• Share
  • Email
  • Embed
  • Like
  • Save
  • Private Content
B I O I N F O R M A T I C S  An  Intro
 

B I O I N F O R M A T I C S An Intro

on

  • 1,000 views

 

Statistics

Views

Total Views
1,000
Views on SlideShare
1,000
Embed Views
0

Actions

Likes
0
Downloads
36
Comments
0

0 Embeds 0

No embeds

Accessibility

Categories

Upload Details

Uploaded via as Microsoft PowerPoint

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

    B I O I N F O R M A T I C S  An  Intro B I O I N F O R M A T I C S An Intro Presentation Transcript

    • Bioinformatics – an Introduction
    •  
    • “ Bioinformatics addresses problems related to the storage, retrieval and analysis of information about biological structure, sequence and function. - National Institute of Health Definition
    • Bioinformatics deals with
      • Design and implementation of new algorithms and statistics which assess relationship among members of large data sets.
      • Analysis and interpretation of various data types, which includes nucleotide and amino acid sequences and structure of protein.
      • To develop computational tools and databases that enables efficient analysis, access and management of biologically significant information.
    • Bioinformatics and Human Genome Project
      • The Human Genome Project is a 13-year effort coordinated by the U.S. Department of Energy and the National Institutes of Health.
      • The project budget was 3 billion and it was completed three years before the proposed time due to the technological advancements in biological data storage, management and analysis.
    • Necessary Skill Sets
      • Knowledge in Molecular Biology
      • Statistics
      • Mathematics (algorithm development)
      • Communicate biological problems to computer scientists
      • Working knowledge in bioinformatics tools
      • Computer proficiency (windows/command line)
      • Programming Skills
      • Data administration
    • Specialized fields
      • Computational Biology
      • Genomics
      • Proteomics
      • Bioprogramming
      • Cheminformatics
      • Structural Biology
      • Systems Biology
      • Pharmacogenomics
    • Applications
      • Sequence analysis and similarity searches
      • Protein structure prediction
      • Phylogenetics
      • Molecular docking
    • Sequence Analysis and Similarity Searches
      • Finding the (protein-coding) gene Sequence alignment Sequence Comparison and functional annotation Domain and pattern analysis
    • Finding the (protein-coding) gene? CCTGAGCCAACTATTGATGAA P E P T I D E CCU GAG CCA ACU AUU GAU GAA Protein mRNA DNA transcription translation
    • Pairwise Sequence Alignment
    • Multiple Sequence Alignment
    • Pfam analysis
    • Structure Prediction
    • Molecular Docking
    • Thanks You Mail: [email_address] Tel: +91-9884042119