization and oenological properties of wine yeasts isolated during spontaneous fermen- tation of six varieties of grape must” Food Microbiol. 21: 149-155. • Combina M, Mercado L, Borgo P, Elia A, Jofré V, Ganga A, Martinez C , Ca- tanis C (2005) “Yeasts associated to Malbec grape berries from Mendoza, Argentina” Int. J. Food Microbiol. 98: 1055–1061. • Csoma H, Sipiczki M (2008) “Taxonomic reclassification of Candida stellata strains reveals frequent occurrence of Candida zemplinina in wine fermen- tation” FEMS Yeast Res. 8: 328-336. • Csoma H, Zakany N, Capece A, Romano P, Sipiczki M (2010) “Biological di- versity of Saccharomyces yeasts of spontaneously fermenting wines in four wine regions: Comparative genotypic and phenotypic analysis” Int. J. Food Microbiol. 140: 239–248. • de Melo Pereira GV, Ramos CL, Galvão C, Souza Dias E, Schwan RF (2010) “Use of specific PCR primers to identify three important industrial species of Saccharomyces genus: Saccharomyces cerevisiae, Saccharomyces bayanus and Saccharomyces pastorianus” Lett. Appl. Microbiol. 51:131- 137. • Delfini C, Formica JV (2001) “Preparations and set-up for microscopic obser- vation” In: Wine Microbiology: Science and Technology, 10 ed., Marcel Dekker, Inc, New York, pp.47-60. • Di Maro E, Ercolini D, Coppola S (2007) “Yeast dynamics during spontaneous wine fermentation of the Catalanesca grape” Int. J. Food Microbiol. 117: 201- 210. • Dice LR (1945) “Measurement of the amount of ecological association between species” Ecology 26: 295-302)
  • 125. Bibliografia• Doolittle RF, Feng DF, Johnson MS, Mc Clure MA (1989) “Origins and evolutio- nary relationship of retroviruses” Q. Rev. Biol. 64:1-30.• Edwards CG, Beelman RB, Bartley CE, McConnell AL (1990) “Production of decanoic acid and other volatile compounds and the growth of yeast and malolactic bacteria during vinification” Am. J. Enol. Viticult. 48-56.• Egli CM, Edinger WD, Mitrakul CM, Henick-Kling T (1998) “Dynamics of indi- genous and inoculated yeast populations and their effect on the sensory character of Riesling and Chardonnay wines” J. Appl. Microbiol. 85: 779- 789.• Eigel A, Feldmann H (1982) “Ty1 and delta elements occur adjacent to se- veral tRNA genes in yeast” EMBO J. 1: 1245-1250• Esteve-Zarzoso B, Belloch C, Uruburu F, Querol A (1999) “Identification of ye- asts by RFLP analysis of the 5.85 rRNA gene and the two ribosomal internal transcribed spacers” Int. J. Syst. Bact. 49: 329-337.• Esteve-Zarzoso B, Gostincar A, Bobet R, Uruburu F, Querol A (2000) “Selec- tion and molecular characterisation of wine yeasts isolated from the ‘El Pe- nedes’ area (Spain)” Food Microbiol. 17: 553–562.• Faria MA, Magalhaes R, Ferreira MA, Meredith CP, Ferreira Monteiro F (2002) Vitis vinifera must varietal authentication using microsatellite DNA analysis (SSR); J. Agric. Food Chem. 48; 1096-1100.• Fleet GH (2003) ”Yeast interactions and wine flavour” Int. J. Food Microbiol. 86: 11–22. 127• Fleet GH (2008) ”Wine yeasts for the future” FEMS Yeast Res. 8: 979–995.• Fleet GH, Heard G (1993) “Yeasts-growth during fermentation” In: Fleet G, Wine-Microbiology and Biotechnology, eds., Harwood Academic Publi- shers, Singapore 1993, pp. 27–54.• Fleet GH, Prakitchaiwattana CJ, Beh AL, Heard G et al. (2002) “The yeast ecology of wine grapes. Biodiversity and Biotechnology of Wine Yeasts” In Research Signpost, Ciani Editor, Kerala, India, pp. 1–17.• Foschino R, Vigentini I (2006) “Il “typing “ dei lieviti: la biologia molecolare al servizio dell’enologia” L’Enologo 42: 93-98.• Gafner J, Schutz M (1993) “Analysis of yeast diversity during spontaneous and induced alcoholic fermentations” J. Appl. Bacteriol. 75: 551– 558.• Garijo P, Santamaría P, López R, Sanz S, Olarte C, Gutiérrez AR (2008) ”The occurrence of fungi, yeasts and bacteria in the air of a Spanish winery dur- ing vintage” Int. J. Food Microbiol. 125: 141–145.• Giudici P, Restuccia C, Randazzo C, Melia V, Corte V (1997) “Biodiversità fenotipica di lieviti isolati da mosti e vini siciliani” Ind. Bev. 149: 252-259.• Giudici P, Zambonelli C (1992) “Criteri di selezione dei lieviti per enologia” Vignevini 9: 29-34.• Goffeau A., Barrell BG, Bussey H, Davis RW, Dujon B, Feldmann H, Galibert F, Hoheisel JD, Jacq C, Johnston M, Louis EJ, Mewes HW, Murakami Y, Phi- lippsen P, Tettelin H, Oliver SG (1996) “Life with 6000 genes” Science 274: 563-567.• Gonzáles SS, Barrio E, Querol A (2007) “Molecular identification and cha- racterization of wine yeast isolated from Tenerife (Canary Island, Spain)” J. Appl. Microbiol. 102: 1018-1025.
  • 126. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… • Granchi L, Bosco M, Messini A, Vincenzini M (1999) “Rapid detection and quantification of yeast species during spontaneous wine fermentation by PCR-RFLP analysis of the rDNA ITS region” J. Appl. Microbiol. 87: 949–956. • Green SR, Grey PP (1950) “A differential procedure applicable to bacterio- logical investigation in brewing” Wallerstein Lab.Comm. 13:357. • Guerra E, Mannazzu I, Sordi G, Tangherlini M, Clementi F, Fatichenti F (1999) ”Characterization of indigenous Saccharomyces cerevisiae from the Italian region of Marche: hunting for new strains for local wine quality improve- ment” Ann. Microbiol. 49: 79-88. • Guillamon JM, Barrio E, Querol A (1996) “Characterization of wine yeast strains of the Saccharomyces genus on the basis of molecular markers: rela- tionships between genetic distance and geographic or ecological origin” Syst. Appl. Microbiol. 19: 122–132. • Heard GM, Fleet GH (1985) “Growth of natural yeast flora during the fer- mentation of inoculated wines” Appl. Environ. Microb. 50: 727-728. • Jara C, Mateo E, Guillamòn JM, Torija MJ, Mas A (2008) “Analysis of several methods for the extraction of high quality DNA from acetic acid bacteria in wine and vinegar for characterization by PCR-based methods” Int. J. Food Microbiol. 128: 336-341. • Jolly NP, Augustyn OPH, Pretorius IS (2003) “The occurrence of non-Saccha- romyces cerevisiae yeast species over three vintages in four vineyards and128 grape musts from four production regions of the Western Cape, South Afri- ca” S. Afr. J. Enol. Vitic. 24: 35-42. • Jolly NP, Augustyn OPH, Pretorius IS (2006) “The role and use of non-Saccha- romyces yeasts in wine production” S. Afr. J. Enol. Vitic. 27: 15–39. • Kurtzman C , Robnett C (1998) ”Identification and phylogeny of ascomyce- tous yeasts from analysis of nuclear large subunit (26S) ribosomal DNA par- tial sequences” Ant. Leeuw. 73: 331–371. • Kurtzman CP, Fell JW (1998) “The yeasts, a taxonomic study” 4th ed. Amster- dam: Elsevier 1055 p. • Lachance MA, Gilbert Srmer WT (1994) “Yeast communities associated with Drosophila species and related flies in eastern oak-pine forests: a compari- son with western communities” J. Ind. Microbiol. 14: 484-494. • Lambrechts MG, Pretorius IS (2000) “Yeast and its importance to wine aro- ma” S. Afr. J. Enol. Vitic. 21:97-129. • Legras J, Karst F (2003) “Optimisation of interdelta analysis for Saccha- romyces cerevisiae strain characterization” FEMS Microbiol. Lett. 221:249– 255. • Lema C, Garcia-Jares C, Orriols I, Angulo L (1996) “Contribution of Saccha- romyces and non-Saccharomyces populations to the production of some components of Albariño wine aroma” Am. J. Enol. Vitic. 47: 206-216. • Longo E, Velázquez JB, Sieiro C, Cansado J, Calo P, Villa TG (1992) “Produc- tion of higher alcohols, ethyl acetate, acetaldehyde and other compounds by 14 Saccharomyces cerevisiae wine strains isolated from the same region (Salnés, N.W. Spain)” World J. Microbiol. Biotech. 5: 539-541. • Lonvaud-Funel A (1996) “Microorganisms of winemaking” Cerevisia: Belgian J. Brew Biotechnol. 21: 55-58.
  • 127. Bibliografia• Lopandic K, Gangl H, Wallner E, Tscheik G, Leitner G, Querol A, Borth N, Brei- tenbach M, Prillinger HJ, Tiefenbrunner W (2007) “Genetically different wine yeasts isolated from Austrian vine-growing regions influence wine aroma differently and contain putative hybrids between Saccharomyces cerevi- siae and Saccharomyces kudriavzevii” FEMS Yeast Res. 7: 953–965.• Lopandic K, Tiefenbrunner W, Gangl H, Mandl K, Berger S, Leitner G, Abd- Ellah G, Querol A, Gardner RC, Sterflinger K, Prillinger H (2008) “Molecular profiling of yeasts isolated during spontaneous fermentations of Austrian wi- nes” FEMS Yeast Res. 8:1063–1075.• Lopes CA, van Broock M, Querol A, Caballero AC (2002) “Saccharomyces cerevisiae wine yeast populations in a cold region in Argentinean Patago- nia. A study at different fermentation scales” J. Appl. Microbiol. 93: 608–615,• Ludovico P, Souza MJ, Silva MT, Leao C, Corte-Real MV (2001) “Saccha- romyces cerevisiae commits to a programmed cell death process in re- sponse to acetic acid” Microbiol. 147: 2409-2415.• Magyar I, Tóth T (2011) “Comparative evolution of some enological proper- ties in wine strains of Candida stellata, Candida zemplinina, Saccharomyces uvarum and Saccharomyces cerevisiae” Food Microbiol. 28: 94-100.• Mannazzu I, Simonetti E, Marinangeli P, Guerra E, Budroni M, Thangavelu M, Bowen S, Wheals A E, Clementi F (2002) “SED1 gene length and sequence polymorphisms in feral strains of Saccharomyces cerevisiae” Appl. Environ. Microbiol. 68: 5437-5444. 129• Marinangeli P, Angelozzi D, Ciani M, Clementi F, Mannazzu I (2004a) “Mini- satellites in Saccharomyces cerevisiae cell wall genes: a new way towards wine strain identification” FEMS Yeast Res. 4: 427-435.• Marinangeli P, Clementi F, Ciani M, Mannazzu I (2004b) “SED1 polymorphism within the genus Saccharomyces” FEMS Yeast Res. 5: 73-79.• Martinez C, Cosgaya P, Vasquez C, Gac S, Ganga A (2007) “High degree of correlation between molecular polymorphism and geographic origin of wine yeast strains“ J. Appl. Microbiol. 103: 2185–2195.• Martinez J, Millan C, Ortega JM (1989) “Growth of natural flora during the fermentation of inoculated musts from “Pedro Ximenez” grapes” S. Afr. J. Enol. Vitic. 10: 31-35• Martini A, Ciani M, Scorzetti G (1996) “Direct enumeration and isolation of wine yeasts from grape surface” Am. J. Enol. Vitic. 47: 435-440.• Masneuf I (2003) “Yeasts: state of the art” Vignevini 30: 41-60.• McGrath A, Higgins DG, McCarthy TV (1998) “Sequence analysis of DNA randomly amplified from the Saccharomyces cerevisiae genome” Mol. Cell. Probes 12: 397–405.• Mercado L, Dalcero A, Masuelli R, Combina M (2007) “Diversity of Saccha- romyces strains on grapes and winery surfaces: Analysis of their contribution to fermentative flora of Malbec wine from Mendoza (Argentina) during two consecutive years“ Food Microbiol. 24: 403–412.• Montrocher R, Verner M, Briolay J, Gautier C, Marrneissel R (1998) “Phyloge- netic analysis of the Saccharomyces cerevisiae group based on polymorphi- sms of rDNA spacer sequence” Int. J. Syst. Bact. 48: 295-303.• Mora J, Barbas JI, Mulet A (1990) “Evolution of the yeast microflora during
  • 128. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… the first days of fermentation in inoculated Majorcan musts” Microbiologia 6: 65-70. • Mortimer R, Polsinelli M (1999) “On the origins on wine yeast” Res. Microbiol. 150: 199-204. • Nadal D, Colomer B, Pi˜na B (1996) “Molecular polymorphism distribution in phenotypically distinct populations of wine yeast strains” Appl. Environ. Microbiol. 62: 1944–1950. • Nakamura S, Haraguchi K, Mitani N, Ohtsubo K (2007) “Novel preparation method of template DNAs from wine for PCR to differentiate grape (Vitis vinifera L.) cultivar” J. Agric. Food Chem. 55: 10388-10395. • Ness F, Lavalle F, Dubourdieu D, Aigle M, Dulau L (1993) “Identification of yeast strains using the polymerase chain reaction” J. Sci. Food Agric. 62:89–94. • Nikolaou E, Andrighetto C, Lombardi A, Litopoulou-Tzanetaki E, Tzanetakis N (2007) “Heterogeneity in genetic and phenotypic characteristics of Sac- charomyces cerevisiae strains isolated from red and white wine fermenta- tions” Food Cont. 18: 1458–1465. • Nisiotou A, Nychas GJ (2007) “Yeast populations residing on healthy or Botrytis-infected grapes from a vineyard in Attica, Greece” Appl. Environ. Microbiol. 73: 2765–2768. • Ocón E, Gutiérrez AR, Garijo P, López R, Santamaría P (2010) “Presence of non-Saccharomyces yeasts in cellar equipment and grape juice during130 harvest time” Food Microbiol. 27: 1023-1027. • Peakal R, Smouse PE (2006) “GENALEX 6: genetic analysis in Excel. Popula- tion genetic software for teaching and research” Mol. Ecol. Notes 6: 288- 295. • Perez MA, Gallego FJ, Hidalgo P (2001) “Evaluation of molecular techniques for the genetic characterization of Saccharomyces cerevisiae strains” FEMS Microbiol. Lett. 205: 375–378. • Peréz-Coello MS, Briones Perez AI, Ubeda Iranzo JF, Martin Alvarez PJ (1999) “Characteristics of wines fermented with different Saccharomyces cerevisi- ae strains isolated from the La Mancha region” Food Microbiol. 16: 563-573. • Peynaud E, Domercq S (1959) “A review of microbiological problems in wine-making in France” Am. J. Enol. Vitic. 10: 69-77. • Phaff HJ, Knapp EP (1956) “The taxonomy of yeasts found in exudates of certain trees and other natural breeding sites of some species of Drosophi- la” Ant. Leeuw. 22: 117-130. • Prakitchaiwattana CJ, Fleet GH, Heard GH (2004) “Application and evalu- ation of denaturing gradient gel electrophoresis to analyse the yeast ecol- ogy of wine grapes“ FEMS Yeast Res. 4: 865–877. • Pramateftaki PV, Lanaridis P, Typas MA (2000) “Molecular identification of wine yeasts at species or strain level: a case study with strains from two vine- growing areas of Greece” J. Appl. Microbiol. 89: 236-248. • Pretorius IS (2000) “Tailoring wine yeast for the new millennium: novel ap- proaches to the ancient art of winemaking“ Yeast. 16: 675-729. • Pretorius IS, Van der Westhuizen TJ, Augustyn OPH (1999) “Yeast biodiversity in vineyards and wineries and its importance to the South African wine in- dustry” S. Afr. J. Enol. Vitic. 20: 61–74.
  • 129. Bibliografia• Pulvirenti A, Caggia C, Restuccia C, Gullo M, Giudici P, 2001, DNA finger- printing methods used for identification of yeasts isolated from Sicilian sour- doughs. Ann. Microbiol 51:107–120• Querol A, Barrio E, Huerta T, Ramon D (1992) “Molecular monitoring of wine fermentations conducted by active dry yeast strains” Appl. Environ. Micro- biol. 58: 2948-2953. ˇ ˇ• Raspor P, Milek DM, Polanc J, Moz ina SS, Cadez C (2006) “Yeasts isolated ˇ from three varieties of grapes cultivated in different locations of the Dolen- jska vine-growing region, Slovenia” Int. J. Food Microbiol. 109: 97–102.• Redzˇepovic S, Orlic S, Sikora S, Majdak A, Pretorius IS (2002) “Identification and characterization of Saccharomyces cerevisiae and Saccharomyces paradoxus strains isolated from Croatian vineyards” Lett. Appl. Microbiol. 35: 305–310.• Ribéreau-Gayon P (1985) “New developements in wine microbiology” Am. J. Enol. Vitic. 36: 1-10.• Ribereau-Gayon P, Dubordieu D, Donèche B, Lonvaud A (1998) “Traitè d’o- enologie” Vol. 1. Ed. Dunod. Paris.• Ribéreau-Gayon P, Dubourdieu D, Donèche B, Lonvaud A et al. (2000) “Cy- tology, Taxonomy and Ecology of Grape and Wine Yeast“. In Handbook of Enology vol. 1, John Wiley and Sons, 2000, West Sussex, England, pp. 1–49.• Romancino D, Di Maio S, Muriella R, Oliva D (2008) “Analysis of non-Saccha- romyces yeast populations isolated from grape musts from Sicily (Italy)” J. 131 Appl. Microbiol. 105: 2248–2254.• Rosi I (2005) “Impatto del lievito sulla qualità del vino” Atti del Convegno: Biotecnologie e qualità nei vini. Seminario di Aggiornamento, Fondazione per le Biotecnologie (Torino).• Rosi I, Domizio P, Fia G, Ugolini S, Agnolotto R (1998) “Costituzione di una banca di lieviti da vino: studio della loro biodiversità e selezione dei ceppi presenti nell’areale del Chianti Classico” Atti del Convegno: Biodiversità dei lieviti e qualità del vino nel territorio del Chianti fiorentino, pp: 19-35 (Firenze).• Sabate J, Cano J, Esteve-Zarzoso B, Guillamon J (2002) “Isolation and iden- tification of yeasts associated with vineyard and winery by RFLP analysis of ribosomal genes and mitochondrial DNA” Microbiol. Res. 157: 267–264.• Savazzini F, Martinelli L (2006) “DNA analysis in wine: Development of meth- ods for enhanced extraction and real-time polymerase chain reaction quantification” Anal. Chim. Acta 563: 274-282.• Scanes KT, Hohmann S, Prior BA (1998) ”Glycerol production by the yeast Saccharomyces cerevisiae and its relevance to wine: a rewiev” S. Afr. J. Enol. Vitic. 19: 17-22.• Schuller D, Valero E, Dequin S, Casal M (2004) “Survey of molecular methods for the typing of wine yeast strains” FEMS Microbiol. Lett. 231:19–26.• Shinohara T, Furuya H, Yanagida F, Miki T (2003) “Ecological distribution and phenotypic diversity of Saccharomyces cerevisiae strains from the wine- producing area in Yamanashi, Japan” Microbiol. Cult. Coll. 192: 69-80.• Sipiczki M (2003) “Candida zemplinina sp. Nov., an osmotolerant and psy- chrotolerant yeast that ferments sweet botrytized wines” Int. J. Syst. Evol. Microbiol. 53: 2079-2083.
  • 130. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… • Steger CLC, Lambrechts MG (2000) “The selection of yeast strains for the production of premium quality South African brandy base products” J. Ind. Microbiol. Biotechnol. 24: 431-440. • Tamura K, Dudley J, Nei M, Kumar S (2007) “MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0” Mol. Biol. Evol. 24: 1596-1599. • Tofalo R, Chaves-López C, Di Fabio F, Schirone M, Felis GE, Torriani S, Papa- rella A, Suzzi G (2009) “Molecular identification and osmotolerant profile of wine yeasts that ferment a high sugar grape must” Int. J. Food Microbiol. 130: 179-187. • Torija M, Rozes N, Poblet M, Guillamon J, Mas A (2001) “Yeast population dynamics in spontaneous fermentations: Comparison between two differ- ent wine-producing areas over a period of three years” Ant. Leeuw. 79: 345–352. • Török T, Mortimer RK, Romano P, Suzzi G, Polsinelli M (1996) “Quest for wine yeasts – an old story revisited” J. Ind. Microbiol. 17: 303-313. • Torriani S, Zapparoli G, Suzzi G (1999) “Genetic and phenotypic diversity of Saccharomyces sensu stricto strains isolated from Amarone wine. Diversity of Saccharomyces strains from Amarone wine” Ant. Leeuw. 75: 207-215. • Tosi E, Azzolini M, Guzzo F, Zapparoli G. (2009) “Evidence of different fermen- tation behaviours of two indigenous strains of Saccharomyces cerevisiae and Saccharomyces uvarum isolated from Amarone wine” J. Appl. Micro-132 biol. 107: 210-8. • Tristezza M, Gerardi C, Logrieco A, Grieco F (2009) “An optimized protocol for the production of interdelta markers in Saccharomyces cerevisiae by using capillary electrophoresis” J. Microbiol. Meth. 78: 286–291. • Tristezza M, Vetrano C, Bleve G, Grieco F, Tufariello M, Quarta A, Mita G, Spa- no G, Grieco F (2012) “Autochthonous fermentation starters for the industrial production of Negroamaro wines” J. Ind. Microbiol. Biotech. 39: 81-92. • Valero E, Cambon B, Schuller D, Casal M, Dequin S (2007) “Biodiversity of Saccharomyces yeast strains from grape berries of wine-producing areas using starter commercial yeasts” FEMS Yeast Res. 7: 317–329. • Vaughan-Martini A, Martini A (1995) “Facts, myths and legends on the prime industrial microorganism” J. Ind. Microbiol. 14: 514-522. • Versavaud A, Courcoux P, Roulland C, Dulau L, Hallet JN (1995) “Genetic diversity and geographical distribution of wild saccharomyces cerevisiae strains from the wine-producing area of Charentes, France” Appl. Environ. Microbiol. 61: 3521–3529. • Vigentini I, Picozzi C, Volonterio G, Foschino R (2007) “Exploration of the nucleotide polymorphism of Saccharomyces cerevisiae genes involved in wine production” From Alcoholic beverages to bioethanol for transporta- tion: a new challenge for fermenting yeast. International Specialized Sym- posium on Yeasts (ISSY26), Book of Abstract, p. 102; 3-7 June, Sorrento (Italy). • Vilanova M, Martinez C, Sieiro C, Massneuf I, Dubourdieu D (2003) “Ecol- ogy of Saccharomyces cerevisiae in spontaneous fermentations at a Rias Baixas appellation controle winery“ J. Inst. Brew. 109: 305–308. • Vincenzini M, Romano P, Farris GA (2005) “Microbiologia del vino” Casa edi- trice ambrosiana Milano.
  • 131. Bibliografia• Xufre A, Albergaria H, Gírio F, Spencer-Martins I (2011) “Use of interdelta polymorphisms of Saccharomyces cerevisiae strains to monitor population evolution during wine fermentation” J. Ind. Microbiol. Biotechnol. 38:127-32.• Zilio F, Lombardi A, De Dea P, Tosi E (2000) “Caratterizzazione e selezione di lieviti per il vino Soave D.O.C.” Vignevini 27: 98-104.• Zilio F, Tosi E, Lombardi A, Delfini C (2004) “Contributo alla valorizzazione del vino Valpolicella D.O.C. mediante l’isolamento, la caratterizzazione ed il successivo impiego di lieviti specifici Vignevini” 31: 75-80.• Zott K, Claisse O, Lucas P, Coulon J, Lonvaud-Funel A, Masneuf-Pomarede (2010) “Characterization of the yeast ecosystem in grape must and wine using Real-time PCR”. Food microbiol. 27: 559-567. 133
  • 132. Valorizzazione delle D.O.C.G. Franciacorta ed Oltrepò Pavese metodo classico… Ringraziamenti Il lavoro è stato lungo, difficile ma proficuo, molte persone sono state coinvolte e dunque per prima cosa ci sentiamo in dove- re di ringraziare i tecnici, gli enologi, gli studenti e i docenti che con noi hanno partecipato con disponibilità, condiviso gli sforzi e contribuito con passione a diversi livelli al successo del progetto. Per Regione Lombardia: Rossana Tonesi134 Sul territorio della Franciacorta: Monica Faccincani Michele Ferrari Silvia Filisetti Guido Gandossi Luca Rossi Alessandro Schiavi Silvia Uberti Raffaello Vezzoli Giuseppe Vezzoli Sul territorio dell’Oltrepò Pavese: Giacomo Barbero Alice Colombo Alessandra Leoni Carlo Alberto Panont Andrea Rossi Daniele Zangelmi All’Università di Milano: Andrea Barbieri
  • 133. Ringraziamenti Fabrizio Cadei Osvaldo Failla Simone Fiori Angelo Moretti Federico Predavini Mara Rossoni Federica Valdetara Ringraziamo le aziende che ci hanno permesso di effettuare ilcampionamento nei loro ambienti (vigneti e cantine) e, in parti-colare, talune di loro che hanno realizzato le prove di spumantiz-zazione. Senza la loro preziosa collaborazione alcuni obiettivi delprogetto non si sarebbero potuti raggiungere. Per il Consorzio per la Tutela del Franciacorta Società Agricola Bellavista Società Agricola Ca’ del Bosco Azienda Agricola Ferghettina 135 Società Agricola Majolini Società Agricola Mirabella Villa Crespia Fratelli Muratori Società Agricola Uberti Azienda Agricola Vezzoli Per il Consorzio Tutela Vini Oltrepò Pavese Azienda Agricola Anteo Azienda Agricola Caseo Azienda Agricola Conte Giorgi di Vistarino Azienda Agricola Isimbarda Società Agricola Quaquarini Azienda Agricola Podere San Giorgio Azienda Agricola Tenuta il Bosco Azienda Agricola Tenuta Mazzolino Azienda Agricola Travaglino Azienda Agricola Verdi Il responsabile scientifico e i suoi collaboratori
  • 134. Finito di stampare nel mese di novembre 2012 presso Arti Grafiche Editoriali srl, Urbino
  • 135. Ricerca e Sperimentazione in Agricoltura www.agricoltura.regione.lombardia.it