Next-Gen Sequencing:4 years in the trenches           C. Titus Brown  Asst Prof, CSE and Microbiology;         BEACON NSF ...
These slides are available online.                  “titus brown slideshare”           You can also e-mail me:
Things I won’t talk aboutDon’t work on/with/have anything useful to say about:  Exome sequencing  Ancient DNA  ChIP-se...
Overview Shotgun sequencing basics Things everyone wants to know: how much $$... Various current problems & challenges...
Two specific concepts:First, sequencing everything at random is very much easier than sequencing a specific gene region. ...
What are current costs forIllumina?Approximate costs from MSU sequencing center, a few  months ago, including labor:RNAs...
What does this data really giveyou?? With RNAseq, you can do de novo (genome- and gene-annotation-  independent) gene & i...
Why so much data?Why do we need 10-20x coverage (resequencing) or 50-  100m reads (mRNAseq) with Illumina?Two (linked) r...
1. Useful minimum coveragedepends on high average coverage
2. mRNAseq quantitation – mustovercome sampling variation
Coverage conclusionsMore coverage rarely hurts (you can always discard data, but  it is harder/more $$ to get more data f...
Problems and challengesSystematic bias in sequencing and software.Genome assembly: scaffolding and sensitivityGene refe...
Resequencing: bias and error         Calling SNPs by mapping --                              U. Colorado                  ...
Both sequencing and bioinformaticsyield many low-frequency artifacts!“Obvious” things like misalignments to paralogous/re...
Suggestion: Cortex variant caller                  Iqbal et al., Nat Genet. 2012, pmid 22231483
Genome assembly: scaffolding &sensitivityEveryone wants two things from a genome assembly --Long/correct scaffolds       ...
Sequence data                                Readsoriginal DNA  fragmentsoriginal DNA  fragments                    Sequen...
ContigsBuilding contigs                 ACGCGATTCAGGTTACCACG                   GCGATTCAGGTTACCACGCG                     GA...
Scaffolds    Ordered, oriented contigs    mate pairscontigs                                          gap size estimate   ...
slides from ; Lex NederbragtLonger reads!  Repeat copy 1                                   R...
Cod: PacBio results         Mapping to the published genome                  11.4 kbp subread                    10.6 kbp ...
Sensitivity – does your genomeinclude everything?Generally not!For example, the chick genome is missing a substantial  n...
Approach - Digital normalization(a computational version of library normalization)                                        ...
Applying diginorm to increasesensitivityReassembled chick genome from 70x Illumina -> normalized reads in ~24 hours.Cont...
Mapping => mRNAseq quantitation          Reference transcriptome required.
Existing chick gene models lack exons,isoforms                                                      Our data              ...
(Exon detection is pretty good.)                            Likit Preeyanon
Gene Modeler Pipeline (“gimme”?)Merge transcripts together based on transcript mapping to genome; can include existing ge...
Some thoughts on bioinfoSoftware is evolving very fast. Don’t worry about using the  latest, but keep an eye on possible ...
Technology – where next?Most slides taken from Lex Nederbragt:
High-throughput sequencing              Phase 1: more is better        2005 GS20        200 000 reads             100 bp  ...
High-throughput sequencing                                   Phase 2: smaller is better                                   ...
slides from ; Lex Nederbragt   High-throughput sequencing                   Why benchtop seq...
Which instrument to choose?        slides from ; Lex Nederbragt
High-throughput sequencing                              Phase 3: single-moleculeC2 (current) chemistry:Average read length...
S                High-throughput sequencingReal-time sequencing                                                         Te...
Need to combine Illumina + PacBio still.                                           P_errorCorrection pipeline from        ...
My perspective on tech:Illumina HiSeq + benchtop sequencers (MiSeq) currently  most reliable for data generation: data in...
Two final pieces of adviceShould you work with genome centers? Maybe.  Genome centers are good at large, well funded pro...
Advertisement: next-gen sequencecourse       June 10-June 20, ...
AcknowledgementsI showed work from Likit Preeyanon and Alexis Black Pyrkosz, in my labHans Cheng is primary collaborator...
2013 pag-equine-workshop
2013 pag-equine-workshop
2013 pag-equine-workshop
2013 pag-equine-workshop
2013 pag-equine-workshop
2013 pag-equine-workshop
Upcoming SlideShare
Loading in …5

2013 pag-equine-workshop


Published on

1 Comment
  • Nice summary. Thanks for sharing.
    Are you sure you want to  Yes  No
    Your message goes here
  • Be the first to like this

No Downloads
Total Views
On Slideshare
From Embeds
Number of Embeds
Embeds 0
No embeds

No notes for slide

2013 pag-equine-workshop

  1. 1. Next-Gen Sequencing:4 years in the trenches C. Titus Brown Asst Prof, CSE and Microbiology; BEACON NSF STC Michigan State University
  2. 2. These slides are available online. “titus brown slideshare” You can also e-mail me: ctb@msu.eduAlso note that these are my opinions and observations, culledfrom personal experience, online material, and reading. I’m happy to cite/explain further upon request, but: Your Mileage May Vary
  3. 3. Things I won’t talk aboutDon’t work on/with/have anything useful to say about: Exome sequencing Ancient DNA ChIP-seq (protein-DNA interactions)Work on but you’re probably not interested in: Metagenomics (sequencing uncultured microbial communities) Bioinformatics data structures and algorithms
  4. 4. Overview Shotgun sequencing basics Things everyone wants to know: how much $$... Various current problems & challenges Technology, now and future Some papers and projects worth looking at; & our own experiences
  5. 5. Two specific concepts:First, sequencing everything at random is very much easier than sequencing a specific gene region. (For example, it will soon be easier and cheaper to shotgun-sequence all of E. coli then it is to get a single good plasmid sequence.)Second, if you are sequencing on a 2-D substrate (wells, or surfaces, or whatnot) then any increase in density (smaller wells, or better imaging) leads to a squared increase in the number of sequences. These two concepts underlie the recent stunning increases in sequencing capacity.
  6. 6. What are current costs forIllumina?Approximate costs from MSU sequencing center, a few months ago, including labor:RNAseq: $200 prep / sample Single-ended 1x50 -- $1100/lane – 100-150 mn reads Paired-end 2x100 -- $2500/lane – 200-300 mn reads (/ 2)Barcoding samples, etc, gets complicated.Discuss biology, etc with a sequencing geek before going forward!
  7. 7. What does this data really giveyou?? With RNAseq, you can do de novo (genome- and gene-annotation- independent) gene & isoform discovery and quantification; 50- 100m reads/sample is probably “enough” (see: for a good discussion) With genome resequencing, you can do variant analysis/discovery; I recommend 20x depth. De novo assembly of complex vertebrate genomes is not casual: Cheap short-read sequencing does not yet deliver good long-range contiguity; repeats, heterozygosity get in the way. Assembly & scaffolding process itself is still evolving.
  8. 8. Why so much data?Why do we need 10-20x coverage (resequencing) or 50- 100m reads (mRNAseq) with Illumina?Two (linked) reasons: Shotgun sequencing is random Counting/sampling variation
  9. 9. 1. Useful minimum coveragedepends on high average coverage
  10. 10. 2. mRNAseq quantitation – mustovercome sampling variation
  11. 11. Coverage conclusionsMore coverage rarely hurts (you can always discard data, but it is harder/more $$ to get more data from an old sample)Your desired coverage numbers should be driven by sensitivity considerations.
  12. 12. Problems and challengesSystematic bias in sequencing and software.Genome assembly: scaffolding and sensitivityGene referencesmRNAseq isoform construction
  13. 13. Resequencing: bias and error Calling SNPs by mapping -- U. Colorado
  14. 14. Both sequencing and bioinformaticsyield many low-frequency artifacts!“Obvious” things like misalignments to paralogous/repeat sequences.Indels are handled badly by current tools (up to 60% false positive rate?!)Oxidation of DNA during library prep step (acoustic shearing) generated 8-oxoguanine “lesions” responsible for artifacts involving C>A/G>T triplets. => With any data set, especially big ones, there will both random and systematic error and bias. truth-you-cant-handle-the-truth/
  15. 15. Suggestion: Cortex variant caller Iqbal et al., Nat Genet. 2012, pmid 22231483
  16. 16. Genome assembly: scaffolding &sensitivityEveryone wants two things from a genome assembly --Long/correct scaffolds SeeComplete genome content
  17. 17. Sequence data Readsoriginal DNA fragmentsoriginal DNA fragments Sequenced ends slides from ; Lex Nederbragt
  19. 19. Scaffolds Ordered, oriented contigs mate pairscontigs gap size estimate Scaffold contig gap slides from ; Lex Nederbragt
  20. 20. slides from ; Lex NederbragtLonger reads! Repeat copy 1 Repeat copy 2 Long reads can span repeats and heterozygous regions Polymorphic contig 22 Polymorphic contig Contig 1 Contig 4 Polymorphic contig 33 Polymorphic contig
  21. 21. Cod: PacBio results Mapping to the published genome 11.4 kbp subread 10.6 kbp subread 10.9 kbp subread slides from ; Lex Nederbragt
  22. 22. Sensitivity – does your genomeinclude everything?Generally not!For example, the chick genome is missing a substantial number of genes from microchromosomes: 723 genes from HSA19q missing from chicken galGal4. ESTs and RNAseq transcripts for many or most.
  23. 23. Approach - Digital normalization(a computational version of library normalization) Digital normalization “smooths out” coverage from different loci, and can “recover” low coverage regions for assembly.
  24. 24. Applying diginorm to increasesensitivityReassembled chick genome from 70x Illumina -> normalized reads in ~24 hours.Contig assembly contained partial or complete matches to 70% of previously unmappable transcripts assembled from chick mRNAseqTogether with Wes Warren (WUSTL), Hans Cheng (USDA ADOL), Jerry Dodgson (MSU) proposing to apply PacBio and normalization to improve chick genome; should be generalizable approach.
  25. 25. Mapping => mRNAseq quantitation Reference transcriptome required.
  26. 26. Existing chick gene models lack exons,isoforms Our data Models *This gene contains at least 4 isoforms. Likit Preeyanon
  27. 27. (Exon detection is pretty good.) Likit Preeyanon
  28. 28. Gene Modeler Pipeline (“gimme”?)Merge transcripts together based on transcript mapping to genome; can include existing gene predictions, iterate.Construct gene modelsRemove redundant sequencesPredict strands and ORFs Likit Preeyanon
  29. 29. Some thoughts on bioinfoSoftware is evolving very fast. Don’t worry about using the latest, but keep an eye on possible artifacts/problems with what you do use.In NGS, online information (seqanswers, biostar, Twitter) is generally far less behind than publications.
  30. 30. Technology – where next?Most slides taken from Lex Nederbragt:
  31. 31. High-throughput sequencing Phase 1: more is better 2005 GS20 200 000 reads 100 bp 0.02 Gb/run 2011 GS FLX+ 1.2 million reads 750 bp 0.7 Gb/run 2006 GA 28 million reads 25 bp 0.7 Gb/run 2011 HiSeq 2000 3 billion reads 2x100 bp 600 Gb/run slides from ; Lex Nederbragt
  32. 32. High-throughput sequencing Phase 2: smaller is better GS Junior from Roche/454 0.04 GB/run 400 bp reads 0.7 GB/run 700 bp reads MiSeq from Illumina 4.5 GB/run 2x150 bp reads 600 GB/run 2x100 bp reads PGM from Ion Torrent/ Life Technologies 0.01, 0.1 or 1 GB/run 100 or 200 bp readsslides from ; Lex Nederbragt
  33. 33. slides from ; Lex Nederbragt High-throughput sequencing Why benchtop sequencing instruments? DiagnosticsAffordable priceper instrument Small projects Fast turn around time
  34. 34. Which instrument to choose? slides from ; Lex Nederbragt
  35. 35. High-throughput sequencing Phase 3: single-moleculeC2 (current) chemistry:Average read length 2500 bp36 000 reads90 MB per ‘run’ slides from ; Lex Nederbragt
  36. 36. S High-throughput sequencingReal-time sequencing Technology Phospholinked hexaphosphate nucleotides G A T C b Lim of detection zone it Fluorescence pulse Intensitye detection Time slides from Nature Reviews |Genetics ; Lex Nederbragt Figure 4 |Real-time sequencing. Pacific Biosciences’ four-colour real-tim sequencing m e ethod is shown.
  37. 37. Need to combine Illumina + PacBio still. P_errorCorrection pipeline from  93% of reads recovered 2.7x Alignments of at least 1kb to cod published assembly + Error-corrected reads 23x s + w rea d Ra 24 cpus 4.5 days 100 Gb RAMslides from ; Lex
  38. 38. My perspective on tech:Illumina HiSeq + benchtop sequencers (MiSeq) currently most reliable for data generation: data in hand, decent quality.PacBio data is an excellent add-on for situations where long reads are needed (to bridge repeats or het regions).
  39. 39. Two final pieces of adviceShould you work with genome centers? Maybe. Genome centers are good at large, well funded projects. Their default pipelines are reliable but not always cutting edge. “Weird” problems (high heterozygosity, or complex repeats) may require more attention than they can give. They also have their own schedules and incentives.Where should you go for contract sequencing? I get asked this a lot! My best recommendation is UC Davis. “Cheaper” is not always “better”; data quality can vary immensely.
  40. 40. Advertisement: next-gen sequencecourse June 10-June 20, Kellogg Biological Station; < $500 Hands on exposure to data, analysis tools.
  41. 41. AcknowledgementsI showed work from Likit Preeyanon and Alexis Black Pyrkosz, in my labHans Cheng is primary collaborator on chick workUSDA funded our technology development.Lex Nederbragt for his slides :)
  1. A particular slide catching your eye?

    Clipping is a handy way to collect important slides you want to go back to later.
