Your SlideShare is downloading. ×
  • Like
The wheat genome sequence: a foundation for accelerating improvment of bread wheat
Upcoming SlideShare
Loading in...5
×

Thanks for flagging this SlideShare!

Oops! An error has occurred.

×

Now you can save presentations on your phone or tablet

Available for both IPhone and Android

Text the download link to your phone

Standard text messaging rates apply

The wheat genome sequence: a foundation for accelerating improvment of bread wheat

  • 2,902 views
Published

Catherine Feuillet, INRA

Catherine Feuillet, INRA

Published in Technology
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Be the first to comment
No Downloads

Views

Total Views
2,902
On SlideShare
0
From Embeds
0
Number of Embeds
0

Actions

Shares
Downloads
47
Comments
0
Likes
1

Embeds 0

No embeds

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
    No notes for slide

Transcript

  • 1. ACTTGTGCATAGCATGCAATGCCATATATAGCAGTCTGCTAAGTCTATAG The wheat genomeCAGACCCTCAACGTGGATCATCCGT sequence: a foundationAGCTAGCCATGACATTGATCCTGATTTACACCATGTACTATCGAGAGCAG for acceleratingTACTACCATGTTACGATCAAAGCCG improvement of breadTTACGATAGCATGAACTTGTGCATA wheatGCATGCAATGCCATATATAGCAGTCTGCTAAGTCTATAGCAGACCCTCAACGTGGATCATCCGTAGCTAGCCATGACATTGATCCTGATTTACACCATGTACTATCGAGAGCAGTACTACCATGT Catherine FeuilletTACGATCAAAGCCGTTACGATAGCATGAACTTGTGCATAGCATGCAATGC INRA Clermont-Ferrand, FranceCATATATAGCAGTCTGCTAAGTCTA Genetics, Diversity & Ecophysiology ofTAGCAGACCCTCAACGTGGATCATC CerealsCGTAGCTAGCCATGACATTGATCCTGATTTACACCATGTACTATCGAGAGCAGTACTACCATGTTACGATCAAAG BGRI 2012 Technical WorkshopCCGTTACGATAGCATGAACTTGTGC September 1-4, BeijingATAGCATGCAATGCCATATATAGCA  GTCTGCTAAGTCTATAGCAGACCCTCAACGTGGATCATCCGTAGCTAGCCATGACATTGATCCTGATTTACACCA
  • 2. The future is in an integrated toolbox-> expertise and critical mass Gene and QTLTraining, capacity building mapping Map-based cloning Candidate genes Perfect markers Allele mining Improved wheat varieties
  • 3. Genetics and genomics resources (early 2000)1. Genetic mapping • Molecular markers: low throughput RFLP and SSR ü  Wheat : 1634 RFLPs/2946 SSRs ü  ESTs : > 1 million of wheat ESTs / • Mapping populations: A few references with low marker coverage, numerous biparental populations of small sizes (100), a few specific high resolution F2/RILs for map-based cloning projects Marker assisted selection not broadly deployed, not cost efficient for most breeders2. Physical mapping • BAC libraries ü  Wheat : 1x ABD-genome (CS), 1x AB-genome, 1x A-genome, 1x D genome, Chromosome specific libraries: 3B, 1-4-6D • Physical maps: None (D genome Ae. tauschii, IWGSC chromosome based roadmap) Map-based cloning laborious and inefficient3. Genome sequence: None but…. NGS sequencing revolution opened perspectives
  • 4. Sequencing ConsortiumLaunched  in  2005  on  the  ini0a0ve  of  Kansas  Growers     23  Sponsors   Funding or Scientific ~  500  members   Contributors      40  countries   64  members,  22  countries   www.wheatgenome.org  
  • 5. An integrated and ordered wheat genome sequencePhenotyping Genetic mapping Physical mapping Sequencing
  • 6. The Breadwheat genome is……1.  Big: 17Gb (5 x human genome, 40 x rice…)2.  Polyploid: 2n= 42 = 6x 1 MYA T. urartu T. turgidumAe. speltoides (?) 8-10KYA T. aestivum Ae. tauschii3. Full of TEs (>90%)
  • 7. A chromosome-based approach Dissection of the genome to single chromosomes (arms) representing AA BB Sheath fluid individual (sub)genomesTriticum aestivum(2n = 6x = 42) Flow D Laser chamber1C ~ 17,000 Mbp Fluorescence emission B Excitation DD light A Deflection plates Scattered light ; Waste Doležel et al., Chromosome Res. 15: 51, 2007§  Chromosomes: 605 - 995 Mbp (3.6 – 5.9% of the genome)§  Chromosome arms: 225 - 585 Mbp (1.3 – 3.4% of the genome) •  Chromosome specific BAC libraries (End 2012) •  Amplified DNA for chromosome survey (June 2012) IEB
  • 8. Combined strategies to establish a wheat reference genome sequence Physical mapping of individual chromosomes Survey sequencing of MTP sequencing individual chromosomes Gene catalog Anchored and ordered sequence Virtual order Intergenic regions Markers Markers Short term Long term A reference sequence anchored to the genetic and phenotypic maps
  • 9. An international effort 1A   2A   3A   4A   5A   6A   7A   1B   2B   3B   4B   5B   6B   7B  1D   2D   3D   4D   5D   6D   7D   T.  aes/vum   cv    Chinese  Spring  
  • 10. Physical map of the 1Gb chromosome 3B chr 3B 1000 Mb Paux  et  al,  Science  2008;  Rustenholz  et  al,  Plant  Physiol  2011   1 283 contigs (average size = 749 kb) with FPC  961 Mb coverage (97% chromosome) ü 4367 molecular markers (SSRs, ISBPs,unigenes…) ü  Minimal Tiling Path (8448 clones)h8p://urgi.versailles.inra.fr/projects/Tri0cum/index.php  
  • 11. http://urgi.versailles.inra.fr/cgi-bin/gbrowse/wheat_FPC_pub/
  • 12. Combined strategies to establish a wheat reference genome sequence Physical mapping of individual chromosomes Survey sequencing of MTP sequencing individual chromosomes Gene catalog Anchored and ordered sequence Virtual order Intergenic regions Markers Markers Short term Long term A reference sequence anchored to the genetic and phenotypic maps
  • 13. Sequencing  Survey  IniPaPve   Assembly  of   gene  catalog   ComparaPve   Virtual  Gene   Amplified   ~50X  Survey   for  each   –  “Genome   Order  of  the  Sorted  DNA   sequence  of  all   chromosome Zipper”   21  Bread   individual     (IEB)   /arm   Wheat   chromosomes   (MIPS)     Chromosomes   (TGAC)    
  • 14. Chromosome Survey Sequencing Amplified DNA/sorted chromosomes IEB Illumina reads (2*108 bp/) PE 0.5 kb Min 50 x Assembly (ABySS) K-mer 71 Contigs > 200bp N50 = 2.4 kb • 1,526 genes average per short arm • 2,460 genes average per long arm • Total: 83,977
  • 15. Map your favorite gene in silico Ø  Anyone  can  register  to  get  a  login  and   password  through  signing  the  data  release   policy  agreement   Ø  Click  on  a  chromosome  to  have  access  to   the  survey  sequence  with  blast  search  and   viewers   Ø  BLAST  against  all  or  selected  surveys   Ø  Download  your  best  hit  sequences    http://urgi.versailles.inra.fr/Species/Wheat/Sequence-Repository
  • 16. An unlimited source of markers Low  copy  fracPon:  10%   RepePPve  fracPon:  90%   Gene  density:  1  /  104  kb   ISBP  density:  1  /  5  kb   Candidate  genes   Anonymous  markers   Paux  et  al  Plant  J  2006;  Plant    Biotech  J  2010  IWGSC  chromosome   X   Resequencing  4  European   arm  survey   wheat  elite  lines   (Premio,  Renan,  Robigus  and  Xi19)   sequences  
  • 17. An unlimited source of markers Gene-derived SNPs: 670,000 ISBP-derived SNPs: 3 millions Average gene density: 1 / 104 kb Average polymorphic ISBP density: 1 / 20 kb Average SNP density: 2.9 SNPs / gene Average SNP density: 1.8 SNPs / ISBP è Low density blocks of "candidate" SNPs è High density isolated anonymous SNPs Intergenic region-derived SNPs: 2,1 Millions variable density Average SNP density: 2.2 SNPs / kb è Low density blocks of anonymous SNPsAnd integration of 12’175 ESTs, 1181 DArTs, 38’905 GBS and 7000 gene SNPs from the 9K infinium array
  • 18. Combined strategies to establish a wheat reference genome sequence Physical mapping of individual chromosomes Survey sequencing of MTP sequencing individual chromosomes Gene catalog Anchored and ordered sequence Virtual order Intergenic regions Markers Markers Short term Long term A reference sequence anchored to the genetic and phenotypic maps
  • 19. 3B SEQuencing Project (1Gb)Chr 3B physical map 1282 BAC-contigs Sorted chr. 3B 8448 BACs Pool of 10 BACs (Roche 454 GSFLX Titanium, 8 Kb MP) 922 pools BAC pool Illumina (82X) 454 scaffolds Sanger Illumina contigs BAC-ends (2*108 bp) (2*600 bp) PE 0.5 kb Super-scaffolds ü Annotation (TriAnnot) ü Anchoring/orientation (ISBP SNPs) ü Resequencing and polymorphisms analyses ü Transcription map (15 RNASeq)
  • 20. 3B sequence automated annotation RNASeq data from 15 Assembly v2 samples •   5109  scaffolds   •   995  Mb • N50  =  463  Kb  (Max   Leroy et al, Frontiers in Plant Science 2012) 1,6  Mb) 7975  non  redundant     genes  with  expression  profiles  
  • 21. An integrated and ordered wheat genome sequencePhenotyping Genetic mapping Physical mapping Sequencing
  • 22. An integrated and ordered wheat genome sequenceØ Integration of all known markers into the ordered sequence RFL DAr AFL Other SSR ISBP SNP SFP GBS STS Tot. P T P sNb 348 99 88 373 114 790 108 30 4 19 1973Se 293 40 88 373 114 96 108 0 0 0 1112qØ  3B  consensus  map  (coll  with  wheat  community)   •  Cs  x  Re  as  reference  map  (335  markers)   •  10  addiDonal  maps  (>200  populaDons)   •  1973  markers  (1112  with  sequence  info)   •  metaQTL  analysis  underway  
  • 23. 3B physical map and sequence utilization•  40 genes and QTL mapped on 3B....Ø  13 map-based cloning projects underway using 3B resources ü  Disease resistance genes (Sr, Lr, Yr, Stb…) ü  Solid stem (saw fly) ü  Yield ü  Drought tolerance ü  Boron transporter ü  Flowering time ü  NUE ü  Chromosome pairing… -> 343 scaffolds accounting for 29 Mb targeting 74 BAC- contigs sequences provided to collaborators
  • 24. Map-based cloning 1-2 CM A   C E D B   7-­‐8  years  C D E E YFG D A   C E D B   1-­‐3  years   C E YFG D
  • 25. R locus: a multiple disease resistance region R locus Sn2 Stagonospora nodorum 20 Mb Sr2 Puccinia graminis Sv2 Puccinia triticina Stb2 Septoria tritici Fhb1 Fusarium graminearum Yr Puccinia striiformis 3B
  • 26. Map-based cloning of LrSv2 Leaf  rust,  incited  by  the  biotrophic  fungus   Puccinia  tri/cina,  is  one  of  the  most  important   diseases  of  wheat  worldwide,  causing  annual   yield  losses  of  about  5-­‐10%  in  ArgenDna  Some  South  American  varieDes  as  La  prevision    13,  Pergamino  Gaboto,  Sinvalocho  MA,  Buck  MananDal,  Buck  Poncho  and  El  Gaucho  FA,  among  others,  showed  durable  resistance  In   Sinvalocho,   the   seedling   resistance   Lr3   in   6BL   and   two   adult   plant   resistance   genes,  LrSV1  in  2DS  and  LrSV2  in  3BS,  were  idenDfied   María  José  Diéguez     LrSV2:  dominant      race-­‐specific      Adult  Plant  Resistance  (APR)      subtelomeric  3BS  
  • 27. 3BS physical (Kb) 3BS genetic (cM) cross 0 swm13 cfb3417 swm 50•  2 physical contigs (ctg 11 and 10 0 15 0344 of >1 Mb ) identified with 20 0 25 0markers flanking SV2 30 0 wmm1104 wm 35 0 cfp1410 cfp1 40 0 45 0 0.88 cM 50 0•  48 new markers developped and 55 0 cfb5008 cfb5021 cfb5 cfb5 cfb5018 cfb5tested on parents and populations 60 0 65 0 FMO cfb5006 FMO cfb5 cfb5009 cfb5 70 0 cfb5023 cfb5•  15 new markers at the SV2 75 0 80 0 nw1821 gpw7080 SCAR 40/42 nw1 gpw SCAlocus 85 0 cfb5000 cfb5007 cfb5010 swm13 cfb5 cfb5 cfb5 90 0 cfb5025 cfb5 cfb5026 cfb5 95 0 cfb5015 0.22 cM cfb5010 cfb5 10 00 cfb5011 SV2 cfb5 cfb5013 wmm1 104-cfp 41 cfb5 10 50 cfp5222 0.04 cM cfp37 cfp5•  a high resolution genetic map 11 00 cfb5019 cfb5061 ger9 cfb5 cfb5 ger9 11 50Sinvalocho x G6 (1308 F2s = 2616 12 00 Sr 2-CA PS D10F-C5 csSr 2RK 0.26 cM Sr2 D10 csSgametes) 12 50 13 00 CoA cfb5014 gwm533 stm559 CoA cfb5 cfb5060 cfb5 stm560 13 50•  Crossover detection Sinvalocho x 14 00G6 (3403 F2s = 6806 gametes) 14 50 15 00 cfp41 cfp4 15 50 cfp37 cfp3 16 00 16 50 17 00 cfp5231 cfp5 17 50 cfp5243 cfp5 18 00 18 50 gwm533 gwm
  • 28. IWGSC MTP sequencing www.wheatgenome.org  
  • 29. Some challenges remain….. Polygenic traits Sequencing Genotyping PhenotypingMonogenic traits
  • 30. Acknowledgments K. Eversole (Eversole Associates)Frédéric Choulet Adriana Alberti Michael AlauxEtienne Paux Institute of Experimental Botany Julie Poulain Hadi Quenesville Jaroslav DolezelPierre Sourdille Hana Simkova Arnaud Couloux Jan BartosPhilippe Leroy Jan Safar Valérie BarbeNicolas Guilhot Patrick Wincker J. WrightSébastien Theil M. Caccamo J. RogersLise PingaultJosquin Daron K. Mayer M. MartisNatasha GloverDelphine Boyer María José DiéguezCatherine Feuillet Nanda Pergolesi