• Share
  • Email
  • Embed
  • Like
  • Save
  • Private Content
Secuenciación
 

Secuenciación

on

  • 911 views

 

Statistics

Views

Total Views
911
Views on SlideShare
911
Embed Views
0

Actions

Likes
1
Downloads
32
Comments
0

0 Embeds 0

No embeds

Accessibility

Categories

Upload Details

Uploaded via as Microsoft PowerPoint

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

    Secuenciación Secuenciación Presentation Transcript

    • IT´S A LITLE BITE COMPLICATED TO SEQUENCE MESECUENCIACIÓN
    • ACTTTGTCCACGGCCTAAGCGTTTTTTGCCCSecuenciación AGTGACTTTGTCCAAC GTCCAACAGTTACCAAGTGACTTTGTCCAC TTTTGCCCde genomas AGTGACTTTGTCCA ACGGCCTAAGCGTTTTTTTT ALINEAMIENTO DE TODAS LAS SECUENCIAS Y RECONSTRUCCIÓN DEL CROMOSOMA
    • •Detección de mutaciones Método de diagnóstico rutinario (relación entre enfermedad y mutación puntual)•Secuenciación de ADNs fósiles Posibilidad de aislar secuencias de ADN a partir de unas pocas copias (la mayoría están dañadas o degradadas)•Diagnóstico de enfermedades genéticas Diagnóstico prenatal / Diagnóstico preimplantación de enfermedades hereditarias o determinación del sexo del feto previamente a su implantación en procesos de fecundación in vitro•Identificación de especies y control de cruces entre animales Para descubrir fraudes comerciales, tales como vender carne de una especie más barata a los precios de otra más cara, o el comercio ilegal de especies en peligro•Secuenciación de genomas Conocimiento básico y aplicado de diferentes organismos (incluido el genoma humano)
    • • Técnica de Sanger para secuenciar el DNA: • el DNA se denatura: hebras simples • el partidor se hibrida a la hebra molde • el DNA es sintetizado usando DNA polimerasa5’ 3’ |||||||||||||||3’
    • FUNDAMENTOLas CadenasPolinucleotídicas crecen porAdición de nucleótidos alExtremo 3´ OH
    • Dideoxy Sequencing Fred Sanger - 1977
    • ddATP ddTTP ddGTP ddCTP DNA DNA DNA DNA dNTPs dNTPs dNTPs dNTPs 5’ ||||||||||||||| 3’ ATCATGTCATCAAGTCTAGCAC TA •cada fragmento TAGTA termina en ddA• Todos los posibles TAGTACA productos de la reacción TAGTACAGTA conteniendo ddATP TAGTACAGTAGTTCA TAGTACAGTAGTTCAGA
    • SECUENCIACION DEL DNAMETODO ENZIMATICO
    • migracióngraphics taken from Cold SpringHarbor Laboratory web site:darwin.cshl.org/shockan.html
    • González,2007
    • 16 de Febrero de 2001Celera Genomics Proyecto genoma humano La secuencia del genoma es un atajo valioso: ayuda a los científicos a encontrar los genes más fácil y rápidamente y sienta las bases para averiguar la función de los genes identificados Beneficios médicos tras el conocimiento de la estructura de cada gen humano 1. Diagnóstico en individuos con riesgo de ser portadores del gen de alguna enfermedad 2. Marco de trabajo para el desarrollo de nuevas terapias, además de nuevas estrategias para la terapia génica15 de Febrero de 2001Consorcio público internacional
    • SORPRESA No. 1Gen 1 98% del genoma Gen 2 Sólo 2% del genoma son genes.
    • SORPRESA No. 2Somos casi idénticos (2% de diferencia) a los chimpancés.
    • SORPRESA No. 3 Hay sólo 0,1% de variación genética entre todos los seres humanos.Pero 0,1% de 3.000.000.000 bases = 3.000.000 bases
    • La propiedad mas importante del DNAes su secuencia de nucleótidos.La secuenciación es la determinación delorden de los nucleótidos.
    • Secuenciación por el método de Maxam-Gilbert• Esta basada en la modificación química del dna y posterior escisión de bases específicas.Ventaja: El dna que se usa directamente (no requieres ser clonado) Desventajas:• ha quedado en desuso por su complejidad.• Los reactivos de este método no se pueden adaptar para usarse en un kit biológico
    • • El método requiere el marcaje radiactivo en el extremo 5 y la purificación del fragmento que se requiere secuenciar.• De esta manera las longitudes de los fragmentos corresponden a posiciones en la secuencia donde esta esa base
    • Métodos de terminación de la cadena (sanger) • Es el método más usado para la secuenciación es el conocido como técnica de terminación de cadena de Sanger, la cual se ha perfeccionado conociéndose actualmente como la técnica del didesoxi. • Se denomina así por ser necesario los didesoxirribonucleótidos (figura 1), que han perdido su grupo alcohol OH del carbono 3. En la figura 2 vemos un nucleótido normal con el grupo alcohol en el carbono 3.
    • • Como "molde" se utiliza una de las cadenas del fragmento de ADN que se va a secuenciar• Como "cebador" para iniciar la síntesis, se necesita un corto oligonucleótido complementario del extremo de la cadena• desoxinucleótidos de las cuatro bases: dAMP, dTMP, dGMP, dCMP.• didesoxinucleótidos de una base en cada una de las cuatro reacciones de secuenciación.
    • • Al añadir la ADN-polimerasa, comienza la polimerización en el cebador, pero cesa el incorporarse un didesoxinucleótido porque la ausencia de un hidroxilo 3’ impide el agregado del próximo nucleotido.
    • • Deben prepararse cuatro reacciones de secueciación, cada una con un didesoxi distinto . Los fragmentos resultantes se separan por tamaño mediante electroforesis, se autorradiografían, y la sucesión de bandas de cada una de las cuatro reacciones, comparándolas entre sí,dan la secuencia del ADN
    • •CYCLE SEQUENCING•3 µl de ddH2O•2 µl buffer 5x•1 µl de cada cebador•1 µl Big Dye•3 µl de ADNmt (gelasa)
    • Automatización y preparación de las muestras• Más de 384 muestras marcadas por fluoresciencia de una sola vez y 24 ciclos de secuenciación al día.• Preparar por separado las reacciones de secuenciación mediante una termocicladora, lavado y resuspensión en una solución buffer antes de pasar las muestras al secuenciador.• Limitaciones: alturas y formas de picos desiguales en los registros del cromatograma producto de los terminadores fluorescentes.• Solución: introducción de nuevos sistemas enzimáticos de polimerasas de ADN y colorantes que minimizan la variabilidad de la incorporación..
    • TECNOLOGíA DE MICROARRAYS DE cDNAS CHIPs de DNA • Permite analizar cientos o miles de genes diferentes en un solo experimento.
    • Tipos de arrays1. Microarrays de cDNAs:• DNAs (cDNA o productos de PCR 0,6-2,4 Kb) son inmovilizados en una superficie solida (nylon o vidrio).• Contienen cientos-miles de sondas.• Baja densidad de las sondas inmovilizadas.• La muestra a hibridar es marcada con radioactividad.2. 2. Microarrays de oligonucleotidos:• Oligonucleotidos (20-80 pb) son sintetizados sobre una matriz de vidrio o plástico.• Contienen 40.000-60.000 sondas.• Alta densidad de sondas inmovilizadas (107 copias/punto de siembra).
    • Confección del array
    • Confección de arraysMICROARRAYSSiembra 0,25-1 nL/spotgenerando spots de 100-150 m de diametro.
    • Confección de arrays
    • Confección de arraysFigure 3: Atomic force microscopy of DNA on a microarray. This is a micrograph of a portion of a hybridization probe from ayeast microarray, taken after the array was subjected to hybridization. The DNA is clearly deposited at a sufficient density toallow many kinds of strand–to–strand interactions. The width of the picture represents a scanned distance of 2 m. Imagekindly provided by J. DeRisi (Stanford) and E. Carr (Hewlett–Packard).
    • Confección de arrays Macroarrays Robot sembrador Membrana de nylonColección de genes blanco: DNA’s o Productos de PCR Siembra 7 nL/spot generando spots de 400-800 m de diametro.
    • Hibridación en microarrays Cy5 = 633 nm Cy3 = 532 nm 1 2 Cy5 Cy3 Expresión de 1 > 2 Expresión de 1 = 2 Expresión de 1 < 2
    • Microarray de levadura
    • El nivel de expresión de cada gen es representado por laintensidad de la señal asociada a un color:Rojo (Cy5) = > expresión en la muestra experimentalVerde (Cy3) = < expresión en la muestra experimentalPor convención el RNA de referencia es marcado con Cy3.