Bioinformatics – an Introduction
 
“ Bioinformatics addresses problems related to the storage, retrieval and analysis of information about  biological struct...
Bioinformatics deals with <ul><li>Design and implementation of new algorithms and statistics which assess relationship amo...
Bioinformatics and Human Genome Project <ul><li>The Human Genome Project is a 13-year effort coordinated by the U.S. Depar...
Necessary Skill Sets <ul><li>Knowledge in Molecular Biology </li></ul><ul><li>Statistics </li></ul><ul><li>Mathematics (al...
Specialized fields <ul><li>Computational Biology </li></ul><ul><li>Genomics </li></ul><ul><li>Proteomics </li></ul><ul><li...
Applications <ul><li>Sequence analysis and similarity searches </li></ul><ul><li>Protein structure prediction </li></ul><u...
Sequence Analysis and Similarity Searches <ul><li>Finding the (protein-coding) gene  Sequence alignment  Sequence Comparis...
Finding the (protein-coding) gene?  CCTGAGCCAACTATTGATGAA P E P T I D E CCU GAG CCA ACU AUU GAU GAA Protein mRNA DNA trans...
Pairwise Sequence Alignment
Multiple Sequence Alignment
Pfam analysis
Structure Prediction
Molecular Docking
Thanks You Mail:  [email_address] Tel:  +91-9884042119
Upcoming SlideShare
Loading in …5
×

B I O I N F O R M A T I C S An Intro

1,093 views
1,025 views

Published on

Published in: Technology, Business
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
1,093
On SlideShare
0
From Embeds
0
Number of Embeds
1
Actions
Shares
0
Downloads
55
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

B I O I N F O R M A T I C S An Intro

  1. 1. Bioinformatics – an Introduction
  2. 3. “ Bioinformatics addresses problems related to the storage, retrieval and analysis of information about biological structure, sequence and function. - National Institute of Health Definition
  3. 4. Bioinformatics deals with <ul><li>Design and implementation of new algorithms and statistics which assess relationship among members of large data sets. </li></ul><ul><li>Analysis and interpretation of various data types, which includes nucleotide and amino acid sequences and structure of protein. </li></ul><ul><li>To develop computational tools and databases that enables efficient analysis, access and management of biologically significant information. </li></ul>
  4. 5. Bioinformatics and Human Genome Project <ul><li>The Human Genome Project is a 13-year effort coordinated by the U.S. Department of Energy and the National Institutes of Health. </li></ul><ul><li>The project budget was 3 billion and it was completed three years before the proposed time due to the technological advancements in biological data storage, management and analysis. </li></ul>
  5. 6. Necessary Skill Sets <ul><li>Knowledge in Molecular Biology </li></ul><ul><li>Statistics </li></ul><ul><li>Mathematics (algorithm development) </li></ul><ul><li>Communicate biological problems to computer scientists </li></ul><ul><li>Working knowledge in bioinformatics tools </li></ul><ul><li>Computer proficiency (windows/command line) </li></ul><ul><li>Programming Skills </li></ul><ul><li>Data administration </li></ul>
  6. 7. Specialized fields <ul><li>Computational Biology </li></ul><ul><li>Genomics </li></ul><ul><li>Proteomics </li></ul><ul><li>Bioprogramming </li></ul><ul><li>Cheminformatics </li></ul><ul><li>Structural Biology </li></ul><ul><li>Systems Biology </li></ul><ul><li>Pharmacogenomics </li></ul>
  7. 8. Applications <ul><li>Sequence analysis and similarity searches </li></ul><ul><li>Protein structure prediction </li></ul><ul><li>Phylogenetics </li></ul><ul><li>Molecular docking </li></ul>
  8. 9. Sequence Analysis and Similarity Searches <ul><li>Finding the (protein-coding) gene Sequence alignment Sequence Comparison and functional annotation Domain and pattern analysis </li></ul>
  9. 10. Finding the (protein-coding) gene? CCTGAGCCAACTATTGATGAA P E P T I D E CCU GAG CCA ACU AUU GAU GAA Protein mRNA DNA transcription translation
  10. 11. Pairwise Sequence Alignment
  11. 12. Multiple Sequence Alignment
  12. 13. Pfam analysis
  13. 14. Structure Prediction
  14. 15. Molecular Docking
  15. 16. Thanks You Mail: [email_address] Tel: +91-9884042119

×