Ud 2. evolucion
Upcoming SlideShare
Loading in...5
×
 

Like this? Share it with your network

Share

Ud 2. evolucion

on

  • 2,795 views

 

Statistics

Views

Total Views
2,795
Views on SlideShare
2,143
Embed Views
652

Actions

Likes
0
Downloads
99
Comments
0

7 Embeds 652

http://biologiahipatia.wordpress.com 421
http://ciencias4cepacamargo.blogspot.com 89
http://ciencias4cepacamargo.blogspot.com.es 83
http://ciencias4cepacamargo.blogspot.mx 43
http://ciencias4cepacamargo.blogspot.com.ar 13
http://ciencias4cepacamargo.blogspot.de 2
http://ciencias4cepacamargo.blogspot.it 1
More...

Accessibility

Categories

Upload Details

Uploaded via as Microsoft PowerPoint

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

Ud 2. evolucion Presentation Transcript

  • 1. ¿Por qué crees que son famsosas?
  • 2. Otra especie de tortuga de lasIslas Galápagos
  • 3. Iguana marina de las Islas Galápagos
  • 4. ¿Es cierto quevenimos del mono?
  • 5. ¿Es cierto quevenimos del mono?
  • 6. ¿De dónde venimos?
  • 7. Charles Darwin(1809 – 1882), el “padre” de la Teoría de la Evolución porSelección NaturalClic aquí para ver vídeo de la vida de Darwin
  • 8. 1 El origen de la vida¿Cómo se originó la vida? Creación de Adán (Miguel Ángel, Capilla Sixtina)
  • 9. 1 El origen de la vida ¿Te has hecho preguntas como estas?¿Cómo han surgido los seres vivos que nos rodean?
  • 10. 1 El origen de la vida¿Cómo han surgido los seres vivos que nos rodean? ¿Cómo se originó la vida?
  • 11. 1 El origen de la vida¿Cómo han surgido los Estas preguntas han estado en la seres vivos que nos mente humana desde nuestro mismo origen. Las religiones, la filosofía y la rodean? ciencia han compartido estas inquietudes. ¿Cómo se originó la vida? ¿Cómo hemos surgido nosotros?
  • 12. 1 El origen de la vida Según la mayoría de las religiones, la vida tiene un origen sobrenatural en el que no intervienen reacciones físico-químicas de ningún tipo, ya que todo lo que existe ha sido creado por uno o varios dioses. Esta tesis recibe el nombre de creacionismo. Por su parte, los científicos han aportado a lo largo de la historia diferentes explicaciones acerca del origen de los seres vivos.
  • 13. 1 El origen de la vida1.1.- Controversia entre generación espontánea y biogénesis Los antiguos griegos argumentaban dos teorías: unos suponían que la vida había aparecido en la Tierra y había ido cambiando posteriormente; otros pensaban que se formaba constantemente en el planeta. Esta última idea constituyó el germen de la teoría de la generación espontánea, según la cual la vida puede surgir del lodo, del agua, del mar o de las combinaciones de los cuatro elementos fundamentales: aire, agua, fuego y tierra, o de Platón y Aristóteles. Rafael cualquier sustancia inerte.
  • 14. 1 El origen de la vida1.1.- Controversia entre generación espontánea y biogénesis La vida puede surgir del lodo, de las aguas estancadas… La idea de la generación espontánea de los seres vivos,Aristóteles que ya enunció Aristóteles hace 2000 años, perduró durante mucho tiempo.
  • 15. 1 El origen de la vida1.1.- Controversia entre generación espontánea y biogénesis Estas ideas que hoy día nos parecen tan extrañas o incluso cómicas, se basaban en observaciones como esta: si dejamos, por ejemplo, trozos de carne, al cabo de unos días “salen gusanos”. Esos gusanos aparecerían ahí solos, espontáneamente. ¿Qué explicación le das tú a la aparición de estos gusanos?
  • 16. 1 El origen de la vida1.1.- Controversia entre generación espontánea y biogénesis En 1667, el médico Jan B. van Helmont propuso una receta que permitía la generación espontánea de ratones: Los piojos, garrapatas, pulgas y gusanos nacen de nuestras entrañas y excrementos. Si colocamos ropa interior llena de sudor junto con trigo en un recipiente de boca ancha, al cabo de 21 días el olor cambia y penetra a través de las cáscaras del trigo, cambiando el trigo por ratones. Estos ratones son de ambos sexos y se pueden cruzar con ratones que hayan Jan B. van Helmont surgido de manera normal.
  • 17. Reflexiona Francesco Redi, un médico italiano, realizó en el siglo XVII el siguiente experimento: Fr asco Frasco cerr ado her méticamenteFrasco abier to tapado con una gasa Car ne Car ne Car ne A quí apar ecen huevos de mosca A par ecen gusanos No apar ecen gusanos ¿Qué conclusión sacas de este experimento?
  • 18. Reflexiona Como habrás podido deducir del resultado obtenido por Redi en su experimento, los gusanos sólo aparecen en la carne si entra en contacto con las Lucilia caesar moscas, que depositan en ella los huevos a partir de los cuales se desarrollan las larvas,Sarcophaga carnaria que son los “gusanos”. Mosca (adulto)Calliphora vomitoria Con este sencillo experimento Redi demostró que la Musca domestica Larva de la mosca vida sólo puede Son varias las (“gusano”) surgir de vida especies de moscas preexistente. cuyas larvas pueden alimentarse de carne.
  • 19. La teoría según la cual la vida sólopuede originarse a partir de vida seconoce como biogénesis.
  • 20. 1.1.- Controversia entre generación espontánea y biogénesis A pesar del experimento de Redi, la controversia se prolongó aún otros doscientos años hasta que en el siglo XIX, Louis Pasteur realizó el experimento que refutó definitivamente la teoría de la generación espontánea.El exper imento de Pasteur El aire podía pasar a los recipientes, pero no así los 1864 microorganismos, que quedaban atrapados en el cuello. Si se corta el cuello el líquido se contamina con microorganismos. Se desechó para siempre la teoría de la generación espontánea. Microbios
  • 21. 1 El origen de la vida1.2.- Teoría del origen físico-químico de ……. la vida: Oparin y Haldane Haldane Oparin Los dos científicos enunciaron esta teoría simultáneamente. Esta teoría se basa en las condiciones físico-químicas que existieron en la Tierra primitiva y que permitieron el desarrollo de la vida.Aleksandr Ivanovich Oparin John Burton S. Haldane Clic aquí para ver (1894 - 1980) (1892 - 1964)
  • 22. 1 El origen de la vida1.2.- Teoría del origen físico-químico de ……. la vida: Oparin y Haldane Haldane Oparin En nuestro planeta no había oxígeno libre en la atmósfera, pero sí sustancias como el hidrógeno, el metano, el vapor de agua y el amoniaco. Existían, además, unas altas temperaturas, provenientes de la actividad volcánica, las radiaciones solares y las descargas eléctricas producidas por las Las condiciones eran distintas a las actuales frecuentes tormentas. Clic aquí para ver
  • 23. 1 El origen de la vida1.2.- Teoría del origen físico-químico de ……. la vida: Oparin y Haldane Haldane Oparin En estas condiciones, aparecieron en un mar - que era una “sopa primitiva ” - las primeras moléculas orgánicas que lograban autoreplicarse. Posteriormente, estas moléculas se rodearon de Miller unas envolturas y originaron los organismos más primitivos, los protobiontes. Pero… ¿habría alguna Cuando estos evolucionaron dieron lugar a los eubiontes, manera de comprobarlo? que ya eran células con vida. Clic aquí para ver
  • 24. 1 El origen de la vida1.2.- Teoría del origen físico-químico de ……. la vida: Oparin y Haldane Haldane OparinEn 1953, Miller Experimento de Miller Hasta Este ahora, Hastaconfirmó la nadie ha experimentoteoría de se entonces logrado que las probabacrear pensaba queOparin-Haldane una célula con condiciones sólo un sersimulando en ellaboratorio las el vida,podía existentes en vivo pero planeta hace estecondiciones de fabricar unos 3500 experimentola Tierra materiaprimitiva. de años millones ha sido orgánicaObtuvo para que crucial fueron tales (aminoácidos,compuestos entender pudieron ácidosorgánicos a Miller mejor cómo formarse grasos…)partir de otros pudo haber espontáneamenteinorgánicos.ocurrido.moléculasorgánicas.
  • 25. 2 Un origen común a pesar de la variedad Se han clasificado 1,2 millones de especies animales y más de 400.000 especies vegetales. Además de los reinos Animal y Vegetal, existen otros 3 reinos con cientos de miles de especies conocidas. Cada año se descubren especies nuevas.
  • 26. 2 Un origen común a pesar de la variedad Antiguamente se creía que las especies entonces conocidas habían mantenido su aspecto sin cambiarlo desde el mismo momento de la creación.
  • 27. 2 Un origen común a pesar de la variedadSin embargo, en el siglo XIX comenzaron a surgirdiversas teorías que postulaban que los organismosvivientes eran el resultado de un dilatado procesodesarrollado a lo largo de la historia de la Tierra. Todos los seres vivos tienen un origen común, a partir del cual se formaron las distintas especies y adquirieron niveles organizativos superiores. Este proceso se denomina evolución. Los científicos se preguntaban cómo podían explicarse las extrañas formas de vida, hoy inexistentes, que parecían estar grabadas en piedra: los fósiles. También se hacían preguntas acerca de las variaciones en los animales y plantas domésticos y el origen de sus razas.
  • 28. 2 Un origen común a pesar de la variedadNinguno de los científicos que apostaban por lasteorías evolucionistas conocía la existencia de losgenes ni de las mutaciones, pero ya entonces intuíanque los cambios ocurridos en los individuos de unaespecie “se transmitían” a los descendientes.
  • 29. 2 Un origen común a pesar de la variedad2.1.- Fijismo Los seres vivos permanecen invariables a lo largo del tiempo. Sus ideas se basaban en la interpretación del génesis y otros libros sagrados Se aceptaba el creacionismo, que explicaba el origen de las especies como creaciones de Dios que se mantienen inmutables en el tiempo Ciervo Gamo
  • 30. 2 Un origen común a pesar de la variedad2.1.- Fijismo Linneo fue un gran defensor del fijismo. “Hay tantas especies diferentes como formas diversas fueron creadas al principio por el ser infinito”
  • 31. ¿Cómo podía explicarla teoría fijista laexistencia de fósiles?
  • 32. Para nada El fijismo admito cambios en lasSiglo XIX especies Uno de los defensores del fijismo fue Cuvier. Interpretó acertatamente que los fósiles que se descubrían correspondían a Creacionismo restos deCuvier organismos que habían existido. Primer científico en hablar de la extinción de especies.
  • 33. Cuvier propusoPara explicar que la Tierrala diversidad había estadode organismos expuesta afósiles que grandescontradecían catástrofes, comoal fijismo, el diluvio universalelaboró la de la Biblia, queteoría del originaron decatastrofismo manera brusca la inundación de tierras, la desaparición de mares, la aparición de montañas y la desaparición de seres vivos.
  • 34. 2 Un origen común a pesar de la variedad2.1.- Fijismo y evolucionismo Fijistas Evolucionistas Los seres vivos son Los seres vivos son distintos porque distintos porque han sido evolucionan, pero mantienen creados distintos, sin relaciones de parentesco. Esto quiere relaciones de parentesco. decir que tienen un origen común, más o menos lejanos en el tiempo. Ciervo Gamo Elefante asiático Elefante africano
  • 35. ¿Por qué se parecen tanto entre sí? ¿Por qué se parecen tanto entre sí?
  • 36. ¿Por qué se parecen tanto entre sí? ¿Por qué se parecen tanto entre sí?
  • 37. ¿Por qué se parecen tanto entre sí? ¿Por qué se parecen tanto entre sí?
  • 38. ¿Por qué se parecen tanto entre sí? ¿Por qué se parecen tanto entre sí?
  • 39. ¿Por qué se parecen tanto entre sí? ¿Por qué se parecen tanto entre sí?
  • 40. ¿Por qué se parecen tanto entre sí? ¿Por qué se parecen tanto entre sí?
  • 41. Las semejanzas entre los seres vivos se deben a las relaciones de parentesco entre ellos, por lo que serán más parecidos cuanto más cercano en el tiempo se encuentre un antepasado común.Presente Línea del tiempo Ciervo Gamo Elefante asiático Elefante africano s mp lo Eje Antepasado común Antepasado común El descubrimiento y estudio de losPasado fósiles estimulaba las ideas evolucionistas
  • 42. lo s mpEjePresente Línea del tiempo Ancestro común de Ancestro común de los cánidos los félidos Ancestro común de hienas y osos Pasado Ancestro común Ancestro = Antepasado
  • 43. 2 Un origen común a pesar de la variedad 2.1.- Fijismo y evolucionismo Fijistas Evolucionistas Explicaban la desaparición de Los fósiles se explican porque los especies antiguas por antiguos seres se extinguieroncatástrofes naturales que eran para dejar paso a nuevas formas ordenadas por Dios. Eran de vida que surgieron a partir decatastrofistas y creacionistas. las anteriores. El Mamut y otras criaturas se habrían extinguido por no haberse salvado del Diluvio en el Arca de Noé
  • 44. 2 Un origen común a pesar de la variedad2.1.- Fijismo y evolucionismo A lo largo del siglo XIX, la comunidad científica asistió al enfrentamiento entre los defensores y detractores de las teorías evolucionistas, que trascendió el ámbito de la mera especulación científica y suscitó furibundos ataques por parte de los estamentos eclesiásticos, para los que la idea de la evolución representaba una grave amenaza a las creencias más profundamente arraigadas. Las ideas evolucionistas chocaban con las Caricaturas contra Darwin como esta ideas religiosas que el propio Darwin tenía.intentaban ridiculizar sus ideas incluso insultándolo personalmente.
  • 45. 3 Teorías evolutivas Durante la gestación de la teoría de la evolución a partir de un antepasado común se formularon diversas hipótesis para explicar las causas que originaron el cambio en los seres vivos, es decir, para determinar qué factores provocan la formación de nuevas especies y la aparición de nuevos tipos de organización. Veamos a continuación cada una de las hipótesis: 3.1.- Lamarckismo 3.2.- Darwinismo: Darwin y Wallace 3.3.- Neodarwinismo o Teoría sintética
  • 46. 3 Teorías evolutivas3.1.- Lamarckismo Lamarck pensaba que las especies cambiaban evolucionando, para adaptarse a sus necesidades, aumentando así poco a poco la complejidad de los organismos vivos. Lamar ck (1744 – 1829)Jean Baptiste de Monet, caballero de Lamarck, naturalista francés. En 1809 publicó Philosophiezoologique, donde expuso las primeras ideas Por ejemplo, el ancestro de la actual jirafa razonadas sobre la se adaptó estirando cada vez más su evolución. Sus ideas no cuello, generación tras generación, para fueron aceptadas. poder llegar a las ramas más altas.
  • 47. 3 Teorías evolutivas3.1.- Lamarckismo La premisa central de su hipótesis giraba en torno a dos ideas fundamentales: Lamar ck 1. La influencia del medio en el que se desarrollan (1744 – 1829)Jean Baptiste de Monet, las especies determinan caballero de Lamarck, los cambios de estas. naturalista francés. En 2. Dichos cambios son 1809 publicó Philosophie hereditarios, es decir, Cráneo yzoologique, donde expuso las primeras ideas serán transmitidos a la vértebras razonadas sobre la descendencia. cervicales evolución. Sus ideas no de jirafa fueron aceptadas.
  • 48. 3.1.- Lamarckismo Según Lamarck, las modificaciones en el entorno de una especie genera nuevas necesidades, en respuesta a las cuales los seres vivos se ven obligados a utilizar un determinado órgano determinado: “La función hace el órgano”, en palabras del propio Lamarck. El uso continuado del mismo lo fortalece y desarrolla, mientras que el no usarlo determina su atrofia y desaparición (“ley del uso y desuso”). Esforzándose y usándolo, este animal lograría desarrollar su cuello. Y después lograría transmitir eso a sus hijos.
  • 49. El lamarkismo Siglo XIX Jean Baptiste de LamarckEn épocas de sequía las Los primitivas jirafas Las caracteres adquiridos,jirafas estiraban el cuello y cuello y patasantílopes provenían de cada vezlas patas para alcanzar las más largos, eran primitivos.hojas. transmitidos a la Se alimentaban de lasDebido al uso, de descendencia estos hojas bajas en generación. generación de las acacias.órganos se iban
  • 50. 3.1.- Lamarckismo Según Lamarck, las modificaciones en el entorno de una especie genera nuevas necesidades, en respuesta a las cuales los seres vivos se ven obligados a utilizar un determinado órgano determinado: “La función hace el órgano”, en palabras del propio Lamarck. El uso continuado del mismo lo fortalece y desarrolla, mientras que el no usarlo determina su atrofia y desaparición (“ley del uso y desuso”). El uso de los cuernos provocaría su desarrollo. El gran desarrollo de las patas posteriores de algunos animales se debería a su gran uso. El kiwi habría atrofiado sus alas por no usarlas.
  • 51. El lamarckismo Su teoría se basa en :1.Tendencia a la complejidadSegún esta teoría, los seres vivos tienen un impulso interno hacia laperfección y la complejidad, se adapta a los cambios del ambienteprovocando la aparición de órganos nuevos que pasan a susdescendientes.2. Aparición de adaptacionesLa necesidad provoca la aparición de órganos nuevos, y cuando sedeja de usar algún órgano, éste se atrófia y desaparece. Se trata de lahipótesis del uso y desuso, que se suele simplificar con lasexpresiones: la función crea el órgano y el órgano que no se utiliza seatrofia.3. Herencia de los caracteres adquiridosLos caracteres adquiridos durante la vida del individuo se conservany se transmiten a la descendencia. Esta idea esta arraigada en lacultura popular, incluso hoy día se mantiene en muchas personas.
  • 52. 3.1.- Lamarckismo Según Lamarck, las modificaciones en el entorno de una especie genera nuevas necesidades, en respuesta a las cuales los seres vivos se ven obligados a utilizar un determinado órgano determinado: “La función hace el órgano”, en palabras del propio Lamarck. El uso continuado del mismo lo fortalece y desarrolla, mientras que el no usarlo determina su atrofia y desaparición (“ley del uso y desuso”). Esta hipótesis es totalmente inadmisible hoy día por la Genética, pues se sabe que los caracteres adquiridos (como, por ejemplo, el aumento de la masa muscular por el ejercicio o ponerse moreno cuando se toma el sol) no se transmiten a la descendencia, pues no afectan al material genético.
  • 53. 3 Teorías evolutivas 3.2.- Darwinismo Las ideas de Darwin se resumen en 3 conceptos: Charles Darwin1.- La lucha por la existencia (1809 – 1882)2.- La variabilidad intraespecífica3.- La selección natural La selección natural tiende a promover la supervivencia de los más aptos. Esta teoría revolucionaria se publicó en 1859 en el famoso tratado El origen de las especies por medio de la selección natural. Veamos estos conceptos…
  • 54. ¿Cómo van evolucionando los ser es vivos? Son muchos los que nacen… Nacen más individuos de los que son capaces de sobrevivir en un medio con recursos limitados. Dentro de cada especie hay variedad en las características. Los individuos no son idénticos entre sí. Nacen con diferencias entre ellos, es decir, hay una variabilidad intraespecífica (dentro de la especie)
  • 55. Son muchos los que nacen… Pero… Algunos noencuentran suficiente alimento o sufren enfermedades y Otros son la mueren presa de algún depredador Hay una lucha por la existencia
  • 56. Son muchos los que nacen… Pero… Hay una lucha por la existencia y por la Algunos no encuentran pareja reproducción o no consiguen reproducirse por algún motivo
  • 57. Son muchos los que nacen… Pero… Sólo sobr eviven unos pocos: los que han nacido con características que les permiten adaptarse mejor a su medio.
  • 58. La Selección Natural haeliminado a los que nacieroncon características menosapropiadas para lasupervivencia. Sólo sobreviven unos pocos Los que sobreviven transmiten a sus hijos esas características que precisamente les ayudaron a sobrevivir mejor en su medio.
  • 59. La teoría de la evolución de Darwin y Wallace Siglo XIX Charles Darwin En épocas Generación tras desfavorablesPoblación de las generación, las jirafas de jirafas con patas yjirafas donde los cuello y patas cuello largo seránindividuos más largas más abundantespresentan tendrán mayor en la poblaciónvariaciones de probabilidad sobrevivir y reproducirse.
  • 60. 1.- Hay una variabilidad Las especies intraespecífica evolucionan,pero no como 2.- Hay una luchadecía Lamarck por la existencia 3.- Ha actuado la selección natural 1 2 3 A diferencia de Lamarck, Darwin pensaba que nacían jirafas con cuellos más largos o más cortos. Sobrevivirían sólo aquellas que habían heredado un cuello suficientemente largo.
  • 61. Compara las dos teorías y reflexiona Lamar ck Dar winPresente La Selección Natural se encarga de Luchan por la Línea del tiempo Transmiten a los hijos eliminar las de un cuello más largo supervivencia cuello corto. El cuello largo se va extendiendo en la especie Usan mucho su cuello Luchan por la Sólo Transmiten a los hijos supervivencia sobreviven y un cuello más largo se reproducen las de cuelloPasado más largo Las jirafas desarrollan un cuello Hay una variabilidad dentro largo por esforzarse y usarlo de la especie: algunas mucho para coger su alimento nacen con el cuello más largo.
  • 62. Reflexiona: ¿Cómo ha llevado la evolución a que este insecto parezca una hoja… … según la teoría de Lamarck? … según la teoría de Darwin? ¿Y en el caso dePhyllium giganteum esta oruga que parece una rama?
  • 63. Darwin estaba muy interesado en cómo los? agricultores, ganaderos y criadores de animales conseguían obtener y mejorar diferentes razas
  • 64. Darwin estaba muy interesado en cómo los Hacen agricultores, ganaderos y criadores de animales unaSelección conseguían obtener y mejorar diferentes razasArtificial Darwin pensaba que la Selección Pues muy fácil: para criar buenos Natural actuaba animales sólo hay que cruzar los como la selección mejores y eliminar a los que no nacieron con buenas características. hecha por el hombre Clic aquí para ver Si se quiere una buenaraza de vaca lechera no se cruzan animales que produzcan poca leche.Se seleccionan aquellashembras que produzcan más leche. Se hace una Cría Selectiva.
  • 65. El viaje del Beagle.Tras graduarse en Cambridge en 1831, eljoven Darwin se enroló a los 22 años en elbarco de reconocimiento HMS Beagle comonaturalista sin paga, para emprender unaexpedición científica alrededor del mundo.
  • 66. La expedición duró cinco años y recogió datoshidrográficos, geológicos y meteorológicos en Sudamérica Clic aquí pay otros muchos lugares. Las observaciones de zoología ybotánica de Darwin le llevaron a desarrollar la teoría de laselección natural.La asombrosa fauna de las Islas Galápagos dio mucho quepensar a Darwin Iguana Varias especies de pinzones Cormorán con alas Tortugas gigantes atrofiadas
  • 67. INICIO ESQUEMA RECURSOS INTERNET La teoría de la evolución de Darwin y Wallace Siglo XIX Antecedentes del darwinismo Lucha por la supervivencia El origen de las especies Charles Lyell Sucesión y cambio gradual a lo largo del tiempo Thomas Maltus
  • 68. INICIO ESQUEMA RECURSOS INTERNET Las especies y la especiación Pinzones de las islas Galápagos ANTERIOR SALIR
  • 69. En las islas Galápagos, en el Océano Pacífico frente a Sudamérica, quedó muy impresionado por las especies de animales que vio y, sobre todo, por las sutiles diferencias entre los pájaros de las islas del archipiélago. ¡¡13 ESPECIES DE PINZONES DISTINTAS!!A partir de estas observaciones, Darwin se dio cuenta que estasdiferencias podían estar conectadas con el hecho de que cada especievivía en un medio natural distinto, con distinta alimentación. En esemomento comenzó Darwin a delinear sus ideas acerca de la evolución.
  • 70. Entonces, ¿Venimos o no venimos del mono?
  • 71. Del “mono” no. Su teoría sobre la evolución del hombre fue groseramente malinterpretada y encontró mucha oposición. Los ataques a las ideas de Darwin que encontraron mayor eco no provenían de sus contrincantes científicos, sino de sus oponentes religiosos. Muchos atacaron a Darwin sin haber leído suLa idea de que los seres vivos habían libro ni conocer aevolucionado por procesos naturales fondo susnegaba la creación divina del hombre argumentos ey parecía colocarlo al mismo nivel ideas.que los animales. Ambas ideasrepresentaban una grave amenazapara la teología ortodoxa. Darwin no pensaba que el hombre descendiese de ningún “mono” actual, sino que el hombre y otros primates descendían todos de antepasados comunes.
  • 72. ¿Dónde encajan lo shumanos e n la evolución?
  • 73. Orangután Gorila Chimpancé Ser humano ? En tiempos de Darwin no se conocían fósiles de antepasados humanos Darwin pensaba que el ser humano no ? Antepasado procede de ningún común primate actual. Pero sí creía que tenemos antepasados comunes con ellos.
  • 74. Orangután Gorila Chimpancé Ser humano ? (hace 5 millones de años) Pero la ciencia moderna Darwin fue atacado porqueconoce muchos eslabones de no se conocían estos esta cadena ? “eslabones perdidos” de la Australopithecus Procónsul cadena de la evolución (hace 20 millones humana de años) 117
  • 75. Antepasados comunes Homínidos Simios Monos del antropoides Monos del viejo mundo Prosimios nuevo mundo Hace 5 millones de años Se produce la separación de los simios y homínidos Hace 35 millones de años. Los monos seLos homínidos junto a antropoides, separan del resto demonos y prosimios forman el orden primatesprimates Hace 60 millones de años
  • 76. La especie humana es laúnica representante actualde la familia de loshomínidos, que comprendelas especies extinguidas delgénero Homo y del géneroAustralopithecus
  • 77. La adquisición del bipedismo El foramen magnum se sitúa en una La columna posición inferior del El bipedimso consiste en vertebral cráneocaminar sobre dos adquiere formapies sin apoyar las manos de S Acortamiento y ensanchamiento Alargamiento de las de la pelvis extremidades inferiores El dedo pulgar del pie deja de ser oponible
  • 78. El foramen magnum es el orificioque une la columna vertebral conel cráneo
  • 79. Los primeros homínidos habrían sidogranívoros, y para obtener las semillasharía falta un órgano que funcionasecomo una pinza de precisión. Y eseórgano sería la mano «con el pulgaroponible, característica que conviertea este dedo en el instrumento másvalioso de la mano».Esa pinza es laclave que explica el porqué de que elhombre, a diferencia de cualquier otraespecie, pueda fabricar, dominar laforma de la materia para plasmar através de ella su pensamiento.
  • 80. Hacia el final del Mioceno el hábitat africanocomienza a modificarse. Para ese entonces, Áfricaestaba cubierta de selvas tropicales. Diversosprocesos tectónicos, junto con el aumento gradualde la temperatura global del planeta, condujeron aun clima seco estacional. Así, proliferaron losespacios abiertos de bosques y sabanas. En estenuevo contexto, los homínidos debieronmovilizarse más en búsqueda de alimentos: "loobligan a bajarse del árbol y a ir a los llanos".
  • 81. Entonces, queventajas supuso el bipedismo…
  • 82. 1. Observar el horizonte desde las altas hierbas de las praderas.2. Liberar las manos para otras funciones (transporte de obetos, alimentos, crías…) 3. Caminar durante más tiempo
  • 83. •Frena la velocidad•Limita la agilidad•Supone más dificultades en el parto al aumentarla capacidad craneana
  • 84. En el árbol de la evolución que condujo hasta nosotros, algunas ramas, como el Neardenthal, se extinguieron Homo sapiensHomo neardenthalensis Homo heidelbergensis Homo erectus Homo antecesor Homo ergaster Australopithecus afarensis Australopithecus boisei
  • 85. La evolución de los homínidosM.a. 1,3 - 500 000 - 23 000 - 4,5 4-2 2,5 - 1,6 1,6 - 1,3 50 000 a. 800 000 a. 150 000 años 180 000 a. 28 000 a. Homo Ardipithecus Homo Homo Homo sapiens sapiens ramidus habilis erectus heidelbergensis Homo Homo Homo Australopitecus neanderthalensis ergaster antecesor
  • 86. La evolución de los homínidos Orrorin tugenensi. Es el homínido conocido más antiguo, ya que inició la postura bípeda hace 6 m.a. Vivía en un hábitat arbolado.
  • 87. La evolución de los homínidos Ardipithecus ramidus. Vivió hace 4,5 M.a. en las selvas de Etiopía. Aspecto similar al chimpancé actual. Se alimentaba de frutos y hojas. No se sabe con seguridad su tipo de locomoción.
  • 88. La moderna Antropología conoce muchos más detalles de la evolución humana de lo que la gente piensa Australopithecus afarensis
  • 89. La evolución de los homínidos Australopitecus. Primer homínido bípedo. Dio lugar al género Homo. Vivieron entre hace 4 y 2 M.a. en los bosques de África. Caminaban erguidos y se alimentaban de frutos y brotes. Su capacidad craneal era de 500 cm3. Hay varias especies: A anamensis, A. afarensis, A. africanus…
  • 90. La evolución de los homínidos Lucy Es el fósil de homínido más conocido. Pertenece a A. afarensis (del griego pithecus que significa mono). Edad de 3.2 M.a Hasta hace poco el homínido más antiguo conocido. De sexo femenino y altura de poco más de un metro. Caminaba erguida. Volumen cerebral 400 cc (similar al de los chimpancés)
  • 91. La evolución de los homínidos Homo habilis. Hombre diestro Primera especie del género Homo. Vivió entre hace 2,5 y 1,6 M.a. en las sabanas del valle del Rift en África. Fabricó las primeras herramientas e incluyó carne en su dieta . Tenía una capacidad craneal aproximada de 600 cm3.
  • 92. La evolución de los homínidos Homo ergaster. “Hombre trabajador” Comenzó a aprovechar el fuego. Vivió entre hace 1,6 y 1,3 M.a. en las sabanas del sur y este de África. Podía llegar a medir 180 cm de estatura. Era omnívoro y probablemente cazador. Su capacidad craneal estaba entre 800 y 900 cm3 . A partir de él se originaron dos líneas: H erectus, H antecessor
  • 93. La evolución de los homínidos Homo erectus. Colonizó Asia. Vivió entre hace 1,3 M.a. y 50 000 años en China y Asia en zonas abiertas. Parecido al Homo ergaster. Esta especie fue la primera en salir de África y colonizar Asia. Tenía una capacidad craneal entre 900 y 1 280 cm3 .
  • 94. La moderna Antropología conoce muchos más detalles de la evolución humana de lo que la gente piensa Homo erectus
  • 95. Homo antecessor. Hombre pioneroLa evolución de los homínidos Colonizó Europa. Vivió hace 800 000 años en Europa habitando zonas boscosas. Era cazador recolector y utilizaba herramientas de hueso y madera. Tenía 1 000 cm3 de capacidad craneal. Dio lugar a dos especies: H heidelbergensis y H neanderthalensis
  • 96. La evolución de los homínidos Homo heidelbergensis. Posiblemente realizó los enterramientos más antiguos. Vivió entre hace 500 000 y 180 000 años en Europa. Colonizó todo tipo de ambientes. Era omnívoro, con una estructura corporal robusta. Fabricaba herramientas de piedra. Tenía una capacidad craneal entre 1 100 y 1 390 cm3.
  • 97. La evolución de los homínidos Homo neanderthalensis. Dominaban el fuego, cuidaban de sus enfermos y tenían ritos funerarios. Vivió entre hace 23 000 y 28 000 años. Habitó todo tipo de ambientes de Europa, Oriente próximo y Asia central. Perfeccionó la técnica de tallado de la piedra. Tenía una capacidad craneal de 1 750 cm3, superior a la de nuestra especie. Carecía de mentón
  • 98. La evolución de los homínidos Homo neanderthalensis. Carecía de mentón El hueso frontal se prolongaba sobre los ojos formando el arco superciliar prominente (toro supraorbital). Excelente cazador Gran fortaleza física
  • 99. La evolución de los homínidos Homo sapiens sapiens. Única especie actual de homínidos. Nuestra especie apareció hace aproximadamente 150 000 años y colonizamos todo el planeta. Su inteligencia y capacidad de comunicación fue fundamental para desarrollar una cultura compleja y una conciencia. Nuestra capacidad craneal es de 1 400 cm3 .
  • 100. 3 Teorías evolutivas3.3.- Neodarwinismo o Teoría…….Sintética de la Evolución Ninguno de los científicos que apostaban por las teorías evolucionistas conocía la existencia de los genes ni de las mutaciones, pero ya entonces intuían que los cambios ocurridos en los individuos de una especie “se transmitían” a los descendientes. Darwin no sabía explicar cómo se transmiten los caracteres hereditarios. En sus tiempos no se conocían los cromosomas, ni mucho menos el ADN. Las Leyes de Mendel se desconocían cuando Darwin publicó su teoría.
  • 101. 3 Teorías evolutivas Ningún científico3.3.- Neodarwinismo o Teoría niega hoy día el hecho…….Sintética de la Evolución evolutivo La Biología moderna explica el hecho evolutivo sumando a las ideas de Darwin las Leyes de Mendel y los conocimientos de la moderna Genética. + + = Neodarwinismo o Teoría Sintética de la EvoluciónDarwin Mendel Genética Moderna Por fin quedaba resuelto el misterio del modo de transmitirse los caracteres hereditarios. El descubrimiento de las leyes de la herencia y del material genético permitía explicar aquello que los científicos contrarios a Darwin más le criticaron.El origen de las especies de Darwin se publicó en 1859, antes de los trabajos de Mendel.
  • 102. 3 Teorías evolutivas 3.3.- Neodarwinismo o Teoría Sintética de la Evolución La recombinación genética que Papá pato conoce a mamá pata… ocurre en la meiosis y la reproducción sexual producen la variabilidad intraespecífica de la que hablaba Darwin… mamá pata puso …y tuvieron hermosos patitos. Pero no habrá una oportunidadhuevos en el nido… para “el patito feo”: la Selección Natural acabará con él. El pato malvasía La Selección Natural sigue admitiéndose como el bucea para principal “motor” de la Evolución. La Selección obtener alimento Natural “escoge” dentro de la variabilidad. del fondo de lagunas
  • 103. 3 Teorías evolutivas3.3.- Neodarwinismo o Teoría Sintética de la EvoluciónComo ya sabes, a veces se producen errores en la duplicación del ADN,dando lugar a genes alterados, distintos al original. Son las MUTACIONES. ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG Doble cadena de ADN sin mutar ATTCGCGGCATTAATCCGATACCTAGGACCGCGGATTTAAACATGGATC TAAGCGCCGTAATTAGGCTATGGATCCTGGCGCCTAAATTTGTACCTAG Doble cadena de ADN con mutación Mutación Las mutaciones son la fuente original de la variabilidad. La meiosis y la reproducción sexual son fuentes añadidas de variabilidad. Variabilidad dentro de la especie Eriopis eschscholtzi Algunas mutaciones provocan la muerte, pero otras, en sí, no son “buenas” ni “malas”: todo dependerá del medio donde vive la especie.
  • 104. 3 Teorías evolutivas3.3.- Neodarwinismo o Teoría Sintética de la Evolución Las mutaciones, la recombinación genética en la meiosis, y la combinación de gametos en la reproducción sexual ocurren aleatoriamente (al azar) El número de combinaciones posibles de alelos de genes en una especie es elevadísimo (“casi infinito”). ¿Sabrías calcular el número de combinaciones posibles de figuras de dados tirando cinco de ellos?.
  • 105. 3 Teorías evolutivas3.3.- Neodarwinismo o Teoría Sintética de la Evolución En este medio, los ratones de fenotipo oscuro sobreviven con más probabilidad La naturaleza arroja sus dados y nacen animales más claros, más oscuros… Búho “normal” Dependiendo del medio, un color u otro será “mejor” o “peor” En este medio, los ratones de fenotipo claro sobreviven con más probabilidad Búho nivalCon el tiempo, en esta población de ratones, aumenta lafrecuencia de genes que determinan el fenotipo claro
  • 106. El neodarwinismo o teoría sintética de la evoluciónSiglo XX• Genética• Paleontología• Bioquímica• Geología
  • 107. El neodarwinismo o teoría sintética de la evolución Siglo XX Ante Entre los condicionesLa selección natural antecesores de cambiantes delfacilita la las jirafas, las medio, la mutaciónsupervivencia de los mutaciones se muestraindividuos que producirían beneficiosa y losposeen la ventajael individuos con individuos que laadaptativa. patas cuello y las poseen tendrán más largas. ventajas
  • 108. 4 Pruebas de la evolución4.1.- Pruebas morfológicas4.2.- Pruebas biogeográficas4.3.- Pruebas paleontológicas4.4.- Pruebas embriológicas4.5.- Pruebas bioquímicas
  • 109. 4 Pruebas de la evolución4.1.- Pruebas morfológicas Se basan en el estudio comparado de la morfología de los órganos de seres vivos actuales o de fósiles. Mediante la ANATOMIA COMPARADA se estudian las semejanzas y diferencias entre órganos de diversas especies.
  • 110. 4.1.- Pruebas morfológicas Observa detenidamente estos dibujos de extremidades anteriores de vertebrados: Todas son diferentes pero tienen “un esquema común” de organización Ese “esquema común” de organización se debe a unHOMÓLOGOS Estos dibujos muestran ejemplos de ÓRGANOS antepasado común que “inventó” un “esquema básico”. La evolución por selección natural llevó a distintas adaptaciones de esta extremidad para correr, nadar, volar… Pero el “esquema básico” se mantuvo en todas estas especies.
  • 111. INICIO ESQUEMA RECURSOS INTERNET Pruebas anatómicas de la evolución LAS LUPAS AMPLÍAN LAS IMAGENES ANTERIOR SALIR
  • 112. INICIO ESQUEMA RECURSOS INTERNET Pruebas anatómicas de la evolución ANTERIOR SALIR
  • 113. INICIO ESQUEMA RECURSOS INTERNET Pruebas anatómicas de la evolución ANTERIOR SALIR
  • 114. INICIO ESQUEMA RECURSOS INTERNET Pruebas anatómicas de la evolución ANTERIOR SALIR
  • 115. INICIO ESQUEMA RECURSOS INTERNET Pruebas anatómicas de la evolución ANTERIOR SALIR
  • 116. 4.1.- Pruebas morfológicas Los órganos HOMÓLOGOS son aquellos que tienen un mismo origen evolutivo y embrionario, con una estructura interna semejante, fruto de diversas modificaciones adaptativas a distintos hábitats. Ejemplos: Humano Gato Ballena Murciélago
  • 117. 4.1.- Pruebas morfológicas Los órganos HOMÓLOGOS son aquellos que tienen un mismo origen evolutivo y embrionario, con una estructura interna semejante, y con diversas modificaciones adaptativas a distintos hábitats. Humano Caballo Murciélago Ballena
  • 118. 4.1.- Pruebas morfológicas ¿Te parecería apropiado pensar en un parentesco próximo entre un murciélago y un insecto sólo porque vuelan? Ala de murciélago Ala de insecto Son ejemplos de Hay una membrana entre los dedos órganos ANÁLOGOS que permite volar a los murciélagos. Son ejemplos de órganos HOMÓLOGOS Cráneo de oso Cráneo de murciélago Brazo Aunque los osos y los humanos humano no volemos, estamos bastante más emparentados con un Brazo de murciélago que con un insecto. murciélago
  • 119. 4.1.- Pruebas morfológicas Los órganos ANÁLOGOS son Ala de murciélago aquellos que tienen Ala de insecto distinto origen evolutivo y embrionario, pero presentan una Son ejemplos de forma órganos ANÁLOGOS aparentemente Son ejemplos de semejante y órganos ANÁLOGOS realizan la misma función. Estos machos de Lucanus cervus (ciervo volante), usan sus “cuernos” (mandíbulas muy desarrolladas) para Los ciervos macho combatir entre ellos. también combaten con sus cuernos
  • 120. 4.1.- Pruebas morfológicas Los órganos ANÁLOGOS representan un fenómeno llamado CONVERGENCIA ADAPTATIVA, por el cual los seres vivos repiten fórmulas y diseños que han tenido éxito.
  • 121. 4.1.- Pruebas morfológicas Los órganos HOMÓLOGOS representan la DIVERGENCIA ADAPTATIVA, por la cual los seres vivos modelan sus órganos según su modo de vida, el ambiente en que están, etc.
  • 122. 4.1.- Pruebas morfológicas Los ÓRGANOS VESTIGIALES son también pruebas anatómicas de la Evolución. Son órganos rudimentarios, atrofiados, que revelan un pasado evolutivo. Cintura pélvica Fémur Por ejemplo, los cetáceos (ballenas, delfines…) conservan vestigios (“restos”) del fémur y de la cintura pelviana. La explicación es que tuvieron un antepasado mamífero terrestre. Su adaptación al medio acuático les llevó a perder las extremidades posteriores, pero quedan “restos”.
  • 123. 4.1.- Pruebas morfológicas Los ÓRGANOS VESTIGIALES son también pruebas anatómicas de la Evolución. Son órganos rudimentarios, atrofiados, que revelan un pasado evolutivo. Este insecto tiene El kiwi y el cormorán de las Islas alas vestigiales. Con ellas ya no puede Galápagos tienen alas vestigiales. Con ellas ya no pueden volar. volar. El cóccix son pequeñas vértebras fusionadas. Es el vestigio de un pasado evolutivo con cola.
  • 124. 4 Pruebas de la evolución 4.2.- Pruebas biogeográficas Un único ancestro comúnLas encontramos repartidas por todo el dio lugar a diversasplaneta, y consisten en la existencia de especies de pinzones engrupos de especies más o menos las diferentes islasparecidas, emparentadas, que habitan Galápagoslugares relacionados entre sí por suproximidad, situación o características,por ejemplo, un conjunto de islas, dondecada especie del grupo se ha adaptado aunas condiciones concretas. La pruebaevolutiva aparece porque todas esasespecies próximas provienen de una únicaespecie antepasada que originó a todaslas demás a medida que pequeños gruposde individuos se adaptaban a lascondiciones de un lugar concreto, queeran diferentes a las de otros lugares.Son ejemplos característicos de esto lospinzones de las islas Galápagos quefueron estudiados por Darwin
  • 125. 4 Pruebas de la evolución 4.2.- Pruebas biogeográficas Camello bactriano Llama Camélidos de Asia - África Dromedario Alpaca Vicuña Guanaco La familia de los camélidos se diversificó de acuerdo a su distinta adaptación en diferentes hábitats. Ello constituye unaCamélidos de Sudamérica prueba biogeográfica más de la evolución.
  • 126. 4 Pruebas de la evolución 4.2.- Pruebas biogeográficas Diablo de Tasmania Equidna Ornitorrinco Lobo marsupial (extinguido)La extraña fauna de Australia Koalarefleja su aislamientoevolutivo del resto decontinentes. Las especies demamíferos evolucionaronindependientemente de otraspartes del mundo. Esto es unaprueba biogeográfica más dela evolución. Wallaby Canguro rojo
  • 127. INICIO ESQUEMA RECURSOS INTERNET Pruebas biogeográficas de la evolución Japón África América Central ANTERIOR SALIR
  • 128. INICIO ESQUEMA RECURSOS INTERNET Pruebas biogeográficas de la evolución Japón África Capuchino de cara blanca ANTERIOR SALIR
  • 129. INICIO ESQUEMA RECURSOS INTERNET Pruebas biogeográficas de la evolución Japón América Central Mono verde ANTERIOR SALIR
  • 130. INICIO ESQUEMA RECURSOS INTERNET Pruebas biogeográficas de la evolución Macaco japonés África América Central ANTERIOR SALIR
  • 131. 4 Pruebas de la evolución4.3.- Pruebas paleontológicas El nacimiento de la Paleontología vino a apoyar las ideas evolucionistas del siglo XIX. Se establecen similitudes con Esqueleto especies actuales y se intentafosilizado de determinar una historia evolutiva Megaceros apoyada en pruebas tan firmes como son los fósiles. ¿Podría ser este el Así, por ejemplo, se han logradoantepasado del reconstruir historias evolutivasciervo actual? completas como la que condujo hasta el caballo
  • 132. 4 Pruebas de la evolución 4.3.- Pruebas paleontológicas Se han logrado reconstruir historias evolutivascompletas como laque condujo hasta el caballo. Los antepasados del caballo fueron cambiando y gradualmente fueron perdiendo dedos como adaptación a la carrera veloz.Clic aquí para En los fósiles está escrita la historia evolutiva de los équidosver vídeo
  • 133. 4 Pruebas de la evolución 4.3.- Pruebas paleontológicas Ancestro de los équidos Équido actual Se han logrado reconstruir historias evolutivas completas como la que condujo hasta el caballo. Los antepasados del caballo fueron cambiando y gradualmente fueron perdiendo dedos como adaptación a la carrera veloz.Clic aquí para En los fósiles está escrita la historia evolutivaver vídeo
  • 134. 4 Pruebas de la evolución Clic aquí para4.3.- Pruebas paleontológicas ver vídeoDedosvestigiales y Garras en los dedos Plumassin garras Pico con dientes Cola larga Cola corta El Arqueopterix pudo ser el antepasado extinguido de las aves. Era “mitad reptil – Pico sin dientes Ave actual mitad ave”
  • 135. Fósil de Archaeopteryx Reconstrucciones del Archaeopteryx Clic aquí para ver vídeo
  • 136. ArchaeopteryxVivió hace 150millones de años Se considera un animal emblemático en el estudio de la evolución por su carácter transicional entre reptiles y aves
  • 137. INICIO ESQUEMA RECURSOS INTERNET Pruebas paleontológicas de la evoluciónRasgos de ave Alas Garras Archaeopter yx Pico Cola DientesPlumas Rasgos de reptil ANTERIOR SALIR
  • 138. 4 Pruebas de la evolución 4.3.- Pruebas paleontológicas “Fósiles vivientes” Hoja actual Hojas fosilizadas Darwin llamó al Ginkgo Biloba "fósil viviente", por considerarlo la especie vegetal más antigua delConcha de planeta. Aparecieron hace 250 Nautilus fosilizados Nautilus actual millones de años, en el período seccionados Este molusco es un “fósil Pérmico, al final de la era primaria. viviente” que lleva sin evolucionar 150 millones Este pez, el celacanto es de años. Se considera otros “fósil viviente”. próximo en la evolución a Curiosamente, se conocía los extinguidos ammonites muy bien a los fósiles mucho antes de descubrirse el primer ejemplar vivo.
  • 139. 4 Pruebas de la evolución4.3.- Pruebas paleontológicas El libro de la historia de la Tierra está escrita en las rocas. Los fósiles son las palabras de ese libro. En el próximo tema veremos los detalles del proceso de fosilización y los grupos de fósiles más importantes.
  • 140. 4 principio todosde laembrionesAl Pruebas estos evoluciónson muy parecidos entre sí4.4.- Pruebas embriológicas Observa detenidamente el desarrollo embrionario de estas especies:
  • 141. 4 Pruebas de la evolución4.4.- Pruebas embriológicas Estas semejanzas son una prueba de que existe un parentesco entre las especies. Cuanto más alto sea el parecido entre embriones, mayor será el grado de parentesco entre dos especies. Durante el desarrollo embrionario es como si se reprodujese la historia evolutiva de los antepasados. Nuestro embrión, al principio, es muy parecido al de un pez. Nuestros antepasados remotos fueron peces.
  • 142. Pruebas embriológicas de la evolución Gato Humano Ave Ratón
  • 143. 4 Pruebas de la evolución 4.5.- Pruebas bioquímicas Por último, las pruebas más recientes y las que mayores posibilidades presentan, consisten en comparar ciertas moléculas que aparecen en todos los seres vivos de tal manera que esas moléculas son tanto más parecidas cuanto menores diferencias evolutivas hay entre sus poseedores, y al revés; esto se ha hecho sobre todo con proteínas (por ejemplo proteínas de la sangre) y con ADN.
  • 144. 5 Mecanismos evolutivos La eficacia biológica o capacidad para dejar descendencia es inseparable del concepto de selección natural. La mayor Los seres vivos somos lo que somos gracias a la información genética que poseemos eficacia biológica deja una mayor almacenada en nuestras células; esta representación del genotipo información ha sido más o menos modelada por sobre los demás en generaciones el ambiente en el que vivimos. Pero lo único sucesivas. que transmitiremos a nuestros hijos serán nuestros genes, no caracteres adquiridos como una piel morena o unos músculos fuertes. La evolución se entiende como el cambio producido a lo largo del tiempo en el material genético de las poblaciones.
  • 145. 5 Mecanismos evolutivos En un principio, los seres vivos de la misma especie y de la misma población debieron tener idéntica información genética, los mismos genes y los mismos alelos. Todos los individuos estarían en principio igual de adaptados a su medio, salvo diferencias ambientales individuales (por ejemplo, el que se alimente más estará más fuerte); la cuestión es, ¿por qué con el tiempo surgen individuos diferentes dentro de las poblaciones?. La respuesta a estas cuestiones está en las MUTACIONES GENÉTICAS, que hacen que un gen cambie lo suficiente para seguir siendo el mismo gen, pero dé lugar a un carácter algo diferente, convirtiéndose entonces en lo que llamamos un ALELO.
  • 146. 5 Mecanismos evolutivosCualquier ser vivirá mejor o peor en el lugar en que le ha tocado vivirsegún los caracteres que haya desarrollado, así por ejemplo, si tieneuna gruesa cubierta de pelo aguantará bien el frío, si tiene agilidadpara subir a los árboles escapará de los predadores y si sabe nadar nose ahogará cuando tenga que cruzar un río; esta capacidad de vivirmejor o peor es lo que llamamos ADAPTACIÓN AL MEDIO: el queestá mejor adaptado vive mejor, se alimenta bien, escapa de lospredadores, vive más tiempo y todo esto hará que tenga más crías, y,por lo tanto, deje más descendientes a la siguiente generación quellevarán sus genes, es la SUPERVIVENCIA DEL MÁS APTO.LOS SERES MEJOR ADAPTADOS A SU MEDIO DEJANMÁS DESCENDIENTES A LA SIGUIENTE GENERACIÓNEn sentido negativo, los individuos que están peor adaptados vivenmenos, y dejarán menos descendientes, por lo que al cabo de variasgeneraciones sus genes tenderán a desaparecer, quedando sólo losgenes que suponen una mejor adaptación, es decir, la naturalezaselecciona los mejores genes para un ambiente determinado, es lo quellamamos la SELECCIÓN NATURAL
  • 147. 5 Mecanismos evolutivosComo ya hemos visto, la principal fuerza evolutiva son las mutacionesgenéticas, que son las responsables de la mayoría de la variabilidad genéticade las poblaciones, aunque no son la única fuerza evolutiva que actúa, ya queexisten otras que son también muy importantes: la reproducción sexual, que es la responsable de la mezcla de genes y alelosen los individuos el número de individuos de la población, ya que si lapoblación es muy pequeña los cambios genéticos se dan más deprisa (derivagenética) los movimientos de individuos, las migraciones, que alteran elconjunto de genes y alelos de la población y, por supuesto, la selecciónnatural, que escogerá aquellas combinaciones genéticas más favorables paraese medio, haciendo que esos individuos mejor adaptados produzcan másindividuos y su EFICACIA BIOLÓGICA sea mayor.
  • 148. 5 Mecanismos evolutivosLa mariposa Biston betularia deInglaterra puede ser clara uoscura. En condicionesnormales, la proporción deindividuos que llevan el genresponsable del color claro esmuy alta. Sin embargo, en zonasdonde azotaba la contaminacióny los árboles oscurecían con elhollín, predominan los individuoscon fenotipo oscuro. Tronco Mariposas descansado, posadas ennegrecido sobre troncos de abedul por el hollín
  • 149. 6 Microevolución y macroevolución Son dos niveles diferentes del proceso evolutivo Microevolución MacroevoluciónSe trata de pequeñas El término Macroevolución semodificaciones en las refiere a las relaciones entrepoblaciones que pueden llegar todos de seres vivos, con laa originar nuevas especies aparición y desaparición depróximas, parecidas entre grandes grupos. Los fósiles sonellas, pero distintas. Ejemplo: fundamentales para encajar todopinzones de las Islas este gran rompecabezas.Galápagos.
  • 150. 6 Microevolución y macroevoluciónLas 13 especies actuales depinzones de las Galápagos se originaron a partir de unantepasado que llegó desde el continente. Se produjo una radiación adaptativa. Se trata de un ejemplo demicroevolución.
  • 151. 6 Microevolución y macroevoluciónMacroevolución: árbol evolutivoo filogenético de los seres vivos.
  • 152. Carnívoros Pinnípedos Cetáceos Perisodáctilos Roedores ArtiodáctilosLagomorfos Proboscídeos Primates Sirenios Quirópteros Desdentados Árbol evolutivo de los Insectívoros mamíferos placentarios
  • 153. 7 Formación de nuevas especies Aquí ves 6 especies de felinos que se originaron a partir de un ancestro común. Pero… ¿Qué es exactamente una ESPECIE? 1 2 3 4 6 5
  • 154. Los individuos pertenecen a una misma especie cuando pueden reproducirse entre sí y tener descendencia fértil. Macho adulto Hembra adulta Subadulto Foca monje Joven (Monachus monachus)Las cuatro especies de buitres ibéricos Recién nacido Cachorro
  • 155. ¿Son de la misma especie estas dos aves?: No. ¿Por qué?A simple vista vemos que hay diferencias entre estos dos individuos:la forma del pico, los colores del plumaje, etc. Dos seres como estos(macho y hembra) NO PUEDEN REPRODUCIRSE ENTRE SÍ
  • 156. ¿Cuántos individuos hay aquí? …… 19 ¿Y cuántas especies ves? ………8
  • 157. Carlos Linneo estableció en elsiglo XVIII el sistema deNOMENCLATURA BINOMIALpara nombrar científicamentelas especies.
  • 158. Gorrión Cada especie tiene un nombre científico, universal y único en todos los países. Passer domesticus
  • 159. Los nombres científicos evitan confusionesNombre vulgar: bisonteA veces llamado en América “búfalo” Nombre vulgar: búfaloBison bonasus Syncerus caffer
  • 160. Son RAZAS de una misma especie: Canis familiarisPastor alemán Pastor belga Collie Galgo Pointer Fox terrier Bulldog Bulterrier Basset Beagle Yorkshire Rottweiler
  • 161. Ya no se pueden Todavía se pueden reproducir entre sí reproducir entre sí Canis familiaris Canis lupus Vulpes vulpes (perro) (lobo) (zorro)El perro comenzóa acompañar alser humanodesde laPrehistoria.Estudios de ADNconfirman que Canis lupusproviene del lobo (lobo) Antepasado comúny no del zorro.
  • 162. A veces existe un DIMORFISMO SEXUAL, es decir, queel macho y la hembra muestras diferentes colores,tamaño y forma del cuerpo o de algunos órganos…
  • 163. Estos monos, aunque no lo parezca, pertenecen a la mismaespecie (la variabilidad intraespecífica es muy alta) Otras veces ocurre lo contrario: animales o plantas que parecen iguales a simple vista, en realidad pertenecen a diferentes especies, como ocurre por ejemplo con las cebras…
  • 164. Se hace necesario estudiar a fondo las poblaciones de animales paraconocer si se trata de una especie o de varias. Por ejemplo, después desiglos pensando que en África sólo había una especie de cebra, se sabedesde hace pocos años que en realidad hay tres: Equus grevyi Equus zebra Su parecido es tan grande porque están muy emparentadas. Eso significa que el ancestro común de las tres especies está relativamente próximo en el tiempo. Equus quagga
  • 165. Esto no es un capricho de los biólogos. Son especies diferentes porque no se reproducen entre sí dando unos hijos fértiles Equus grevyiEquus zebra En algunos zoológicos se han podido reproducir especies diferentes de cebras. Pero los hijos resultantes, aunque viven con normalidad, son ESTÉRILES Equus quagga
  • 166. Desde muy antiguo se sabe que también pueden reproducirse dosespecies diferentes: caballo y asno.La mula es un híbrido que resulta del cruce entreburro y yegua o entre caballo y burra. Las mulasno se pueden reproducir porque son ESTÉRILES Équidos Animales del género Equus Mula (es un híbrido asno-caballo) Cuando se originan las especies dejan de reproducirse unas con otras. Adoptan colores, formas y comportamientos que les impiden cruzarse con especies diferentes
  • 167. Una especie puede definirse como el conjunto deindividuos que constituyen una población concaracterísticas estructurales y funcionalessemejantes, y que son capaces de aparearseentre sí y generar una descendencia fértil. El cortejo en las palomas Apareamiento en el ciervo volante
  • 168. 7 Formación de nuevas especies 7.1.- ¿Cuál es la causa de la biodiversidad? 1. La adaptación al medio genera una serie de cambios pequeños y graduales en una población que, a lo largo de miles de años, pueden llegar a constituir una especie nueva. 2. La formación de especies nuevas a partir de otra preexistente, o especiación, fenómeno que es principal responsable de la diversidad de los organismos vivientes.Ancestro de los équidos Équido actual
  • 169. 7 Formación de nuevas especies 7.2.- ¿Cómo se forma una nueva especie? Además de intervenir la adaptación al medio por selección natural, debe producirse además el AISLAMIENTO de una población que, al evolucionar y diferenciarse gradualmente del resto de la especie original, llega a original una especie nueva. El okapi es un jiráfido de cuello corto Las dos especies: jirafa y okapi, que vive en las selvas africanas no se pueden reproducir entre sí.Al principio las poblaciones de una misma especie quedan separadas por una barrera física (un mar, una cadena montañosa, un desierto…). Al cabo de varias generaciones, se hace imposible del todo la reproducción entre las especies diferentes que se han formado
  • 170. Tengo ganas de aprender más sobre la evolución Clic aquí para ver vídeos sobre la Evolución Clic aquí para actividades interactivas:http://iessuel.org/ccnn/interactiv/evolu01.htm
  • 171. El caso de la mariposa del abedul (Biston betularia). Revolución Industrial (Manchester, 1850) Es de color blanco y vive sobre el tronco de los abedules, que suele estar cubierto de líquenes blancos. Así, pasa inadvertida ante sus depredadores: los pájaros. Las que tienen una mutación que les hace ser oscuras son presas fáciles. Éstas son minoritarias.
  • 172. Hacia 1850, en plena Revolución Industrial, lacontaminación atmosférica mató a muchos líquenes  los troncos de abedules ya no tenían líquenes y mostraban su color oscuro… Las mariposas blancas dejaron de pasar inadvertidas y fueron presa fácil de los pájaros… Tan sólo las mutantes oscuras pasaban inadvertidas en el nuevo ambiente y se reproducían… Al cabo de 50 años, el 99% de la población era oscura…
  • 173. … Un siglo más tarde, la calidad ambiental mejoró y la contaminación desapareció de la zona…Los líquenes volvieron a aparecer sobre los abedules… y la situación volvió a cambiar… … De nuevo las mariposas blancas vuelven a ser mayoría!!
  • 174. Una especie es un grupo deindividuos naturales que se Las especiespueden cruzar entre sí y tenerdescendencia fértil pero nopueden hacerlo con individuosde otras especies.Cualquiera que sea el parecidoentre dos especies, si losapareamientos entre ellos noproduce descendientes (que es lomás habitual) o sólo producendescendientes estériles (como esel caso, por ejemplo, del cruceentre caballos y burros) podemosafirmar que pertenecen aespecies diferentes.