Gate bt papers

GRASSROOTS ACADEMY GATE-BIOTECH- 2000 2O00

GATE BIOTECHLOGY – 2000

1. The substrate for restriction enzyme is
(A) Single stranded RNA (B) Partially double stranded RNA
(C) Cell wall proteins (D) Double stranded DNA

2. The G – C content of hyeterophage 13 double stranded DNA is 63%. What would you expect
the G + C content of its mRNA?
(A) About 68% (B) about 34%
(C) About 32% (D) about 86%

3. DNA helicases catalyse the reaction
(A) DNA supercoling (B) DNA unwinding
(C) Cleavage f DNA helix (D) Interconversion of DNA topoisomers

4. In human populations 4% of the individuals are homozygous recessive to a specific RELP
marker. What percentage of individuals do you expect to be heterozygous for this trait?
(A) 4% (B) 8%
(C) 16% (D) 32%

5. Rho – dependent and rho – independent transcription termination mechanisms operate in
prokaryotes, Rho- independent termination mechanism involves
(A) Binding of the rho protein upstream of the termination element
(B) No protein factors and only RNA secondary structure and run of ‘U’s
(C) Presence of UGA or UAA stop codons
(D) Binding of accessory factors at termination single
1
6. Many plasmids have amp marker. This implies
(A) The plasmids contain genes for ampicillin biosynthesis
(B) Ampicillin is required for bacterial growth after transformations
(C) The plasmid contains the gene encoding β – lactamase
(D) Ampicillin is essential for cell survival

7. Choose the correct completion of the following statement. A fermenter sterilization in situ is less
efficient than continuous heat sterilization because
(A) it uses higher temperature for longer time
(B) it uses longer heating time during which heat is lost
(C) it uses larger volume and hence takes longer to cool the medium
(D) it uses steam as the heating source

8. Which of the following has been produced commercially from mammalian cell cultures?
(A) Plasminogen activator
(B) Antibacterial antibiotics
(C) Insulin
(D) Renin

9. Mung bean nuclease could be used for
(A) DNA synthesis
(B) Nucleotide hydrolysis
(C) Trimming single stranded regions in DNA
(D) Removal of phosphate groups from the ends of the DNA

10. Phage 17 promoter containing plasmids are used for overexpression of cloned genes because
(A) Their convenient size
(B) Their single stranded nature
(C) Exquisite specificity of T7 RNA polymerase to phage promoters
(D) T7 infects E. coli and lysogenizes the cell

Grassroots,2274, Hudson line, Kingsway Camp, Near Delhi Univ, New Delhi, 9891602060,
9350232207. www.grassrootsacademy.in


11. In eukaryotes the ribosomal RNA genes are transcribed by
(A) Reverse transcriptase
(B) RNA dependent RNA polymerase
(C) RNA polymerase I
(D) RNA polymerase III

12. Yeast artificial chromosome (YAC) is used for
(A) Cloning large segments of DNA
(B) Cloning only genomic sequences
(C) Cloning of only cDNA sequences
(D) All DNA except plant DNA sequences

13. The rerm protein splicing refers to
(A) Removal of intervening sequences between the genes
(B) Splicing out of introns from RNA
(C) Removal of intervening protein sequences from the translated protein
(D) Joining (splicing) of two different gene products to generate a novel protein

14. Which one of the following is not a requirement for a PCR reaction?
(A) DNA template (B) Taq polymerase
(C) NTPs (D) MgCl 2

15. In secondary metabolism two distinct phases- trophophase and idiophase refer respectively to
(A) Growth and production phase
(B) Early and late phase
(C) Primary and secondary metabolism
(D) Lag phase and log phase

16. Which of the following eukaryotic organism has been proven to be of great industrial
importance?
(A) Pencillium chrysogenum
(B) Saccharomyces cerevisiae
(C) Bacillus subtilis
(D) Streptomyces grisents

17. Plants breeders have an advantage over animal breeders in reproducing a desired type
offspring because the plant breeders can employ
(A) Gene mutations
(B) Hybridation
(C) Clonal propagation
(D) Sélection

18. Which one of the following options related to the following statement is incorrect? In comparison
to physical / chemical methods of clean up, bioremediation methods
(A) Use relatively simple techniques
(B) Generally end up with hazardous waste material
(C) Are relatively slow
(D) Are unobtrusive and non-disruptive

19. Abzymes are
(A) Enzymes that are highly specific like antibodies
(B) Antibodies that have catalytic activities
(C) Also referred to as zymogens
(D) Enzymes which hydrolyse antibodies

20. cDNA made from the mRNA of an organism was used to make a cDNA library in a vector that
allows the expression as a fusion with a reporter tag. What percentage of the cDNA clones is
likely to give rise to correct gene products?



(A) 10% (B) 30%
(C) 50% (D) 100%

21. Commonly used reporter gene in plant expression vectors is
(A) Ti gene of Agrobacterium tumifaciens
(B) GUS gene
(C) β – lactamase gene
(D) α – amylase gene

22. Which one of the following is not a protease?
(A) Proteosome (B) Trypsin
(C) Chrymotrypsin (D) Peptidyl tRNA hydrolase

23. The Pasteur Effect is
(A) Inhibition of glucose utilization and lactate accumulation in glycolysis
(B) Sterilization of milk
(C) Vaccine production
(D) Heat treatment of bacteria

24. Detection of which hormone is the commonly used test for pregnancy in humans?
(A) LH (B) FSH
(C) Charionic gonadotropin (D) Estrogen

25. PKU is one of the best known hereditary disorders in amino acid metabolism. The defects is
attributed to a lesion in one of the following enzymatic activities
(A) Phenylalanine ammonia lyase
(B) Phenylalanine hydroxylase
(C) Tryosine hydroxylase
(D) Phenylalanine transaminase

26. (a) Match the column A with those in column B
(A) Chemical sequencing of DNA (1) Southern
(B) DNA blotting (2) Temin, Baltimore & Dulbecco
(C) Monoclonal antibodies (3) F. Sanger
(D) Reverse transcription (4) Maxam and Gilbert
(E) Protein sequencing (5) Kohler and Milstein
(F) Polymerase chain reaction (6) K. Mullis

(b) If all the steps in a PCR reaction were to work at 100% efficiency, how many micrograms of
1 Kb product will be generated from 1 p mole of DNA template after 10 cycles (1 bp= 660
Da)

27. Write whether the following statements are true or false
(A) Three important characteristics in performance of biosensors are selectivity, sensitivity and
stability
(B) Activated sludge process is one of the most common anaerobic sewage treatment methods
(C) A pressure eycie is a type of air lift fermentor
(D) Monoclonal antibodies are used extensively in diagnosis of haematopoietic cancers

28. (a) Explain in one sentence why you can not have monoclonal antibodies which can react with
most cells
(b) What are bispecific monoclonal antibodies?
(c) How bispecific monoclonal antibodies can be generated.
(Give two methods)

29. (a) What is somatic embryogenesis?

(b) What is the difference between direct and indirect somatic embryogenesis?



(c) State two methods for direct DNA transfer into plant cells

30. The double stranded DNA molecule of a virus was found by electron microsopy to have a length
of 34 μM.

(a) How many nucleotide pairs are there in one molecule?

(b) How many complete turns of the two polynucleotide chains are present in such a double helix?

31 A protein PZ is present in genetically engineered bacteria at 5% of the total protein (0.1 pico
8
gram) per cell 1 ml of log phase culture contains 2 X 10 cells while stationary phase culture
4
contains 1 x 10 cells. The molecular weight of the protein is 30,000 Da and the Avogadro
23
number is 6.02 x 10 molecules / mole. What is the number of molecules of PZ per cell?
Calculate the amount of protein in milligrams in one liter each of log phase and stationary phase
cultures.


GRASSROOTS ACADEMY GATE-BIOTECH 2001 .


1. The limiting factor in the production of large quantities of ethanol as bio-fuel is
(A) Lack of a balanced medium
(B) Ethanol to toxicity to cells
(C) Expensive downstream processing steps
(D) Only (B) and (C) of the above

2. Gel retardation assay is routinely used to monitors interaction between
(A) Proteins (B) Drug and nucleic acid
(C) Nucleic acid (D) Protein and nucleic acid

3. Efficient expression of a heterologous protein product is influenced by
(A) Transcriptional efficiency
(B) Copy number of the plasmid
(C) Codon bias
(D) All of the above

4. The fundamental feature of the genetic code which allows the expression of a protein in any host
is its
(A) Triplet nature (B) Universality
(C) Degeneracy (D) Redundancy

5. When thymidine synthesis is inhibited eukaryotic cells will be arrested at
(A) End of S phase (B) End of M phase
(C) G1/S Interphase (D) G2/ M Interphase

6. To PCR amplify the sequence
(A) ATCTTCTACG (B) AAGCTTGCGG
(C) TAGAAGATGC (D) TTCGAACGCC

The required primers are
(A) ATCTTCTA and CGAACGCC
(B) ATCTTCTA and CCGCAAGC
(C) TAGAAGAT and CGAACGCC
(D) TAGAAGAT and CCGCAAGC

7. The major groove of DNA is lined by

(A) N3 of purine and N1 of pyrimidine
(B) N7 of purine and O2 of pyrimidine
(C) N7 of purine and C4 of pyrimidine
(D) None of the above

8. The heterozygosity of any locus can be ascertamed by
(A) RFLP analysis (B) SNPs
(C) FISH analysis (D) Either RFLP analysis of SNPs

9. BAC which can be used to clone large DNA fragments, is derived from
(A) colE plasmid (B) F plasmid
(C) 2μ (D) Mu phage

10. Antibody diversity is generated by
(A) Protein splicing (B) Somatic mutation
(C) Allelic exclusion (D) Inter-chromosomal recombination

Grassroots, 2274, Hudson Line, Kingsway Camp, Near Delhi Univ. Delhi-9.
9891602060, 9352232207. www.grassrootsacademy.in |


11. Resistance to herbicide chlorsulfuron in plants is due to a change in
(A) Glutamine synthetase (B) Threnine deaminase
(C) Acetolactate synthase (D) DNA polymerase

12. A heterologous protein for its expression in the milk of transgenic animal should be under the
control of the promoter of the gene coding for
(A) β-Globin (B) β-Lactoglobulin
(C) Preproinsulin (D) lacZ

13. To isolate a gene coding for glucagons, the cDNA library has to be constructed using mRNA
isolated from
(A) Intestine (B) Pancreas
(C) Pituitary (D) Brain

14. If the fractional recovery at each step of unit operation is 0.8, the recovery after 4 steer will be
(A) 0.24 (B) 3.23
(C) 0.41 (D) 0.82

15. The factor (s) likely to increase the rate of reaction catalyzed by a surface immobilized enzyme is
/are
(A) Increased agitation of the bulk liquid containing the substrate
(B) Continued replacement of the bulk liquid containing the substrate
(C) Increased concentration of the substrate in the bulk liquid

16. Which of the following cases are likely to lead to taster rate of catalysis by an enzyme
immobilized on an negatively charged support?
(A) A positively charged substrate and a negatively charged product
(B) A negatively charged substrate and a positively charged product
(C) A positively charged substrate and a positively charged product

17. The essential component of Ti plasmid required for integration into plant genome is
(A) Origin of replication (B) Tumor inducing gene
(C) Nopaline utilization gene (D) All of the above

18. Positional cloning approach exploits information
(A) On the location of the gene in the genome
(B) On the status of its expression
(C) About the position of promoter relative to MCS
(D) About the position of the restriction sites

19. Hormone pairs required for a callus to differentiate are
(A) Auxin and cytokinin (B) Auxin and gibberellin
(C) Ethylene and gibberellin (D) Cytokinin and gibberellin

20. Reverse genetics means
(A) Finding the function of a ORF
(B) Finding the gene responsible for a trait
(C) RNA dependent DNA synthesis
(D) Converting somatic cell to a germ cell

21. Which of the following statements applies to the operation of a fed-batch process?
(A) The volume of the culture increases with time
(B) it helps controlling repressive effects of the nutrient being fed
(C) It eliminates the need for oxygen supply
(D) Only (A) and (B) of the above



22. A gene can not be isolated from a human genomic DNA library by functional complementation in
E. coli because of
(A) None functional promoter
(B) The absence of splicing machinery
(C) Coupled transcription and translation
(D) Codon bias

23. In large-scale fermentation the preferred method of sterilization is
(A) Chemicals (B) Radiation
(C) Filtration (D) Hear

24. Embryo rescues is a useful technique to
(A) Grow / generate hybrids between different plant species
(B) Complete the growth of embryos susceptible to defects in seed development
(C) Break the dormancy of seeds

25. Which of the following is not true of aerobic digestion?
(A) It generates most sludge
(B) It generally incurs higher running cost
(C) It may generate a usable fuel
(D) Requires a shorter residence time

26. Match the products in Column A with their corresponding organisms in Column B

Column A Column B
(A) Aspergillus niger 1. Lysine
(B) Saccharomyces cerevisiae 2. Citric acid
(C) Penicillum chrysogenum 3. Acetone / butanol
(D) Lactobacillus casei 4. Vitamin B 12
(E) Corynebacterium glutamicam 5. Erythromycin
6. β- Lactam
7. Diacetyl
8. Ethanol

27. Match the unit operations in Column A with the most appropriate recovery stage in Column B

Column A Column B
(A) Drying 1. Pretreatment
(B) Sédimentation 2. Purification
(C) Membranes 3. Formulation
(D) Cell disruption 4. Solid/ liquid separations
(E) Chromatography 5. Solid / solid separation
6. Concentration
–1
28. (a) A chemostat is operating at state at a dilution rate of 0.1 hr and a limiting nutrient
–1
concentration of 10 μM. If the μ max for the organism is 0.5 hr calculate the Monod constant for
the nutrient.
(b) Why asparagine is used in anticancer therapy?

29. (a) Write the reaction catalyzed by penicillin G acylase
(b) Name any two techniques by which penicillin G acylase may be immortalized
(c) Why are mammalian cells cultured in CO 2 incubators?
(d) Mention an important post translational modification absent in prokaryotes maxing them
unsuitable hosts for expressing human genes.



30. (a) The sequences at the cloning site of three vectors are given below. The BamH I (GGATCC)
and Hind III (AAGCTT) sites are underlined. Only the sequences around the restriction site are
shown. The symbol “______” indicates rest of the sequence.

Vector 1: ___Promoter …ATGGGTCGCGGATCCGGCTGC…AAGCTT ____

Vector 2: ___Promoter …ATGGGTCGGGATCCGGCTGCT…AAGCTT ____

Vector3: ___ Promoter…ATGGGTCGGATCCGGCTGCTA…AAGCTT _____

Which one of the above three vectors is appropriate to clone the following ORF

_____ ATGCCCAACACCCGGATCCCG… TAAAAGCTT _______

For expression? Give the reaction in one sentence.

(b) Draw the restriction map of the plasmid given the following data (the gel pattern shown below
is not to scale). The size of each DNA fragment (in kb) is indicated next to it.

ecoR 1 Sal1 Hind III EcoR I & Sal 1& EcoR 1 &
Hind III Hind III Sal I
5.4__ 5.4__

3.6__

2.1 __ 2.1__

1.9 __ 1.9 __ 1.8 __

1.4 __ 1.4 __ 1.4 __

1.3 __ 1.2 __

0.9 __

0.6 __


in
y.
e m
ad
s ac
ot
ro
ss
ra
.g
w
w
w

Grassroots, 2274, Hudson Line, Near Delhi Univ, 9891602060.


GATE BIOTECHNOLOGY – 2003

1 – 10 carry one mark each.

1. Which of the following processes require energy?
(A) Ligation (B) Transformation
(C) Restriction digestion (D) Hybridization

2. To be a cloning vector, a plasmid does NOT require
(A) An origin of replication
(B) An antibiotic resistance market
(C) A restriction site
(D) To have a high copy number

3. In animal cell culture, the addition of serum to media is essential for providing
(A) Amino acids for protein synthesis
(B) Nucleotides for DNA synthesis
(C) Growth factors

4. In the course of cell cycle, the level of the protein cyclin abruptly falls during
(A) G 1 phase (B) S phase
(C) G 2 phase (D) M phase

5. Enzyme papain is used with success to
(A) Increase meat production (B) Leaven bread
(C) Ripen papaya fruit (D) Tenderize meat

6. Microbes bring about biological transformation of xenobiotic compounds by
(A) Degradation (B) Conjugation
(C) Detoxification (D) All of the above

7. Which one of the following reactions is used for the purpose of recycling enzymes in
bioprocesses?
(A) Isomerization (B) Immobilization
(C) Phosphorylation (D) Polymerization

Answer 8 – 9 based on the data given below

Dr. Singh isolated a new 5 kb gene and wants to determine its sequence using a sequencer that
sequence upto 500 bases in a single reaction. Therefore, she decides to create subclones
having suitable size inserts for sequencing.

8. Which one of the following will be the most appropriate restriction enzymes for the subeloning?
(A) 8 – bp cutter (B) 6 – bp cutter
(C) 3 – bp cutter (D) 5 – bp cutter

9. To generate the minimum number of subclones needed for sequencing. What should be the
size of the insert in these subclones?
(A) 1000 bp (B) 500 bp
(C) 250 bp (D) 2000 bp

10. All of the following are true about DNA microarray technology except
(A) An electron microscope is used to gather data from the arrays
(B) The technology is used to assess transcription from multiple genes simultaneously
(C) The technology works best for organisms whose genome is completely sequenced
(D) The technology is derived from computer chip manufacture



11. You have cut the genome of a double – stranded viral genome with a restriction endonuclease
and and electrophoresed the products on an agarose gel. You observe only one band on the
gel, equivalent to the size of the genome. This is because
(A) There are no introns in the genome
(B) The introns contain recognition small to detect
(C) All of restriction n fragments are too small to detect
(D) Restriction endonuclease, do not an RNA , and this virus has an RNA genome

12. The restriction enonuclease Eco521 recognizes the sequence C/GGCGG and cuts between the
first C and the first G. indicated by the slash. DNA cut by which of the following enzymes (given
with their recognition sequences and cut sites) could be cloned into a plasmid digested with Eco
521?
(A) EcoRI (G/AATTC) (B) XmlII (C/GGCGG)
(C) Smal (CCC/GGG) (D) Sacll (CCGC/GG)

13. If bacterial cells are transformed with a mixture of linear and circular molecules resulting from a
ligation reaction designed to produces recombinant molecule
(A) No recombinant molecules will ever be detected
(B) Both linear a circular will replicate equally well
(C) none of the plasmids will express the antibiotic resistance gene located on the plasmid
(D) The circular molecules will be amplified by the cells

14. What is the primary purpose of neomycin in creating mice with knock outs in gene X?
(A) Neomycin selects for the survival of embryonic stem cells (ES) that have incorporated the
mutant gene X anywhere in the genome
(B) Neomycin selects for the survival of ES cells that have incorporated the mutant gene in the
place of the wild-type gene
(C) neomycin prevents Candida infection during ES cell culture that does not have gene X
(D) Neomycin makes the gene X knock-out mice resistant of Candida infection

15. Match the industrial application of the following enzymes
P. Penicillinase 1. Pharmaceutical
Q. Pectinase 2. Leather
R. Trypsin 3. Wine
S. Rennin 4. Dairy

(A) P-4, Q-3, R-1, S-2 (B) P-1, Q-3, R-2, S-1
(C) P-1, Q-2, R-3, S-4 (D) P-4, Q-2, R-3, S-1

16. To optimize the bioreactor system, which one of the following conditions is least important for
anaerobic fermentation?
(A) culture agitation to maintain oxygen supply
(B) restriction of the entry of contaminating organisms
(C) control of parameters like pH and temperature
(D) maintenance of constant culture volume

17. Match the activity spectrum the following antibiotics
P. Actinomycin D 1. Antifungal
Q. Daunorubicin 2. Antitubreculosis
R. Ritamycin 3. Antitumor
S. Griseofulvin 4. Antiprotosoal

(A) P-3, Q-4, R-2, S-1 (B) P-3, Q-1, R-4, S-2
(C) P-3, Q-1, R-2, S-4 (D) P-2, Q-1, R-4, S-3

18. Autoclaves are routinely used in laboratories for sterilization. It acts by
(A) Disrupting cell membranes
(B) Denaturing protein
(C) Changing physically membrane lipids



19. All of the following are produced by animal cells an culture and help the cells adhere to the
culture dish except
(A) Glycoproteins (B) Collagen
(C) Phospholipase A (D) Hyaluronic acid

20. The following are useful to introduce genes into crop plants except
(A) Ti plasmid (B) Particle gun
(C) Breeding (D) Auxin

21. Power number also called Newton’s number, is defined as a dimensionless parameter relating
to
(A) Turbulent flow
(B) The relative velocity between the nutrient solution and individual cells
(C) Energy required by the stirred reaction

22. The selection of the appropriate purification method in the product recovery after microbial
fermentation depends on the
(A) Nature and the stability of the end products produced
(B) Type of the side products present
(C) Degree of purification required
(D) all of the above

23. Which of the following techniques is NOT ideal for immobilizing cell free enzymes?
(A) Physical entrapment by encapsulations
(B) Covalent chemical bonding to surface carriers
(C) Physical bonding by flocculation
(D) Covalent chemical bonding by cross linking the precipitate

24. The full-length coding sequence of an eukaryotic gene was expressed in bacteria and the
protein was purified. However, in the functional assay, no activity was detected for the purified
protein. The reason could be
(A) The host bacteria produced and enzyme that inhibited the activity of the expressed
eukaryotic protein
(B) The purified protein was contaminated with bacteria
(C) The host bacteria did not produce the essential co-factors
(D) No post-translational modification on the protein expressed in bacteria




1. Expression of hundreds of different genes in DNA microarray technology is monitored by using
(A) Radioactive probe (B) Visible chromogenic probe
(C) UV absorbing probe (D) Fluorescent probe

2. Transfer of T-DNA from Ti plasmid into plant cell is mediated by
(A) mob gene (B) vir gene
(C) nif gene (D) octopine gene

3. For the growth of T-cell, the growth factor needed would be
(A) Epidermal growth factor (B) Interleukin-2
(C) Fibroblast growth factor (D) TNF-α

4. Nick translation of DNA is a method for making DNA probes. Identify from below what is NOT
required for nick translation method
(A) DNA polymerase (B) DNAase
(C) Frimers (D) Deoxyribonucleotides

5. During the functioning of biosensor which of the following sequences of events occurs
(A) Enzymatic/ Cellular reaction  detector  transducer
(B) Enzymatic / cellular reaction  transducer detector
(C) Enzymatic / cellular reaction  pressure gauge  time
(D) Enzymatic/ cellular reaction  vibrator  mechanical signal

6. During the media preparation for cultivation of cells, insoluble precipitates of calcium phosphate
are often formed. Identify which method can be adopted to avoid this problem
(A) Hold the pH at 5.6 (B) Hold the pH at 7.5
(C) Add calcium salt first and then phosphate source

7. Somatic embryogenesis is a procedure in plant tissue culture methodology described best as
(A) Formation of both root meristem
(B) Formation of stable embryos
(C) Formation of axillary buds

8. An immobilized enzyme being used in a continuous plug flow reactor exhibits an effectiveness
factor (η) of 1.2. the value of η being greater than one could be apparently due to one of the
following reasons. Identify the correct reason.
(A) The enzyme follows substrate inhibited kinetics with internal pre diffusion limitation
(B) The enzyme experiences external film diffusion limitation
(C) The enzyme follows sigmoidal kinetics
(D) The immobilized enzyme is operationally unstable

9. The degree of inhibition for non – competitive inhabitation of an enzyme catalyzed reaction
(A) Increases with increases in substrate concentration
(B) Reaches a maxima with increases in substrate concentration and then decreases
(C) Is independent of substrate concentration
(D) Decreases with increase in substrate concentration

10. The two columns given below indicate some of the fermentation products and the microbial
cultures used for their production. Identify the correct set of groups from the four options.
Fermentation products Microbial cultures
(a) Ethanol (p) Aspergillus niger
(b) Streptomycin (q) Zymomouas mabilis
(c) Citric acid (r) Streptonryces griseus
(d) Cellulase (s) Trichlderma reesei



(A) a-p, b-q, c-r, d-s (B) a-q, b-r, c-p, d-s
(C) a-q, b-r, c-s, d-p (D) a-s, b-r, c-q, d-p

11. The culture fluids of 1000 to 5000 colonies of hybridoma are screened for monoclonal antibody
by
P. western blot analysis
Q. antigen capture analysis
R. northern blot analysis
S. antibody capture analysis

Chose the correct pair from the following
(A) P, Q (B) Q, R
(C) R, S (D) Q, S

12. Tobacco leaf discs are transfected with Agrobacterium tumefaciens strain containing binary
vector (GUS as reporter gene) with selectable marker nco (kanamycin resistant gene) and then
regenerated to plants. The plants are kanamycin resistant but leaf tissues are negative to GUS
assay. The explanations are
(A) The plants are transformed for both genes but GUS gene is formed off
(B) The plants are transformed for only neo gene not the GUS gene
(C) The plants are not transformed at all, but the devolvement of kanamycin resistance is due to
somaclonal variation
(D) All the above

13. The restriction endonuclease HaeIII recognizes the sequence GGI CC and the point of cleavage
is given by the arrow. If you want to clone a piece of DNA in a plasmid digested by HaeIII, what
will be restriction enzyme of choice
(A) Smal (CCIGGG) (B) Not I (GC I GGCCGC)
(C) Salm III (GG I CC (D) Pst I (CTGCA I G)

14. For the sequence of ds DNA given below, identify the set of promoters required to amplify this
DNA by PCR
3′ GACTCCA …………… TACAACC5′
5′ CTGAGGT …………… ATGTTGG 3′

(A) 5′ GGTTGTA and 5′ GACTCCA
(B) 5′ CTGAGGT and 5′ CCAACAT
(C) 5′ACTCAGT and 5′ ATGTTGG

15. Expression of antisense RNA of ACC synthase in transgenic tomato plants inhibited the
synthesis of ethylene resulting in
(A) Change in color from green to red
(B) Change in aroma
(C) Change in color from red to green

16. Some of the genes from viruses introduced into plants in fully functional form often exhibit
Mendelian inheritance because
(A) The genes are stably integrated in chromosomes
(B) The genes are stably maintained in vectors
(C) The genes are co-expressed with chromosomal genes
(D) The genes are not interrupted by introns

17. Agrobacterium based transformation of protoplasts obtained from dicots is based on the fact
that
(A) These exhibit strong chromosomal structures
(B) These have two cotyledons
(C) These exhibit strong wound response
(D) These have long up root system



18. What would be the effect of addition f 2, 4-D on the production of berberine by cell culture of
Thalictrum minus
(A) To stimulate growth and thereby uncase secondary metabolite production
(B) Stimulate dedifferentiation and there by decrease secondary metabolite production
(C) Stimulate proliferation and reduce secondary metabolite production

19. Reverse veccinology indicates
(A) From antigenic protein to vaccine development
(B) From antigenic polysaccharide to vaccine development
(C) From antibody to vaccine development
(D) From genome sequence to vaccine development
–1 1
20. An enzyme following Michaelis – Menten kinetics with V m = 2.5 mmol m s and K m = 5.0 mM
was used to carry out the reaction in a batch stirred reactor. Staring with an initial substrate
concentration of 0.1 M, the time required for 50% conversion of the substrate will be about: (in
2 = 0.69)
(A) 01 hr (B) 06 hr
(C) 02 hr (D) 12 hr

21. The maximum reaction velocity (V m ) for an enzyme catalyzed reaction w. experimentally
measured at two different temperature and following results w obtained:
0
Temperature, C 27 37
–1 –1
V m mmol m s 2.25 4.50

The energy of activation for the reaction is
–1 –1
(A) 12834 cal mol (B) 25668 cal mol
–1 –1
(C) 6417 cal mol (D) 19251 cal mol

22. In a heterogeneous population of cells containing T-cell, B-cells and macrophages, the cells are
separated in the following scheme
Heterogenous  Cell suspension  superlatant cells  nylon wool
Cell suspension left in a Petri-plate passed through adhered cell
Plate for 3 hrs nylon wool column

Flow through cell
Identify the major population of cells present in Petri – plate, nylon wool adhered and nylon wool
column flow through respectively

(A) Macrophage, B-cell, T-cell
(B) T-cell, B-cell, macrophage
(C) Macrophage, T-cell, B-cell
(D) B-cell, T-cell, macrophage

23. Match the following genetic elements with their functions.
Genetic elements Functions
k
a. neo 1. Facilitates inducible expression of genes in eukaryotes
b. SV40 2. Facilitates constitutive expression of genes in eukaryotes
c. LTR 3. Allows amplification of gene
d. dhfr 4. Provides way of selecting eukaryotic cells, which have
received foreign DNA

(A) a  4, b  2, c  1, d  3
(B) a  2, b  4, c  1, d  3
(C) a 1, b  4, c  2, d  3
(D) a  4, b  2, c  3, d 1



24. In the cell cycle of a typical eukaryote, the sequence of events operating in the time on cell
division is
(A) S phase  G2 phase  G1 phase  M phase
(B) S phase  M phase  G1 phase  G2 phase
(C) S phase  G2 phase  M phase  G1 phase
(D) S phase  G1 phase  M phase  G2 phase

25. The kinetics of the disintegration of baker’s yeast cell in a bead mill is described as dp dt = k (P 0
– P). Where P is the concentration of protein released and P m is the maximum protein
3
concentration achievable K is the first order rate constant and is 0.5 hr for the system studied.
The time required for the release of 90% of the intercellular proteins will be
(A) 10 hr (B) 02 hr
(C) 4.6 hr (D) None of the above

26. Inversion of sucrose by immobilized invertase follows substrate inhibited kinetics. The reaction
–3 –1
rate (v) in mol m hr can be expressed as
2
V = 800 [S] ; {400 + 50 [S]: [S] }. Where [S] is the sucrose concentration. The immobilized
– 3
invertase preparation is used in a CSTR with 100 mol m sucrose concentrations in the feed
–3
stream. If the reaction velocity passes through a maxima at [S] = 20 mol m the feed flow rate
1
for a reactor volume of 1 m to get the maximum productivity from the reactor should be
2 –1 2 –1
(A) 0.11 m hr (B) 1.10 m hr
2 –1
(C) 5.05 m hr (D) none of the above

27. Examine the data given below in the table on purification of a protein X

Step volume protein concentration Enzyme activity
(ml) (mg/ml) (unit/ ml)
Crude cell - 500 12.0 5.0
Free extract

Ammonium 125 3.0 11.0
Sulfate precipitation

Ion – exchange
Chromatography 10 9.0 75.0

The yield present and purification factor respectively end of the experiment will be approximately

(A) 25 and 3 (B) 30 and 20
(C) 20 and 30 (D) 75 and 30




1. Cells of meristemoid are best described as
(A) Differentiated and non dividing
(B) Dedifferentiated and diving
(C) Differentiated and diving
(D) Dedifferentiated and non dividing

2. Ultra filtration process cannot be used for
(A) Fractionation of proteins
(B) Desalting
(C) Harvesting of cells
(D) Selective removal of solvents

3. The number of replicons in a typical mammalian cells us
(A) 40 – 200 (B) 400
(C) 1000 – 2000 (D) 50000 – 100000

4. What product will result from complete hydrolysis of soluble dextrin?
(A) Sucrose only (B) Fructose only
(C) Glucose and fructose only (D) Glucose only

5. Aeration is a bioreactor is provided by
(A) Impeller (B) Baffles
(C) Spurger (D) All of the above

6. The transplastomic plants bear no risk for gene transfer through pollens as
(A) The pollens degenerate before fertilization
(B) The transformed mitochondrial DNA is lost during pollen maturation
(C) The transformed chloroplast DNA is lost during pollen maturation
(D) The transformed genomic DNA are inherited during maturation

7. The mobility of DNA in agarose gel electrophoresis is solely based on its
(A) Charge (B) conformation
(C) Size (D) none of the above

8. Which of the following fluorescent probes is used to monitor the progress of amplification in Real
time PCR?
(A) SYBR green (B) Rhodamine
(C) FITC (D) Cyan blue

9. Expression of which of the following reporter a gene does not require addition of specific-
substrate for detection?
(A) Luciferase (B) β – Glucoronidase
(C) β – Glucosidase (D)Green fluorescent protein

10. Cibacron blue dye affinity chromatography can be used for affinity purification of

(A) NADPH dehydrogenase (B) Glucoamylase
(C) Subtitlin (D) Caspase

11. A linear DNA fragment is 100% labeled at one end and has transition since for EcoRt. If it is
partially digested by EcoRI so that all possible fragments are produced how many of these
fragments will be labeled?
(A) 4 labeled: 6 unlabeled (B) 4 labeled: 4 unlabeled
(C) 3 labeled: 5 unlabeled (D) 3 labeled: 3 unlabeled


12. Match the following products with their starting substrates
a) Sake 1) apple juice
b) Cider 2) grape juice
c) Wine 3) barley
d) Lager 4) rice

(A) a  4, b  1, c  2, d  3
(B) a  1, b  4, c  2, d  3
(C) a 2, b  3, c  1, d  4
(D) a  3, b  4, c  2, d 1

13. Identify the following antibiotics with their modes of action.

Antibiotic Mode of action
a) Ampicillin 1) inhibition of protein synthesis
b) Tetracycline 2) inhibition of cell wall synthesis
c) Nystatin 3) damage of cytoplasm membrane
d) Anthramycin 4) damage of DNA structure

(A) a  1, b  2, c  4, d  3
(B) a  2, b  1, c  3, d  4
(C) a  1, b  2, c  3, d  4
(D) a  3, b  4, c  2, d 1

14. In a bioreactor baffles are incorporated to
(A) Prevent vortex and to improve aeration efficiency
(B) Maintain uniform suspension of cells
(C) Minimize the size of air bubble for greater aeration
(D) Maintain uniform nutrient medium

15. Somatic embryo from cotyledon explant would develop in the following sequential stages.
(A) cotyledonary  heart  globular  torpedo
(B) Globular  torpedo  heart  cotyledonary
(C) Globular  heart  torpedo  cotyledonary
(D) cotyledonary  globular  heart  torpedo

16. Through the right border (RB) and left border (LB) of T-DNA are identical; the DNA transfer is
specific for the DNA left of the RB (the T-DNA), rather than for the DNA left of the LB because
(A) The sequence context at the RB defines the direction of transfer
(B) The sequence context at the LB defines the direction of transfer
(C) The nuclear location sequence (NLS) of VirD2 protein drives the excised T – strand
(D) The endonuclease activity of VirD2 protein allows nicking at RB

17. Determine the correctness or otherwise of the following Assertion [a] and Reason [r] Assertion:
An antigen recognized by one immunoglobulin subtype is not recognized by any other subtype
Reason: Immunoglobulin subtypes differ from each other both in the variable and in the constant
regions

(A) Both [a] and [r] are true and [r] is the correct reason for [a]
(B) Both [a] and [r] are true but [r] is not the correct reason for [a]
(C) Both [a] and [r] are false
(D) [a] is true but [r] is false

18. Identical sized RNA transcription is detected by Northern blot analysis of UDP glucuronosyl
transferase obtained from human liver and kidney. Micro x ray analysis of the same samples


shows equal spot intensity, where Western to bolt detects a 55 kDa strong band in liver, but a
very faint band in kidney of same size. The regulation of UDP glucuronosyl transferase is
(A) Transcriptionally controlled
(B) Post – transcriptionally controlled
(C) Translationally controlled
(D) Post – translationally controlled

19. Match the items on the left column with those on the right

Left Right
P. Programmed cell death 1. TMV coat protein
at site of infection
Q. Hormone upregulated during 2. EPSP synthase
flooding stress
R. Target for herbicide glyphosate 3. Hyper sensitive response
S. Pathogen-derived resistance 4. Ethylene

(A) P-1, Q-2, R-4, S-3 (B) P-3, Q-4, R-2, S-1
(C) P-1, Q-4, R-2, S-3 (D) P-3, Q-2, R-4, S-1

20. Expression in amunt and in inactive from of cDNA of a eukaryotic protein in Escherichia coli
using its expression vector is due to
(P) The absence of capping mechanism of mRNA
(Q) Codon bias
(R) Absence of polyadenylation
(S) Absence of proper glycosylation

Common Data for Questions 21, 22, 23:

A recombinant SV40 virus delivers c-myc cDNA, which has a unique Sal I site, into muscle cells.
Southern analysis of Sal I digested total genomic DNA of muscle cells using c-myc cDNA probe
generates a smear.

21. The DNA smear obtained on Southern blot is due to
(A) Head to head concatamer of viral DNA
(B) Head to tail concatamer of viral DNA
(C) Tail to tail concatamer of viral DNA
(D) Random integration of viral DNA

22. Western blot analysis of c-myc expression of such transformed cells last for
(A) Transiently (B) upto five generations
(C) Upto 10 generations (D) more than 100 generations

23. Which of the following types of cancer will be observed in such transformed cells?
(A) Adenoma (B) Melanona
(C) Sarcoma (D) Hepatoma

Common Data for Questions 25, 26:

Normal primary hepatocytes can be artificially immortalized. Certain spontaneous mutants of
immortalized hepatocytes are sensitive to ionizing radiation.

24. Which of the following genes are involved in Immortalization of primary hepatocytes?
(A) Telomerase and Cyclin D (B) NFkB and Thymidine kinase
(C) Cyclin D and myc (D) Telomerase and Ras

25. What would happen to the mutant cells by ionizing radiation?


(A) Apoptosis (B) Necrosis
(C) Cell growth strest (D) Cell proliferation

Linked Answer Questions 26a to 27b carry two marks each

An aliquot of competent E. coli cells were used for determinations of cell density by plasmid
count method and another aliquot was used for transformation by plasmid DNA

26. (a) E. coli culture (1 ml) was diluted 1: 1000000 and 200μl of this was used for plating. After 12h
incubation of the plate, the number of colony forming units (CFU) was 150. What is the total CFU
per ml in the original culture?
8 8
(A) 7.5 x 10 (B) 1.5 x 10
6 6
(C) 1.5 x 10 (D) 3.0 x 10

(b)Isolated plasmid DNA (5ng) was used for transformation of 100μl competent E. coli cells to
which 900μl of SOC medium was added. An aliquot of 50μl was plated on a selective plate. After
overnight incubation, 300 colonies were observed. Calculate the efficiency of transformation and
the percentage of transformation cells per ml of parent culture.
5
(A) 6.0 x 10 colonies pre μg of plasmid DNA, 0.01%
5
(B) 1.2 x 10 colonies pre μg of plasmid DNA, 0.02%
6
(C) 1.2 x 10 colonies pre μg of plasmid DNA, 0.008%
6
(D) 6.0 x 10 colonies pre μg of plasmid DNA, 0.1%

Statement for Linked Answer Question 27a & 27b

HMGCoA reductase that binds HMGCoA is the major rate limiting step in the cholesterol biosynthetic
pathway. Several inhibitors of this enzyme are used as potential drugs. The assay of the enzyme is
based on labeling the enzyme with radiolabeled HMGCoA and counting (cpm) the labeled enzyme
substrate complex in the presence (test) and in the absence (control) of the inhibitor. A blank is set up
that contains no enzymes

27. (a) The per cent inhibition for this enzyme is calculated from the equation
(A) {[cpm (control) – cpm (test)] / [cpm (control) – cpm (blank)]} x 100
(B) {[cpm (control) – cpm (test)] / [cpm (blank) – cpm (control)]} x 100
(C) {[cpm (test) – cpm (control)] / [cpm (control) – cpm (blank)]} x 100
(D) {[cpm (control) – cpm (blank)] / [cpm (test) – cpm (control)]} x 100

28. (b) An inhibitor is considered active of it causes more than 65% inhibition. The cpm values
respectively of control, test and blank samples for inhibitors W, X, Y and Z are given below some
reaction of the inhibitors in active.
(A) X – 8000, 4000 and 100 (B) W – 7000, 1400, and 135
(C) Y – 7500, 5000, and 90 (D) Z – 7200, 2800 and 200




1. A thermostable DNA polymerase that can carry out both reverse transcription reaction and
polymerization has been isolated from
(A) Thermococcus litoralis (B) Thermus aquaticus
(C) Thermotoga maritima (D) Therrnus thermophilus

2. When present in tissue culture medium, gibberellin
(A) Help to break dormancy of buds and bulbs
(B) Promotes dormancy development in buds and bulbs
(C) Is regarded as plant growth inhibitor
(D) Prevents normal recognition of auxin molecule

3. To promote attachment and spreading of anchorage – dependent animal cells, the surface of
the culture vessel needs to be coated with
(A) Trypsin (B) Collagen
(C) Pronase (D) Polyglycol

4. For amplification of GC rich sequences by polymerase chain reaction, identify the reagent that
binds and stabilizes AT sequences and destabilizes GC regions.
(A) Tetramethyl ammonium chloride
(B) Betaine
(C) 7–deaza–2–deoxyguanosine triphosphate
(D) Sodium dodecyl sulphate

5. Which of the following statements is INCORRECT about immobilized plant cell cultures?
(A) It is possible to use high cell densities
(B) Cell remain active for long periods
(C) Cell products or inhibitors can be removed easily
(D) It provides low shear resistance to cells

6. All the cells that participate in immune responses originate from a population of
(A) Neutrophils (B) Stem cells
(C) Macrophages (D) Lymphocytes

7. Identity the natural plant growth regulators from the following list
(P) Zeatin
(Q) Benzylaminopurine (BAP)
(R) Indole–3–acetic acid (IAA)
(S) 2,4–Dichlorophenoxyacetic acid

(A) P, Q (B) Q, S
(C) P, R (D) R,S
–
8. A hybrid derived from the fusion of a myeloma cell (HPRT ) with an antibody secreting B –
+
lymphocyte (HPRT ) can be selected to produce monoclonal antibody by growing in a medium
containing
(A) Thiamine, hypoxanthine, aminopterin
(B) Thymidine, histidine, aminopterin
(C) Uridine, hypoxanthine, aminopterin
(D) thymidine, hypoxanthine, aminopterin

9. Match items in group 1 with correct options from those given in group 2.

Group 1 Group 2
P. VNTR sequence 1. Gene regulation on the same chromosome
Q. Leader sequence 2. Ribosome binding site


R. SD sequence 3. DNA finger printing
S. cis – acting sequence 4. Functions in attenuation

10. During cultivation of microorganisms in a fermenter, various parameters are controlled by
appropriate sensor (probe). Match each probe in group 1 with the appropriate response
mechanism in group 2.

Group 1 (Probe) Group 2 (Response)
P. Thermistor 1. Activation of acid / alkali pump
Q. Oxygen electrode 2. Activation of vegetable oil pump
R. Metal rod 3. Activation of hot / cold water pump
S. pH electrode 4. Increase / decrease in stirrer motor speed

(A) P-2, Q-3, R-1, S-4 (B) P-1, Q-2, R-4, S-3
(C) P-3, Q-2, R-4, S-1 (D) P-3, Q-4, R-2, S-1

11. Which of these mice fail to develop a thymus?
(A) Mountain mice (B) Beige mice
(C) Knock out nice (D) Nude mice

12. What are the experimental steps needed for screening an expression library for a clone
encoding a protein X that has been isolated and purified?
P. m RNA isolation
Q. Antibody preparation
R. Cloning into an appropriate vector
S. Western blotting on transferred plaques

(A) P, S (B) Q, S
(C) Q, R (D) R, S

13. When electroporation is used for introducing DNA into mammalian cells
(P) A carrier for DNA is not required
(Q) The lipid bilayer (membrane) interacts with an electric pulse to generate permeation sites
(R) The viability of the cells becomes approximately zero percent
(S) The first step involves absorption of DNA on the cell membrane

(A) P, Q (B) Q, R
(C) P, S (D) Q, S

14. Immobilization of enzymes using entrapment method requires
(P) Photosensitive polyethylene glycol dimethacrylate
(Q) CNBr activation of sepharose
(R) Polyfunctional reagent like hexamethylene diisocyanate
(S) Rediation of polyvinyl alcohol

(A) P, Q (B) R, S
(C) P, S (D) Q, S

15. Which one of the following monolayer culture systems have the highest surface area: medium
ratio?

(A) Roux bottle (B) Spiracell roller bottle
(C) Hollow fibres (D) Plastic bag / film

16. Majority of the cereals are highly recalcitrant to Agrobacterium – mediated transformation, and
so direct transformation methods have been developed to transform such plants. Which of the
following direct transformation methods is applicable to intact plant tissues?
(A) Calcium chloride and PEG – mediated transformation
(B) Liposome – mediated transformation


(C) Electroporation
(D) Transformation using micro projectiles

17. Match items in group 1 with correct options from those given in group 2

Group 1 Group 2
P. Tissue plasminogen activator 1. Immunomodulator
Q. Gamma interferon 2. Biodegradable plastic
R. Podophyllotoxin 3. Clot dissolution
S. Polyhydroxyalkanoate 4. Anti–tumor agent

(A) P-4, Q-3, R-1, S-2 (B) P-1, Q-3, R-4, S-2
(C) P-3, Q-1, R-2, S-4 (D) P-3, Q-1, R-4, S-2

18. Match items in group 1 with correct options from those given in group 2

Group 1 Group 2
P. Amperometric biosensor 1. Light beam
Q. Evanescent wave biosensor 2. Flux of redox electrons
R. Calorinetric biosensor 3. Field effect transistors
S. Potentiometric biosensor 4. Exothermic reaction

(A) P-3, Q-4, R-2, S-1 (B) P-2, Q-1, R-4, S-3
(C) P-3, Q-2, R-4, S-1 (D) P-2, Q-4, R-3, S-1

19. For prediction of three dimensional structure of protein
P. Homology modeling tries many possible alignments
Q. Threading first identifies homologues
R. Threading evaluates many rough models
S. Homology modeling optimizes one model

(A) Q, S (B) P, Q
(C) R, S (D) Q, R

20. Immobilization of enzymes
P. Increases the specificity of the enzyme for its reactants
Q. Facilitates reuse of the enzyme in batch reactions
R. Makes it unsuitable for its use in a continuous reactor system
S. Decrease the operational cost of the industrial process

(A) Q, S (B) Q, R
(C) R, S (D) P, Q

21. Which of the following would result in somaclonal variation in micropropagated plants?
(P) Propagation by axillary branching in the absence of plant growth regulators.
(Q) Cell suspension maintained for five years before induction of somatic embryogenesis
(R) Callus induction using 20 μM 2.4 – Dichlorophenoxyacetic acid followed shoot
organogenesis.
(S) Shoot organogenesis from an explant in the absence of an intermediate callus phase.

(A) P, Q (B) Q, R
(C) P, S (D) Q, S

22. The enzymes that can be used in 5’ end labeling of DNA are
P. alkaline phosphatase
Q. DNA ligase
R. Terminal transferase
S. Polynucleotide kinase



(A) P, S (B) R, Q
(C) P, R (D) R, S

Common Data Quastions

Common data for Questions 23, 24
Lignocellulosic biomass was subjected to microbial composting. The microbial consortium produced
an extracellular enzyme xylanase, which was a glycoprotein having a molecular weight pf 68 kDa and
a positive charge. An aqueous extract of the enzyme could be easily prepared from the compost.

23. What techniques would you recommend for confirming the molecular weight of the purified
enzyme?
P. Isoelectric focusing
Q. SDS – PAGE
R. Native PAGE
S. Gel filtration

(A) P, Q (B) Q, S
(C) R,S (D) P, S

24. If Con A sepharose column was used for the purification of enzyme, the separation would be
based on
(A) Molecular exclusion (B) Affinity binding
(C) ion exchange (D) Hydrophobic interaction

Linked Answer Question: 25 to 26 carry to marks each.

Statement for Linked Answer Question 25 & 26:
8
DNA content of Caenorhabditis elegans was analysed and found to contain 1.0 x 10 bp.

25. How many standard λ – phage vector carrying 20kb DNA fragments or YACs carrying 250 kb
DNA fragments are theoretically required to constitute a complete C.elegan genomic library?
(A) 500 λ – phage vectors or 40 yeast clones
(B) 400 λ – phage vectors or 5000 yeast clones
(C) 500 λ – phage vectors or 400 yeast clones
4
(D) 5 x 10 λ – phage vectors or 4000 yeast clones

26. How many λ – phage vectors / yeast clones should be prepared in order to ensure that every
sequence is included in the library?
3
(A) 25 X 10 λ – phage vectors / 2000 yeast clones
3
(B) 20 x 10 λ – phage vectors / 1600 yeast clones
4
(C) 5 x 10 λ – phage vector / 4000 yeast clones
4
(D) 10 x 10 λ – phage vectors / 10000 yeast clones

Statement for Linked Answer Question 27 & 28:
3
A bioreactor of working volume 50 m produces a metabolite (X) in batch culture under given
operation conditions from a substrate [S]. The final concentration of metabolite (X) at the end of each
–3
run was 1.1 kg m . The bioreactor was operated to complete 70 runs is each year.

27. What will be the annual output of the system (production of metabolite (X) in kg per year?
(A) 55 (B) 38.50
(C) 45.5 (D) 77
–1 –3
28. What will be the overall productivity of the system in kg year m ?
(A) 19250 (B) 38.50


(C) 38.50 (D) 77


[Pick the
GRASSROOTS ACADEMY GATE-BIOTECH 2007
date]


1. The specific growth rate (μ) of a microorganism in death phase is
(A) 0 (zero) (B) μ max
(C) Less than zero (D) Greater than zero

2. Which of the following reagents is used for harvesting anchorage – dependent animal cells from
culture vessels?
(A) Trypsin/ Collagenase (B) Trypsin/ Collagen
(C) Collagen /Fibronectin (D) DMSO

3. Protein binding regions of DNA are identified by one of the following techniques
(A) Finger printing (B) Foot printing
(C) Southern blotting (D) Western blotting

4. Plant secondary metabolites
(A) Help to increase the growth rate of plant
(B) Help in plant reproduction processes
(C) Provide defense mechanisms against microbial attack
(D) Make the plant susceptible to unfavorable conditions

5. Si RNA (s) interfere at
(A) Transcriptional level (B) Post–transcriptional level
(C) DNA replication level (D) Translational level

6. Presence of CX 2 – 4 CX Φ X 8 HX 3 H sequence in a protein suggest that it is
(A) A protein kinase (B) GTP binding protein
(C) Zinc finger protein (D) Lipase

7 – 24 carry two marks each

7. A protein binds to phosphocellulose column at pH 7.0 and elutes pH 8.0. if the protein has to be
further purified on a DEAE sephacel column, the binding buffer should have a pH of
(A) 5 (B) 6
(C) 7 (D) 8

8. Oils rich in PUFA are NOT desirable for biodiesel production because
(A) They form epoxides in presence of oxygen
(B) They do not form epoxides in presence of oxygen
(C) They have high ignition temperature
(D) They solidify at low temperature

9. Gynogenesis is a process of development of haploid plants
(A) From a fertilized cell of female gametophyte
(B) From an unfertilized cell of female gametophyte
(C) From isolated pollen grains
(D) By selective elimination of chromosomes following distant hybridization

10. Match items in group 1 with correct examples from those in group 2

Group 1 Group 2
(P) Catabolic product 1. Griseofulvin
(Q) Bioconversion 2. Bakers yeast
(R) Biosynthetic product 3. 6–Aninopenicillanic acid
(D) Cell mass 4. Ethanol

(A) P-4, Q-3, R-2, S-1 (B) P-3, Q-4, R-1, S-2


[Pick the
date]

(C) P-4, Q-3, R-1, S-2 (D) P-1, Q-4, R-3, S-2

11. A bioremedial solution to reduce oxides of nitrogen and carbon in flue gases is to intergrate flue
gas emission to
(A) Micro–algal culture (B) Fish culture
(C) Mushroom culture (D) Seri culture

12. The respiratory coefficient for the reaction
a CH m O n + b O 2 + c NH 3 → d CH α O β Nγ + e H 2 O + f CO 2 is defined as

(A) f/a (B) e/b
(C) b/f (D) f/b

13. Match the methods available on world wide web in group 1 for performing the jobs listed in
group 2

Group 1 Group 2
(P). Boxshade 1. Searching family data base
(Q) BCM launcher 2. Finding alignments
(C) Prosite 3. Displaying alignments
(D) PSI–BLAST 4. Searching for multiple alignments

(A) P-1, Q-3, R-2, S-4 (B) P-2, Q-3, R-2, S-4
(C) P-3, Q-4, R-1, S-2 (D) P-3, Q-2, R-1, S-4

14. Match the recombinant products in group 1 with their therapeutic applications in group 2

Group 1 Group 2
(P) Human growth hormone 1. Pituitary dwarfism
(Q) Platelet growth factor 2. Chemotherapy induced thrombocytopenia
(R) Factor VIII 3. Haemophilia
(S) Erythropoietin 4. Anaemia associated with chronic renal failure

(A) P-1, Q-2, R-3, S-4 (B) P-2, Q-1, R-3, S-4
(C) P-1, Q-4, R-3, S-2 (D) P-2, Q-4, R-3, S-1

15. Mobile genetic elements present in human genome are
(P) Long interspersed elements (LINEs)
(Q) Short interspersed elements (SINEs)
(R) P elements
(S) IS elements

(A) Q,R (B) P, Q
(C) P, R (D) Q, S

16. Match the following marker genes in group 1 with suitable selecting agent in group 2

Group 1 Group 2
P. npt II 1. Glyphosate
Q. aro A 2. Phosphinothricin
R. hpt 3. Kanamycin
S. bar 4. Hygromycin B

(A) P-1, Q-2, R-4, S-3 (B) P-3, Q-2, R-4, S-1
(C) P-2, Q-3, R-4, S-1 (D) P-3, Q-1, R-4, S-2

17. Determine the correctness or otherwise of the following Assertion [a] and Reason [r]


[Pick the
date]

Assertion: Enzymatic method of tissue dispersion is milder than chemical and mechanical
methods.
Reason: Enzymes work at optimal temperature and pH
(B) Both [a] and [r] true but [r] is not the correct reason for [a]
(C) [a] is true but [r] is false
(D) [a] is false but [r] is true

18. Match each parameter in group 1 with the appropriate measuring device in group 2

Group 1 Group 2
P. Pressure 1. Photometer
Q. Foam 2. Rotameter
R. Turbidity 3. Diaphragm gauge
S. Flow rate 4. Rubber sheathed electrode

(A) P-3, Q-4, R-1, S-2 (B) P-1, Q-3, R-2, S-4
(C) P-4, Q-1, R-2, S-3 (D) P-1, Q-2, R-3, S-4





1. Diauxic pattern of biomass growth is associated with
(P) Multiple lag phases
(Q) Sequential utilization of multiple substrates
(R) Simultaneous utilization of multiple substrates
(S) Absence of lag phase

(A) P, Q (B) P, Q (C) R, S (D) Q, S

2. Zinc fingers are characteristics of
(A) Blood clotting proteins
(B) RNA chaperones
(C) DNA binding proteins
(D) Lysosomal hydrolases

3. Parthenogenetic embryos in plants are those which are formed by
(A) Unfertilized eggs
(B) Fertilized eggs
(C) Sporophytic cells
(D) Male gametophyte

4. Which one of the following is the growth factor used for growth of tissues and organs in plant
tissue culture?
(A) Cysteine (B) Cytokinin
(C) Cytidylate (D) Cyclic AMP

5. Which of the following techniques is best for immobilizing an affinity ligand?
(A) Physical adsorption (B) Gel entrapment
(C) Cross-linking with a polymer (D) Covalent linkage to a spacer arm

6. Multiplication of genetically identical copies of a cultivar by asexual reproduction is known as

(A) Aclonal propagation (B) Vegetative propagation
(C) Polyclonal propagation (D) Clonal propagation

7 – 24 carry two marks each

7. Identify the correct statements for the ‘HAT Medium’
(P) Includes drug aminopterin to block major pathway for synthesis of deoxyribonucleotides
(Q) Hypoxanthine is precursor for thymidine
(R) Includes drug aminopterin to block major pathway for synthesis of polypeptides
(S) Cells can grow in presence of aminopterin only if they have enzymes thymidine kinase and
hypospboribosyl transferase
(A) P, Q (B) P,S
(C) R, S (D) Q, S

8. A DNA fragment of 4500 bp has to be tailed with dT residues by using dTTP and the enzyme
‘terminal transferase’. The stock solution of dTTP that is used as a substrate has a
concentration of 150 μM. Ten μl of this stock solution is added to a total volume of 200 μl
reaction. What will be the concentration of dTTP in the reaction?
(A) 7.5 μM (B) 75 μM
(C) 0.75 μM (D) 0.075 μM

9. Determine the correctness or otherwise of following Assertion [a] and Reason [r].



Assertion: The enzymatic degradation of cell wall to obtain single cell called protoplast has
helped immensely in developing somatic cell genetics in plants
Reason: In plants or animals, fusion of two cells must occur through the plasma membrane
(B) Both [a] and [r] are true but [r] is not the correct reason for [a]
(C) [a] is true but [r] is false
(D) [a] is false but [r] is true

10. In bioinformatics, the term ‘BLAST’ refers to
(A) Database retrieval tool
(B) Computational tool for sequence homology searching and alignment
(C) Computational tool to view genomic sequences
(D) Computational tool to view protein structures

11. Match the terms in group I with their possible explanations in group 2

Group 1 Group 2
p. Orthologs 1. A cell or an organism having foreign
Gene
Q. Paralogs 2. The complement of a protein
Expressed by a genome
R. Proteome 3. Genes from different species related
To each other
S. Transgenic 4. Genes from same species related to
Each other
(A) P-2, Q-4, R-1, S-3
(B) P-4, Q-3, R-2, S-1
(C) P-3, Q-4, R-2, S-1
(D) P-1, Q-2, R-3, S-4

12. Which of the following statements are true with respect to a special complex called ‘dicer’?
(P) It consists of deoxyribonuclease and DNA fragments
(Q) It consists of ribonuclease and RNA fragments
(R) It is involved in gene silencing
(S) It triggers apoptosis

(A) P, R (B) Q, R (C) P, S (D) Q, S

13. Some living cells (e.g. plant cell) have the capacity to give rise to whole organism. The term
used to describe this property is
(A) Morphogenesis (B) Androgenesis
(C) Totipotency (D) Organogenesis

14. Match the items in group 1 with the terms given in group 2

Group 1 Group 2
(P) Lactobacillus and Bifidobacteria 1. Prebiotics
(Q) Polychlorobenzenes 2. Probiotics
(R) Fructo-oligosaccharides 3. Antibiotics
(S) β-Lactams 4. Xenobiotics
(A) P-2, Q-4, R-1, S-3 (B) P-3, Q-4, R-1, S-2
(C) P-4, Q-1, R-2, S-3 (D) P-1, Q-3, R-4, S-2



15. Match the coefficients in group 1 with their corresponding downstream processing steps given in
group2
Group 1 Group 2
(P) Sedimentation coefficient 1. Aqueous two phase extraction
(Q) Partition coefficient 2. Ultrafiltration
(R) Rejection coefficient 3. Dialysis
(S) Activity coefficient 4. Centrifugation

(A) P-3, Q-1, R-4, S-1 (B) P-2, Q-1, R-4, S-3
(C) P-4, Q-3, R-1, S-2 (D) P-4, Q-1, R-2, S-3

16. Match the bioreactor components in group 1 with the most appropriate function given in group2
Group 1 Group 2
(P) Marine type impeller 1. Recirculation of medium
(Q) Draft tube 2. Aeration of medium
(R) Diaphragm valve 3. Animal cell cultivation
(S) Sparger 4. Sterile operation

(A) P-4, Q-2, R-1, S-3 (B) P-3, Q-1, R-4, S-2
(C) P-3, Q-4, R-2, S-1 (D) P-2, Q-1, R-4, S-3

17. Evaluate the Michaelis constant for the following lipase catalyzed trans-esterification reaction for
the production of biodiesel
k1 k2

Vegetable oil +Lipase  Oil – lipase comples  Biodiesel + Glycerol
8 1 1 4 1 3 1
Where, k 1 = 3 x 10 M s ; k 1 = 4 x 10 s and k 2 = 2 x 10 s

–3 –4
(A) 4.2 X 10 M (B) 14.0 X 10 M
–6 –4
(C) 6.4 X 10 M (D) 1.4 X 10 M

18. In a chemostat, evaluate the dilution rate at the cell wash – out condition by applying Monod’s
– 1 –1 – 1 –1
model with the given set of data: μ max – 1 h ; y X/S – 0.5 g g ; K s – 0.2 g L ; S 0 – 10 g L
–1 -1
(A) 1.00 h (B) 0.49 h
–1 –1
(C) 0.98 h (D) 1.02 h

19. Match the products in group1 with their producer organisms given in group 2
Group 1 Group 2
(P) Ethanol 1. Streptomyces orientalis
(Q) L-Lysine 2. Saccharomyces cerevisiae
(R) Biopesticide 3. Corynebacterium glutamicum
(S) Vancomycin 4. Bacillus thuringiensis



(A) P-2, Q-3, R-4, S-1 (B) P-3, Q-4, R-1, S-2
(C) P-4, Q-1, R-2, S-3 (D) P-2, Q-1, R-4, S-3

20. A polymerase chain reaction was performed beginning with 400 template DNA molecules in a
100 μl reaction. After 20 cycles of polymerase chain reaction, how many molecules of the
amplified product will be present in 0.1 μ l of reaction?
4 4
(A) 2.19 X 10 (B) 4.19 X 10
5 5
(C) 2.19 X 10 (D) 4.19 X 10

21. A bacterial culture with an approximate biomass composition of CH 1.8 O 0.5 N 0.2 grown aerobically
on a defined medium containing glucose as the sole carbon source and ammonia being the
nitrogen source. In this fermentation, biomass is formed with a yield coefficient of 0.35 gram dry
cell weight per gram of glucose and acetate is produced with a yield coefficient of 0.1 gram
acetate per gram of glucose. The respiratory coefficient for the above culture will be
(A) 0.90 (B) 0.95
(C) 1.00 (D) 1.05
1 –1
22. A bacterial culture having a specific oxygen uptake rate of 5 mmol O 2 (g–DCW) hr is being
grown aerobically in a fed– batch bioreactor. The maximum value of the volumetric oxygen
–1
transfer coefficient is 0.18 s for the stirred tank bioreactor and the critical dissolved oxygen
concentration is 20% of the saturation concentration (8 mg/ml). The maximum density, to which
the cells can be grown in the fed–batch process without the growth limited by oxygen transfer, is
approximately.
(A) 14 g/l (B) 26 g/l
(C) 32 g/l (D) 65 g/l

Common Data Questions
Common Data for Questions 23 and 24:

An enzyme (24000 Da) undergoes first – order deactivation kinetics while catalyzing a reaction
–4
according to Michaelis–Menten kinetics (k m = 10 M). The enzyme has a turnover number of
4 1
10 molecules substrate / min – (molecule enzyme) and a deactivation constant (k 4 ) of 0.1 min
at the reactions. The reaction mixture initially contains 0.6 mg/ l of active enzyme and 0.02 M of
the substrate.

23. The time required to convert 10% of the substrate will be approximately
(A) 16 min (B) 24 min
(C) 32 min (D) 8 min

24. The maximum possible conversion for the enzymatic reaction will be
(A) 100% (B) 50%
(C) 25% (D) 12.5%

Statement for Linked Answer Questions 25 and 26:

A Nick Translation reaction in a final volume of 100 μ l was carried out by using 25 μCi of
32
labeled [α- P] – dCTP for labeling a 1.2 kb γ – interferon DNA fragment.

25. After completion of Nick translation reaction, 10 μ l of reaction was spotted on a glass–fiber filter
4
that upon counting resulted into 4.2 x 10 cpm in reaction. Another 10 μl was processed for TCA
precipitation to determine radioisotope incorporation. The TCA precipitated sample gave 2.94 x
4 32
10 cpm. What is the percent of [ α - p]-dCTP incorporation into the DNA sample?
(A) 40% (B) 50%
(C) 60% (D) 70%



4
26. If 2.94 x 10 cpm of TCA precipitable counts of the 10 μl sample were taken from 1/10 dilution of
the 100 μl Nick Translation reaction containing 1 μg of γ- interferon DNA, what is the specific
activity of the labeled product?
6 7
(A) 1.47 x 10 cpm / μg (B) 1.47 x 10 cpm / μg
6
(C) 2.94 x 10 cpm / μg (D) 2.94 x 10 7 cpm / μg

Statement for Linked Answer Questions 27 and 28:

A double reciprocal plot was created from the specific growth rate and limiting–substrate
concentration data obtained from a chemostat experiment. A linear regression gave values of
–1
1.25 hr and 100 mg–hr–l for the intercept and slope, respectively.
–1
27. The respective values of the Monod kinetic constant μ a [hr ] and k s (mg/l) are as follows:
(A) 0.08,8 (B) 0.8, 0.8
(C) 0.8, 80 (D) 8, 8

28. The same culture (with the μ m and K s values as computed above) is cultivated in a 10–litre
chemostat being operated with a 50 ml/min sterile feed containing 50 g/l of substrate. Assuming
an overall yield coefficient of 0.3 g – DCW /g-substrate, the respective values of the outlet
biomass and substrate concentrations are
(A) 15 g/l, 48 mg / l (B) 15 g/l, 0.48 g/l
(C) 48 g/l, 15 g/l (D) 4.8 g/l, 4.8 g/l


www.Kbiotech.com

2274, Hudson Line, Near Delhi Univ. 9891602060, www.grassrootsacademy.in

y
em
ad
Ac
s
ot
ro
ss
ra
G


BIOTECHNOLOGY 2010


1. Hybridoma technology is used to produce
(A) monoclonal antibodies
(B) polyclonal antibodies
(C) both monoclonal and polyclonal antibodies
(D) B cells

2. Ames test is used to determine
(A) the mutagenicity of a chemical
(B) carcinogenicity of a chemical
(C) both mutagenicity and carcinogenicity of a chemical
(D) toxicity of a chemical

3. The bacteria known to be naturally competent for transformation of DNA is
(A) Escherichia coli (B) Bacillus subtilis
(C) Mycobacterium tuberculosis (D) Yersinia pestis

4. Antibiotic resistance marker that CANNOT be used in a cloning vector in Gram negative
bacteria is
(A) Streptomycin (B) Ampicillin
(C) Vancomycin (D) Kanamycin

5. Program used for essentially local similarity search is
(A) BLAST (B) RasMol
(C) ExPASY (D) SWISS-PROT

6. Pepjtidyl transferase activity resides in
(A) 16S rRNA (B) 23S rRNA
(C) 5S rRNA (D) 28S rRNA

7. In transgenics, alterations in the sequence of nucleotide in genes are due to
(P) Substitution
(Q) Deletion
(R) Insertion
(S) Rearrangement

(A) P and Q (B) P, Q and R
(C) Q and R (D) R and S

8. During transcription
(A) DNA Gyrase introduces negative supercoils and DNA
(B) DNA Topoisomerase I introduces negative supercoils and DNA Gyrase removes negative
supercoils
(C) both DNA Gyrase and DNA topoisomearse I introduce negative supercoils
(D) both DNA Gyrase and DNA Topoisomearse I remove negative nupercoils

9. Under stress conditions bacteria accumulate
(A) ppGpp (Guanosine tetraphosphate)
(B) pppGpp (Guanosine pentaphosphate)
(C) both ppGpp and pppGpp
(D) either ppGpp or pppGpp

10. An example for template independent DNA polymerase is
(A) DNA Polymerase I (B) RNA polymerase
(C) Terminal deoxynucleotidyl (D) DNA polymerase III

Gate bt papers

Recommended

Recommended

More Related Content

What's hot

What's hot (20)

Similar to Gate bt papers

Similar to Gate bt papers (20)

Recently uploaded

Recently uploaded (20)

Gate bt papers