Bloc 1. presentació t3. creacionisme o evolució. teories
Upcoming SlideShare
Loading in...5
×
 

Bloc 1. presentació t3. creacionisme o evolució. teories

on

  • 3,903 views

 

Statistics

Views

Total Views
3,903
Views on SlideShare
2,569
Embed Views
1,334

Actions

Likes
2
Downloads
37
Comments
0

3 Embeds 1,334

http://cienciesperalmoncontemporanibio.blogspot.com 1288
http://cienciesperalmoncontemporanibio.blogspot.com.es 40
http://www.cienciesperalmoncontemporanibio.blogspot.com 6

Accessibility

Categories

Upload Details

Uploaded via as Microsoft PowerPoint

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

    Bloc 1. presentació t3. creacionisme o evolució. teories Bloc 1. presentació t3. creacionisme o evolució. teories Presentation Transcript

    • UNITAT 3 PER QUÈ ELS ÉSSERS VIUS SÓN COM SON? EVOLUCIÓ O CREACIÓ. ORIGEN DE LA VIDA
    • BIODIVERSIDAD Teoria fixista/creacionista Teoria de l’evolució Teoria del disseny intel·ligent Variabilitat Selecció natural Fòssils Origen de la vida
    • Plantejament del problema
      • Una de les principals característiques dels éssers vius és la diversitat. La vida es manifesta en multitud d’éssers vius:
        • Que tenen dimensions diferents: microscòpics i macroscòpics.
        • Que viuen en ambients diferents: aigua i terra.
        • Que tenen formes diferents: allargats, arrodonits, sense forma definida…
    • Saps què és la BIODIVERSITAT?
    • ACTIVITAT 1
      • Parlar d’evoluació sempre ha creat controvèrsia, per què????
    • PROBLEMES
      • El problema de l’origen i evolució de la vida és un problema difícil de resoldre i de gran rellevància
        • CIENTÍFICA
        • FILOSÒFICA
        • RELIGIOSA
    • EVOLUCIONISME O CREACIONISME, QUÈ S’HA D’ENSENYAR A LES ESCOLES?
    • El origen de la vida Según la mayoría de las religiones, la vida tiene un origen sobrenatural en el que no intervienen reacciones físico-químicas de ningún tipo, ya que todo lo que existe ha sido creado por uno o varios dioses. Esta tesis recibe el nombre de creacionismo . Por su parte, los científicos han aportado a lo largo de la historia diferentes explicaciones acerca del origen de los seres vivos. 1
    • QUÈ DIU LA TEORIA CREACIONISTA (DISSENY INTEL·LIGENT)?
    • LA GÈNESI
      • “ En el principio Dios creó el cielo y la tierra. La tierra estaba sin forma y vacía, y la tiniebla estaba sobre la faz del abismo; y el espíritu Santo se cernía sobre la faz de las aguas”.
    • TEORIA CREACIONISTA
      • - Immutabilitat dels éssers vius
      • - Disseny
      • - Antropocentrisme
    • CREACIONISME
      • El creacionisme defensa la idea qu e els éssers vius varen ser creats per Déu en un únic acte creador i per separat
    • SET DIES DE LA CREACIÓ
      • El primer dia es va crear la llum.
      • Durant el segon dia va crear el firmament.
      • El tercer dia va separar les aigües de la terra i van aparèixer les plantes.
      • El quart dia va crear les estacions.
      • El cinquè va crear les criatures del mar i les aus.
      • El sisè va crear els animals i l’home.
      • El setè va descansar.
    • IMMUTABILITAT DE LES ESPÈCIES
      • Els organismes no han canviat al llarg del temps.
      • Els organismes són talment com varen ser creats
    • DISSENY
    • DISSENY DELS ORGANISMES
      • Déu va crear tots els organismes amb la forma i estructura més adequada per poder viure en un determinat medi
    • DILUVI UNIVERSAL?????
    • QUÈ DIU LA TEORIA DE L’EVOLUCIÓ?
    • QUÈ SON ELS FÒSSILS?
      • S’anomena fòssil als restes de plantes o animals, o als restes de la seva activitat (pistes, galeries, excrements) que s’ han conservat en els sediments.
    • PROBLEMES FÒSSILS QUÈ SÓN? COM ES FORMEN? PROVENEN D’ÉSSERS VIUS EXTINGITS? ON ES TROBEN?
    • ROBERT HOOKE
    • ROBERT HOOKE En 1665 va publicar el llibre Micrographia , relat de 50 observacions microscòpiques i telescòpiques amb dibuixos detallats. Asquest llibre conté per primera vegada la paraula cèl·lula on s’apunta una explicació possible sobre els fòssils. Hooke va descobrir les cèl·lules observant amb el microscopio una llàmina de suro.
    • ACTIVITAT 4
      • Hooke , per altra banda, va estudiar un conjunt de copinyes fòssils conegudes com ammonites. Un segle abans havien rebut el nom, Ammonis cornu (en llatí, banyes de moltó) per la seva forma en espiral. Hooke va poder classificar els ammonites i va poder comprovar que formaven part del mateix grup d’éssers vius.
      • Ara bé, una vegada establert que aquests fòssils eren restes d’organismes vius, es va planteja una pregunta...
    • ROBERT HOOKE
      • AMMONITES (Ammonis cornu, banyes)
    • ROBERT HOOKE
      • De l’estudi dels fòssils va concluir que eren restes d’éssers vius que havien viscut temps enrera .
      • Els fòssils eren restes petrificats d’organismes vius.
    • ROBERT HOOKE
      • Hooke es va plantejar el següent problema:
      • “ Si els ammonites són restes d’animals marins com és que es troben terra endins i fins i tot a les muntanyes, dins les roques?”
      • La resposta que va donar Hooke va ser: “La Terra ha sofert canvis des de la seva creació”
    • STENO Carcharodon megalodon Les dents són en molts aspectes semblants als del tauró blanc actual ( Carcharodon carcharias ),
    • STENO
      • Va veure que uns objectes molt populars “pedres linguals” eren molt semblants a les dents de tauró.
      • Els fòssils es troben entre sediments que es formen dins l’aigua
      • Els sediments es troben estratificats
      • Els estrats no es formen a la vegada sinó successivament.
      • Els estrats que estan més amunt s’han format després que el de davall
      • La Terra té una història
    • ESTRATIFICACIÓ La LLEI de SUPERPOSICIÓ DE STENO diu que les capes de les roques s’ordenen en una seqüència temporal amb la més antigua en el fons i la més jove a la superfície excepte que per procesos posteriors s’alteri aquest ordre. Aquest és la contribució més important a la Geologia de Steno.
    • PROBLEMES DEL CREACIONISME
      • Fòssils d’éssers vius extingits.
      • La Terra té una història
      QUÈ DIU LA BÍBLIA?
    • DILUVI UNIVERSAL
    • EL DILUVI UNIVERSAL
      • Segons la Gènesi a l’Arca de Noé s’havien ficat una parella de cada tipus d’animal.
      • Una vegada el nivell de l’aigua hagués baixat, els animals retornaren al seu lloc.
    • QUÈ DIU LA TEORIA DE L’EVOLUCIÓ DE DARWIN -WALLACE?
    • Un origen común a pesar de la variedad 2.1.- Fijismo y evolucionismo Fijistas Explicaban la desaparición de especies antiguas por catástrofes naturales que eran ordenadas por Dios. Eran catastrofistas y creacionistas. Los fósiles se explican porque los antiguos seres se extinguieron para dejar paso a nuevas formas de vida que surgieron a partir de las anteriores. El Mamut y otras criaturas se habrían extinguido por no haberse salvado del Diluvio en el Arca de Noé Evolucionistas 2
    • Un origen común a pesar de la variedad 2.1.- Fijismo y evolucionismo A lo largo del siglo XIX, la comunidad científica asistió al enfrentamiento entre los defensores y detractores de las teorías evolucionistas, que trascendió el ámbito de la mera especulación científica y suscitó furibundos ataques por parte de los estamentos eclesiásticos, para los que la idea de la evolución representaba una grave amenaza a las creencias más profundamente arraigadas. Caricaturas contra Darwin como esta intentaban ridiculizar sus ideas incluso insultándolo personalmente. Las ideas evolucionistas chocaban con las ideas religiosas que el propio Darwin tenía. 2
    • Un origen común a pesar de la variedad 2.1.- Fijismo y evolucionismo Fijistas Evolucionistas Los seres vivos son distintos porque han sido creados distintos, sin relaciones de parentesco. Los seres vivos son distintos porque evolucionan, pero mantienen relaciones de parentesco. Esto quiere decir que tienen un origen común, más o menos lejanos en el tiempo. Ciervo Gamo Elefante africano Elefante asiático 2
    • ¿Por qué se parecen tanto entre sí? ¿Por qué se parecen tanto entre sí?
    • ¿Por qué se parecen tanto entre sí? ¿Por qué se parecen tanto entre sí?
    • ¿Por qué se parecen tanto entre sí? ¿Por qué se parecen tanto entre sí?
    • ¿Por qué se parecen tanto entre sí? ¿Por qué se parecen tanto entre sí?
    • ¿Por qué se parecen tanto entre sí? ¿Por qué se parecen tanto entre sí?
    • ¿Por qué se parecen tanto entre sí? ¿Por qué se parecen tanto entre sí?
    • Las semejanzas entre los seres vivos se deben a las relaciones de parentesco entre ellos, por lo que serán más parecidos cuanto más cercano en el tiempo se encuentre un antepasado común . Antepasado común Antepasado común Ciervo Gamo Elefante asiático Elefante africano Ejemplos El descubrimiento y estudio de los fósiles estimulaba las ideas evolucionistas Presente Pasado Línea del tiempo
    • Cánidos Félidos Ancestro común de los cánidos Ancestro común de hienas y osos Ancestro común Hiénidos Úrsidos Ejemplos Ancestro común de los félidos Ancestro = Antepasado Presente Pasado Línea del tiempo
    • ORIGEN SEPARAT ORIGEN COMÚ IMMUTABILITAT CANVI DISSENY ADAPTACIÓ ANTROPOCENTRISME UNA ESPÈCIE MÉS
    • Teorías evolutivas 3.1.- Lamarckismo 3.2.- Darwinismo: Darwin y Wallace 3.3.- Neodarwinismo o Teoría sintética Durante la gestación de la teoría de la evolución a partir de un antepasado común se formularon diversas hipótesis para explicar las causas que originaron el cambio en los seres vivos, es decir, para determinar qué factores provocan la formación de nuevas especies y la aparición de nuevos tipos de organización. Veamos a continuación cada una de las hipótesis: 3
    • TEORIES EVOLUCIONISTES LAMARCK DARWIN WALLACE
    • Teorías evolutivas 3.1.- Lamarckismo (1744 – 1829) Jean Baptiste de Monet , caballero de Lamarck, naturalista francés. En 1809 publicó Philosophie zoologique , donde expuso las primeras ideas razonadas sobre la evolución. Sus ideas no fueron aceptadas. Lamarck pensaba que las especies cambiaban evolucionando, para adaptarse a sus necesidades, aumentando así poco a poco la complejidad de los organismos vivos. Por ejemplo, el ancestro de la actual jirafa se adaptó estirando cada vez más su cuello, generación tras generación, para poder llegar a las ramas más altas . 3 Lamarck
    • 3.1.- Lamarckismo Esforzándose y usándolo, este animal lograría desarrollar su cuello. Y después lograría transmitir eso a sus hijos. Según Lamarck, las modificaciones en el entorno de una especie genera nuevas necesidades, en respuesta a las cuales los seres vivos se ven obligados a utilizar un determinado órgano determinado: “ La función hace el órgano ”, en palabras del propio Lamarck. El uso continuado del mismo lo fortalece y desarrolla, mientras que el no usarlo determina su atrofia y desaparición (“ ley del uso y desuso ”).
    • Teorías evolutivas 3.1.- Lamarckismo (1744 – 1829) Jean Baptiste de Monet , caballero de Lamarck, naturalista francés. En 1809 publicó Philosophie zoologique , donde expuso las primeras ideas razonadas sobre la evolución. Sus ideas no fueron aceptadas.
      • La premisa central de su hipótesis giraba en torno a dos ideas fundamentales:
      • La influencia del medio en el que se desarrollan las especies determinan los cambios de estas.
      • Dichos cambios son hereditarios , es decir, serán transmitidos a la descendencia.
      Cráneo y vértebras cervicales de jirafa 3 Lamarck
    • 3.1.- Lamarckismo El uso de los cuernos provocaría su desarrollo. El gran desarrollo de las patas posteriores de algunos animales se debería a su gran uso. El kiwi habría atrofiado sus alas por no usarlas. Según Lamarck, las modificaciones en el entorno de una especie genera nuevas necesidades, en respuesta a las cuales los seres vivos se ven obligados a utilizar un determinado órgano determinado: “ La función hace el órgano ”, en palabras del propio Lamarck. El uso continuado del mismo lo fortalece y desarrolla, mientras que el no usarlo determina su atrofia y desaparición (“ ley del uso y desuso ”).
    • 3.1.- Lamarckismo Esta hipótesis es totalmente inadmisible hoy día por la Genética, pues se sabe que los caracteres adquiridos (como, por ejemplo, el aumento de la masa muscular por el ejercicio o ponerse moreno cuando se toma el sol) no se transmiten a la descendencia , pues no afectan al material genético. Según Lamarck, las modificaciones en el entorno de una especie genera nuevas necesidades, en respuesta a las cuales los seres vivos se ven obligados a utilizar un determinado órgano determinado: “ La función hace el órgano ”, en palabras del propio Lamarck. El uso continuado del mismo lo fortalece y desarrolla, mientras que el no usarlo determina su atrofia y desaparición (“ ley del uso y desuso ”).
    • L’EVOLUCIÓ SEGONS LAMARCK
      • Les espècies no són fixes sinó que procedeixen unes de les altres per transformació.
      • La transformació es produeix com a resposta adaptativa als canvis ambientals .
    • L’EVOLUCIÓ SEGONS LAMARCK 1.- Canvis al medi ambient 2.- Els individus d’una espècie s’esforcen en adaptar-se 3.- Alguns òrgans es transformen poc a poc 4.- Les noves característiques s’hereden
    • ALFRED RUSSEL WALLACE (1823- 1913) Era explorador i zoòleg. Va descobrir mils d’espècies tropicals. Autor de llibres de viatges. Va ser el primer que va estudiar els simis en llibertat. Al 1858 va escriure un article “Sobre la tendència de les varietats a divergir indefinidament del tipus original” en el que formulava la teoria de l’evolució
    • Teorías evolutivas 3.2.- Darwinismo 1.- La lucha por la existencia 2.- La variabilidad intraespecífica 3.- La selección natural Veamos estos conceptos… Las ideas de Darwin se resumen en 3 conceptos: La selección natural tiende a promover la supervivencia de los más aptos. Esta teoría revolucionaria se publicó en 1859 en el famoso tratado El origen de las especies por medio de la selección natural . Charles Darwin (1809 – 1882) 3
    • Son muchos los que nacen… ¿Cómo van evolucionando los seres vivos? Dentro de cada especie hay variedad en las características. Los individuos no son idénticos entre sí. Nacen con diferencias entre ellos, es decir, hay una variabilidad intraespecífica (dentro de la especie) Nacen más individuos de los que son capaces de sobrevivir en un medio con recursos limitados.
    • Son muchos los que nacen… Pero… Algunos no encuentran suficiente alimento o sufren enfermedades y mueren Otros son la presa de algún depredador Hay una lucha por la existencia
    • Algunos no encuentran pareja o no consiguen reproducirse por algún motivo Son muchos los que nacen… Pero… Hay una lucha por la existencia y por la reproducción
    • los que han nacido con características que les permiten adaptarse mejor a su medio. Pero… Sólo sobreviven unos pocos: Son muchos los que nacen…
    • Sólo sobreviven unos pocos La Selección Natural ha eliminado a los que nacieron con características menos apropiadas para la supervivencia. Los que sobreviven transmiten a sus hijos esas características que precisamente les ayudaron a sobrevivir mejor en su medio.
    • A diferencia de Lamarck, Darwin pensaba que nacían jirafas con cuellos más largos o más cortos. Sobrevivirían sólo aquellas que habían heredado un cuello suficientemente largo. 2.- Hay una lucha por la existencia 1 2 3 1.- Hay una variabilidad intraespecífica 3.- Ha actuado la selección natural Las especies evolucionan, pero no como decía Lamarck
    • Las jirafas desarrollan un cuello largo por esforzarse y usarlo mucho para coger su alimento Lamarck Darwin Compara las dos teorías y reflexiona Hay una variabilidad dentro de la especie: algunas nacen con el cuello más largo. La Selección Natural se encarga de eliminar las de cuello corto. El cuello largo se va extendiendo en la especie Transmiten a los hijos un cuello más largo Usan mucho su cuello Transmiten a los hijos un cuello más largo Sólo sobreviven y se reproducen las de cuello más largo Luchan por la supervivencia Luchan por la supervivencia Presente Pasado Línea del tiempo
    • Reflexiona: ¿Cómo ha llevado la evolución a que este insecto parezca una hoja… … según la teoría de Lamarck? … según la teoría de Darwin? Phyllium giganteum ¿Y en el caso de esta oruga que parece una rama?
    • Darwin estaba muy interesado en cómo los agricultores, ganaderos y criadores de animales conseguían obtener y mejorar diferentes razas ?
    • El viaje del Beagle . Tras graduarse en Cambridge en 1831, el joven Darwin se enroló a los 22 años en el barco de reconocimiento HMS Beagle como naturalista sin paga, para emprender una expedición científica alrededor del mundo.
    • La expedición duró cinco años y recogió datos hidrográficos, geológicos y meteorológicos en Sudamérica y otros muchos lugares. Las observaciones de zoología y botánica de Darwin le llevaron a desarrollar la teoría de la selección natural. La asombrosa fauna de las Islas Galápagos dio mucho que pensar a Darwin Cormorán con alas atrofiadas Iguana Tortugas gigantes Varias especies de pinzones Clic aquí para ver vídeo
    • Darwin no pensaba que el hombre descendiese de ningún “mono” actual, sino que el hombre y otros primates descendían todos de antepasados comunes. Del “mono” no . Su teoría sobre la evolución del hombre fue groseramente malinterpretada y encontró mucha oposición. Los ataques a las ideas de Darwin que encontraron mayor eco no provenían de sus contrincantes científicos, sino de sus oponentes religiosos. Muchos atacaron a Darwin sin haber leído su libro ni conocer a fondo sus argumentos e ideas. La idea de que los seres vivos habían evolucionado por procesos naturales negaba la creación divina del hombre y parecía colocarlo al mismo nivel que los animales. Ambas ideas representaban una grave amenaza para la teología ortodoxa.
    • Orangután Gorila Chimpancé Ser humano Antepasado común Darwin pensaba que el ser humano no procede de ningún primate actual. Pero sí creía que tenemos antepasados comunes con ellos. ? ? En tiempos de Darwin no se conocían fósiles de antepasados humanos
    • Orangután Gorila Chimpancé Ser humano ? ? 117 Darwin fue atacado porque no se conocían estos “eslabones perdidos” de la cadena de la evolución humana Pero la ciencia moderna conoce muchos eslabones de esta cadena Australopithecus Procónsul (hace 20 millones de años) (hace 5 millones de años)
    • Australopithecus afarensis La moderna Antropología conoce muchos más detalles de la evolución humana de lo que la gente piensa
    • La moderna Antropología conoce muchos más detalles de la evolución humana de lo que la gente piensa Homo erectus
    • Homo ergaster Homo erectus Australopithecus boisei Homo antecesor Homo sapiens Homo heidelbergensis Homo neardenthalensis Australopithecus afarensis En el árbol de la evolución que condujo hasta nosotros, algunas ramas, como el Neardenthal, se extinguieron
    • DARWIN (1809- 1882) Biòleg britànic va donar les bases de la moderna teoria de l’ evolución, al plantejar el concepte d’evolució de les espècies através d’un lent i continu procés de SELECCIÓ NATURAL . 1831 , Darwin va embarcar com naturalista (sense sou), als 22 anys, al vaixell HMS Beagle , per emprendre una expedició científica al voltant del món i que va durar 5 anys. Després, al tornar a Anglaterrra va dedicar 20 anys a elaborar LA TEORIA SELECCIÓ NATURAL
    • VARIABILITAT
    • TEORIA SINTÈTICA DE L’EVOLUCIÓ
      • Una espècie es pot definir com a un conjunt de gens.
      • En les poblacions es produeixen constantment canvis accidentals en el material genètic, és a dir, mutacions.
      • La majoria de mutacions són letals o desfavorables
    • TEORIA SINTÈTICA DE L’EVOLUCIÓ
      • Els individus amb mutacions desfavorables tindran una descendència menys nombrosa al llarg de les generacions i, fins i tot poden desaparèixer.
      • En canvi, les mutacions favorables permetran al portador viure millor i deixar més descendència que heredarà les característiques favorables.
      • Amb el temps les poblacions estaran formades per individus que presenten les característiques més favorables.
    • Biston betularia
      • La forma typica de B. betularia està més camuflada que carbonaria sobre els troncs coberts de líquens a les regions no contaminades, mentre que carbonaria està més camuflada a les regions industrials en les que els troncs han perdut els líquens i s’han ennegrit per la contaminació atmosfèrica.
    •  
    •  
    • Teorías evolutivas 3.3.- Neodarwinismo o Teoría ……. Sintética de la Evolución Ninguno de los científicos que apostaban por las teorías evolucionistas conocía la existencia de los genes ni de las mutaciones, pero ya entonces intuían que los cambios ocurridos en los individuos de una especie “se transmitían” a los descendientes. Darwin no sabía explicar cómo se transmiten los caracteres hereditarios. En sus tiempos no se conocían los cromosomas, ni mucho menos el ADN. Las Leyes de Mendel se desconocían cuando Darwin publicó su teoría. 3
    • Teorías evolutivas 3.3.- Neodarwinismo o Teoría ……. Sintética de la Evolución La Biología moderna explica el hecho evolutivo sumando a las ideas de Darwin las Leyes de Mendel y los conocimientos de la moderna Genética. Por fin quedaba resuelto el misterio del modo de transmitirse los caracteres hereditarios. El descubrimiento de las leyes de la herencia y del material genético permitía explicar aquello que los científicos contrarios a Darwin más le criticaron. Ningún científico niega hoy día el hecho evolutivo El origen de las especies de Darwin se publicó en 1859, antes de los trabajos de Mendel. 3 Darwin Mendel Genética Moderna + + = Neodarwinismo o Teoría Sintética de la Evolución
    • Teorías evolutivas 3.3.- Neodarwinismo o Teoría Sintética de la Evolución La recombinación genética que ocurre en la meiosis y la reproducción sexual producen la variabilidad intraespecífica de la que hablaba Darwin La Selección Natural sigue admitiéndose como el principal “motor” de la Evolución. La Selección Natural “escoge” dentro de la variabilidad. Papá pato conoce a mamá pata… … mamá pata puso huevos en el nido… … y tuvieron hermosos patitos. Pero no habrá una oportunidad para “el patito feo”: la Selección Natural acabará con él. El pato malvasía bucea para obtener alimento del fondo de lagunas 3
    • Teorías evolutivas 3.3.- Neodarwinismo o Teoría Sintética de la Evolución Como ya sabes, a veces se producen errores en la duplicación del ADN, dando lugar a genes alterados, distintos al original. Son las MUTACIONES . Las mutaciones son la fuente original de la variabilidad. La meiosis y la reproducción sexual son fuentes añadidas de variabilidad. Algunas mutaciones provocan la muerte, pero otras, en sí, no son “buenas” ni “malas”: todo dependerá del medio donde vive la especie. 3 ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG ATTCGCGGCATTAATCCGATACCTAGGACCGCGGATTTAAACATGGATC TAAGCGCCGTAATTAGGCTATGGATCCTGGCGCCTAAATTTGTACCTAG Doble cadena de ADN sin mutar Doble cadena de ADN con mutación Mutación Variabilidad dentro de la especie Eriopis eschscholtzi
    • Teorías evolutivas 3.3.- Neodarwinismo o Teoría Sintética de la Evolución Las mutaciones, la recombinación genética en la meiosis, y la combinación de gametos en la reproducción sexual ocurren aleatoriamente (al azar) El número de combinaciones posibles de alelos de genes en una especie es elevadísimo (“casi infinito”). ¿Sabrías calcular el número de combinaciones posibles de figuras de dados tirando cinco de ellos?. 3
    • Teorías evolutivas 3.3.- Neodarwinismo o Teoría Sintética de la Evolución La naturaleza arroja sus dados y nacen animales más claros, más oscuros… Dependiendo del medio, un color u otro será “mejor” o “peor” En este medio, los ratones de fenotipo oscuro sobreviven con más probabilidad En este medio, los ratones de fenotipo claro sobreviven con más probabilidad Búho nival Búho “normal” Con el tiempo, en esta población de ratones, aumenta la frecuencia de genes que determinan el fenotipo claro 3
    • ESTÀ PROVADA LA TEORIA DE L’EVOLUCIÓ?
    • PROVES
      • No hi ha cap teoria científica que estigui provada del tot.
      • Ara bé, hi ha teories més provades que altres.
      • És el cas de la teoria de l’evolució i la teoria creacionista.
      • Hi ha molts fets que s’expliquen millor des d’una òptica evolucionista que des de la creacionista.
    • EVIDÈNCIES DE L’EVOLUCIÓ
      • Morfològiques i anatòmiques: individus emparentats comparteixen semblances anatòmiques
      • Organització cel·lular: tots els éssers vius estan formats per cèl·lules (procariotes o eucariotes)
      • Biogeogràfiques:
      • Paleontologiques: estudi dels fòssils
      • Embriologiques: la semblança dels embrions durant les primeres fases permet suposar l’existència d’avantpassat comú.
      • Bioquímiques
    • Pruebas de la evolución 4.1.- Pruebas morfológicas 4.2.- Pruebas biogeográficas 4.3.- Pruebas paleontológicas 4.4.- Pruebas embriológicas 4.5.- Pruebas bioquímicas 4
    • 1. ANATOMIA COMPARADA
      • La comparació de la forma corporal i l’anatomia interna dels organismes ha permès establir relacions entre diferents espècies a partir de la suposició que provenen d’una altra espècie ancestral respecte a la qual han anat variant a mesura que s’anaven adaptant a diferents condicions.
    • PROVES DE ANATOMIA COMPARADA ÒRGANS HOMÒLEGS I ANÀLEGS Húmer Cúbit Radi Humà Tòrtora Mosca
    • ÒRGANS HOMÒLEGS Les potes i les ales dels vertebrats, són òrgans homòlegs , és a dir, òrgans amb funcions diferents però amb una estructura anatòmica que denota un origen comú. L’avantpassat EUSTHENOPTERON (peix que va viure fa 385 milions d’anys) Húmer Cúbit Radi
    •  
      • Órgans anàlegs són els òrgans que fan una mateixa funció, però presenten estructures diferents, per això no presenten un alt grau de parentesc.
      • En realitat, aquests dos animals, segons la teoria de l’evolució, provenen d’avanpasstas molts distints. El parescut es degut a que els dos s’ han adaptat al vol i per això, desenvoluparan ales en el seu procés evolutiu.
      • En casos com aquest es parla d’EVOLUCIÓ CONVERGENT.
      ÒRGANS ANÀLEGS Ex. Les ales d’una mosca i ales d’una tòrtora.
    •  
    •  
    • 2. ORGANITZACIÓ CEL·LULAR
    •  
    • FILOGÈNIA                                                               
    • PROVES PALEONTOLÒGIQUES
    • PROVES PALEONTOLÒGIQUES
    • 6. PROVES EMBRIOLÒGIQUES
      • En els vertebrats, sobretot, s’ha observat que al llarg del desenvolupament embrionari es produeixen fases amb notables semblances morfològiques entre grups d’animals diferents.
    • PROVES EMBRIOLÒGIQUES
    • 7. PROVES BIOQUÍMIQUES
      • Les proves més recents i les que majors possibilitats presenten, consisteixen en comparar certes molècules (proteïnes i ADN) que apareixen en tots els éssers vius de tal manera que aquestes molècules són tan
      • més parescudes quant menors diferències evolutives hi ha entre els seus portadors.
      Tots els organismes estam compostos pels mateix tipus de substàncies químiques. Tots els organismes tenim ADN com a material genètic.
    •  
    •  
    •  
    • Tema 6. Evolución Una de las tortugas gigantes de las Islas Galápagos
    • Tema 6. Evolución Otra especie de tortuga de las Islas Galápagos
    • I.E.S. Suel – Fuengirola - Departamento de Ciencias Naturales Tema 6. Evolución Iguana marina de las Islas Galápagos
    • I.E.S. Suel – Fuengirola - Departamento de Ciencias Naturales Tema 6. Evolución Iguana marina de las Islas Galápagos
    • ¿Es cierto que venimos del mono?
    • ¿De dónde venimos?
    • Charles Darwin (1809 – 1882), el “padre” de la Teoría de la Evolución por Selección Natural Clic aquí para ver vídeo de la vida de Darwin
    • El origen de la vida ¿Cómo se originó la vida? Creación de Adán (Miguel Ángel, Capilla Sixtina) 1
    • ¿Cómo han surgido los seres vivos que nos rodean? ¿Te has hecho preguntas como estas? El origen de la vida 1
    • El origen de la vida ¿Cómo se originó la vida? ¿Cómo han surgido los seres vivos que nos rodean? 1
    • El origen de la vida Estas preguntas han estado en la mente humana desde nuestro mismo origen. Las religiones, la filosofía y la ciencia han compartido estas inquietudes. ¿Cómo hemos surgido nosotros? ¿Cómo han surgido los seres vivos que nos rodean? ¿Cómo se originó la vida? 1
    • El origen de la vida 1.1.- Controversia entre generación espontánea y biogénesis Los antiguos griegos argumentaban dos teorías : unos suponían que la vida había aparecido en la Tierra y había ido cambiando posteriormente; otros pensaban que se formaba constantemente en el planeta. Esta última idea constituyó el germen de la teoría de la generación espontánea , según la cual la vida puede surgir del lodo, del agua, del mar o de las combinaciones de los cuatro elementos fundamentales: aire, agua, fuego y tierra, o de cualquier sustancia inerte. Platón y Aristóteles. Rafael 1
    • El origen de la vida 1.1.- Controversia entre generación espontánea y biogénesis La idea de la generación espontánea de los seres vivos, que ya enunció Aristóteles hace 2000 años, perduró durante mucho tiempo. Aristóteles La vida puede surgir del lodo, de las aguas estancadas… 1
    • El origen de la vida 1.1.- Controversia entre generación espontánea y biogénesis Estas ideas que hoy día nos parecen tan extrañas o incluso cómicas, se basaban en observaciones como esta: si dejamos, por ejemplo, trozos de carne, al cabo de unos días “salen gusanos”. Esos gusanos aparecerían ahí solos, espontáneamente. ¿Qué explicación le das tú a la aparición de estos gusanos? 1
    • El origen de la vida 1.1.- Controversia entre generación espontánea y biogénesis En 1667, el médico Jan B. van Helmont propuso una receta que permitía la generación espontánea de ratones: 1 Los piojos, garrapatas, pulgas y gusanos nacen de nuestras entrañas y excrementos. Si colocamos ropa interior llena de sudor junto con trigo en un recipiente de boca ancha, al cabo de 21 días el olor cambia y penetra a través de las cáscaras del trigo, cambiando el trigo por ratones. Estos ratones son de ambos sexos y se pueden cruzar con ratones que hayan surgido de manera normal. Jan B. van Helmont
    • Reflexiona Francesco Redi, un médico italiano, realizó en el siglo XVII el siguiente experimento: ¿Qué conclusión sacas de este experimento? Aparecen gusanos Frasco abierto Carne Carne Carne Frasco tapado con una gasa Frasco cerrado herméticamente No aparecen gusanos Aquí aparecen huevos de mosca
    • Reflexiona Como habrás podido deducir del resultado obtenido por Redi en su experimento, los gusanos sólo aparecen en la carne si entra en contacto con las moscas, que depositan en ella los huevos a partir de los cuales se desarrollan las larvas, que son los “gusanos”. Con este sencillo experimento Redi demostró que la vida sólo puede surgir de vida preexistente. Mosca (adulto) Larva de la mosca (“gusano”) Son varias las especies de moscas cuyas larvas pueden alimentarse de carne. Lucilia caesar Sarcophaga carnaria Calliphora vomitoria Musca domestica
    • La teoría según la cual la vida sólo puede originarse a partir de vida se conoce como biogénesis .
    • 1.1.- Controversia entre generación espontánea y biogénesis A pesar del experimento de Redi, la controversia se prolongó aún otros doscientos años hasta que en el siglo XIX, Louis Pasteur realizó el experimento que refutó definitivamente la teoría de la generación espontánea. El experimento de Pasteur 1864 El aire podía pasar a los recipientes, pero no así los microorganismos, que quedaban atrapados en el cuello. Si se corta el cuello el líquido se contamina con microorganismos. Se desechó para siempre la teoría de la generación espontánea. Microbios
    • El origen de la vida 1.2.- Teoría del origen físico-químico de ……. la vida: Oparin y Haldane John Burton S. Haldane (1892 - 1964) Aleksandr Ivanovich Oparin (1894 - 1980) Los dos científicos enunciaron esta teoría simultáneamente. Esta teoría se basa en las condiciones físico-químicas que existieron en la Tierra primitiva y que permitieron el desarrollo de la vida. Haldane Oparin Clic aquí para ver vídeo 1
    • El origen de la vida 1.2.- Teoría del origen físico-químico de ……. la vida: Oparin y Haldane Haldane Oparin En nuestro planeta no había oxígeno libre en la atmósfera, pero sí sustancias como el hidrógeno, el metano, el vapor de agua y el amoniaco. Existían, además, unas altas temperaturas, provenientes de la actividad volcánica, las radiaciones solares y las descargas eléctricas producidas por las frecuentes tormentas. Las condiciones eran distintas a las actuales Clic aquí para ver vídeo 1
    • El origen de la vida 1.2.- Teoría del origen físico-químico de ……. la vida: Oparin y Haldane Haldane Oparin En estas condiciones, aparecieron en un mar - que era una “ sopa primitiva ” - las primeras moléculas orgánicas que lograban autoreplicarse. Posteriormente, estas moléculas se rodearon de unas envolturas y originaron los organismos más primitivos, los protobiontes . Cuando estos evolucionaron dieron lugar a los eubiontes , que ya eran células con vida. Miller Pero… ¿habría alguna manera de comprobarlo? Clic aquí para ver vídeo 1
      • Hasta entonces se pensaba que sólo un ser vivo podía fabricar materia orgánica (aminoácidos, ácidos grasos…)
      1.2.- Teoría del origen físico-químico de ……. la vida: Oparin y Haldane Hasta ahora, nadie ha logrado crear una célula con vida, pero este experimento ha sido crucial para entender mejor cómo pudo haber ocurrido. En 1953, Miller confirmó la teoría de Oparin-Haldane simulando en el laboratorio las condiciones de la Tierra primitiva. Obtuvo compuestos orgánicos a partir de otros inorgánicos.
    • El origen de la vida 1.2.- Teoría del origen físico-químico de ……. la vida: Oparin y Haldane Haldane Oparin Este experimento probaba que las condiciones existentes en el planeta hace unos 3500 millones de años fueron tales que pudieron formarse espontáneamente moléculas orgánicas. Experimento de Miller Miller 1
    • Un origen común a pesar de la variedad Se han clasificado 1,2 millones de especies animales y más de 400.000 especies vegetales. Además de los reinos Animal y Vegetal, existen otros 3 reinos con cientos de miles de especies conocidas. Cada año se descubren especies nuevas. 2
    • Un origen común a pesar de la variedad Antiguamente se creía que las especies entonces conocidas habían mantenido su aspecto sin cambiarlo desde el mismo momento de la creación. 2
    • Un origen común a pesar de la variedad Todos los seres vivos tienen un origen común , a partir del cual se formaron las distintas especies y adquirieron niveles organizativos superiores. Este proceso se denomina evolución . Sin embargo, en el siglo XIX comenzaron a surgir diversas teorías que postulaban que los organismos vivientes eran el resultado de un dilatado proceso desarrollado a lo largo de la historia de la Tierra. Los científicos se preguntaban cómo podían explicarse las extrañas formas de vida, hoy inexistentes, que parecían estar grabadas en piedra: los fósiles. También se hacían preguntas acerca de las variaciones en los animales y plantas domésticos y el origen de sus razas. 2
    • Un origen común a pesar de la variedad Ninguno de los científicos que apostaban por las teorías evolucionistas conocía la existencia de los genes ni de las mutaciones, pero ya entonces intuían que los cambios ocurridos en los individuos de una especie “se transmitían” a los descendientes. 2
    • Darwin estaba muy interesado en cómo los agricultores, ganaderos y criadores de animales conseguían obtener y mejorar diferentes razas Hacen una Selección Artificial Pues muy fácil: para criar buenos animales sólo hay que cruzar los mejores y eliminar a los que no nacieron con buenas características. Si se quiere una buena raza de vaca lechera no se cruzan animales que produzcan poca leche. Se seleccionan aquellas hembras que produzcan más leche. Se hace una Cría Selectiva . Darwin pensaba que la Selección Natural actuaba como la selección hecha por el hombre Clic aquí para ver vídeo
    • Pruebas de la evolución 4.1.- Pruebas morfológicas Se basan en el estudio comparado de la morfología de los órganos de seres vivos actuales o de fósiles. Mediante la ANATOMIA COMPARADA se estudian las semejanzas y diferencias entre órganos de diversas especies. 4
    • 4.1.- Pruebas morfológicas Observa detenidamente estos dibujos de extremidades anteriores de vertebrados: Todas son diferentes pero tienen “un esquema común” de organización Ese “esquema común” de organización se debe a un antepasado común que “inventó” un “esquema básico”. La evolución por selección natural llevó a distintas adaptaciones de esta extremidad para correr, nadar, volar… Pero el “esquema básico” se mantuvo en todas estas especies. Estos dibujos muestran ejemplos de ÓRGANOS HOMÓLOGOS
    • 4.1.- Pruebas morfológicas Los órganos HOMÓLOGOS son aquellos que tienen un mismo origen evolutivo y embrionario, con una estructura interna semejante, fruto de diversas modificaciones adaptativas a distintos hábitats. Ejemplos: Humano Gato Ballena Murciélago
    • 4.1.- Pruebas morfológicas Los órganos HOMÓLOGOS son aquellos que tienen un mismo origen evolutivo y embrionario, con una estructura interna semejante, y con diversas modificaciones adaptativas a distintos hábitats. Humano Caballo Murciélago Ballena
    • Brazo de murciélago Brazo humano Cráneo de murciélago Cráneo de oso Hay una membrana entre los dedos que permite volar a los murciélagos. ¿Te parecería apropiado pensar en un parentesco próximo entre un murciélago y un insecto sólo porque vuelan? Aunque los osos y los humanos no volemos, estamos bastante más emparentados con un murciélago que con un insecto. Son ejemplos de órganos HOMÓLOGOS 4.1.- Pruebas morfológicas Son ejemplos de órganos ANÁLOGOS Ala de murciélago Ala de insecto
    • 4.1.- Pruebas morfológicas Los órganos ANÁLOGOS son aquellos que tienen distinto origen evolutivo y embrionario, pero presentan una forma aparentemente semejante y realizan la misma función. Estos machos de Lucanus cervus (ciervo volante), usan sus “cuernos” (mandíbulas muy desarrolladas) para combatir entre ellos. Son ejemplos de órganos ANÁLOGOS Ala de murciélago Ala de insecto Son ejemplos de órganos ANÁLOGOS Los ciervos macho también combaten con sus cuernos
    • 4.1.- Pruebas morfológicas Los órganos ANÁLOGOS representan un fenómeno llamado CONVERGENCIA ADAPTATIVA, por el cual los seres vivos repiten fórmulas y diseños que han tenido éxito.
    • 4.1.- Pruebas morfológicas Los órganos HOMÓLOGOS representan la DIVERGENCIA ADAPTATIVA, por la cual los seres vivos modelan sus órganos según su modo de vida, el ambiente en que están, etc.
    • 4.1.- Pruebas morfológicas Los ÓRGANOS VESTIGIALES son también pruebas anatómicas de la Evolución. Son órganos rudimentarios, atrofiados, que revelan un pasado evolutivo. Fémur Cintura pélvica Por ejemplo, los cetáceos (ballenas, delfines…) conservan vestigios (“restos”) del fémur y de la cintura pelviana. La explicación es que tuvieron un antepasado mamífero terrestre. Su adaptación al medio acuático les llevó a perder las extremidades posteriores, pero quedan “restos”.
    • 4.1.- Pruebas morfológicas El kiwi y el cormorán de las Islas Galápagos tienen alas vestigiales. Con ellas ya no pueden volar. El cóccix son pequeñas vértebras fusionadas. Es el vestigio de un pasado evolutivo con cola. Este insecto tiene alas vestigiales. Con ellas ya no puede volar. Los ÓRGANOS VESTIGIALES son también pruebas anatómicas de la Evolución. Son órganos rudimentarios, atrofiados, que revelan un pasado evolutivo.
    • Pruebas de la evolución Las encontramos repartidas por todo el planeta, y consisten en la existencia de grupos de especies más o menos parecidas, emparentadas, que habitan lugares relacionados entre sí por su proximidad, situación o características, por ejemplo, un conjunto de islas, donde cada especie del grupo se ha adaptado a unas condiciones concretas. La prueba evolutiva aparece porque todas esas especies próximas provienen de una única especie antepasada que originó a todas las demás a medida que pequeños grupos de individuos se adaptaban a las condiciones de un lugar concreto, que eran diferentes a las de otros lugares. Son ejemplos característicos de esto los pinzones de las islas Galápagos que fueron estudiados por Darwin 4.2.- Pruebas biogeográficas Un único ancestro común dio lugar a diversas especies de pinzones en las diferentes islas Galápagos 4
    • Pruebas de la evolución Guanaco Llama Camello bactriano Dromedario Alpaca Vicuña Camélidos de Sudamérica Camélidos de Asia - África La familia de los camélidos se diversificó de acuerdo a su distinta adaptación en diferentes hábitats. Ello constituye una prueba biogeográfica más de la evolución. 4.2.- Pruebas biogeográficas 4
    • Pruebas de la evolución 4.2.- Pruebas biogeográficas Wallaby Equidna Ornitorrinco Diablo de Tasmania Lobo marsupial (extinguido) La extraña fauna de Australia refleja su aislamiento evolutivo del resto de continentes. Las especies de mamíferos evolucionaron independientemente de otras partes del mundo. Esto es una prueba biogeográfica más de la evolución. Koala 4 Canguro rojo
    • Pruebas de la evolución 4.3.- Pruebas paleontológicas ¿Podría ser este el antepasado del ciervo actual? Esqueleto fosilizado de Megaceros El nacimiento de la Paleontología vino a apoyar las ideas evolucionistas del siglo XIX. Se establecen similitudes con especies actuales y se intenta determinar una historia evolutiva apoyada en pruebas tan firmes como son los fósiles. Así, por ejemplo, se han logrado reconstruir historias evolutivas completas como la que condujo hasta el caballo 4
    • Pruebas de la evolución 4.3.- Pruebas paleontológicas Se han logrado reconstruir historias evolutivas completas como la que condujo hasta el caballo. Los antepasados del caballo fueron cambiando y gradualmente fueron perdiendo dedos como adaptación a la carrera veloz. En los fósiles está escrita la historia evolutiva de los équidos Clic aquí para ver vídeo 4
    • Pruebas de la evolución 4.3.- Pruebas paleontológicas Se han logrado reconstruir historias evolutivas completas como la que condujo hasta el caballo. Los antepasados del caballo fueron cambiando y gradualmente fueron perdiendo dedos como adaptación a la carrera veloz. Équido actual Ancestro de los équidos En los fósiles está escrita la historia evolutiva Clic aquí para ver vídeo 4
    • Pruebas de la evolución 4.3.- Pruebas paleontológicas Clic aquí para ver vídeo 4 El Arqueopterix pudo ser el antepasado extinguido de las aves. Era “mitad reptil – mitad ave” Pico sin dientes Ave actual Pico con dientes Cola larga Cola corta Garras en los dedos Dedos vestigiales y sin garras Plumas
    • Fósil de Archaeopteryx Reconstrucciones del Archaeopteryx Clic aquí para ver vídeo
    • Archaeopteryx Se considera un animal emblemático en el estudio de la evolución por su carácter transicional entre reptiles y aves Vivió hace 150 millones de años
    • Pruebas de la evolución 4.3.- Pruebas paleontológicas Hojas fosilizadas Concha de Hoja actual 4 Darwin llamó al Ginkgo Biloba "fósil viviente", por considerarlo la especie vegetal más antigua del planeta. Aparecieron hace 250 millones de años, en el período Pérmico, al final de la era primaria. “ Fósiles vivientes” Nautilus actual Nautilus fosilizados seccionados Este pez, el celacanto es otros “fósil viviente”. Curiosamente, se conocía muy bien a los fósiles mucho antes de descubrirse el primer ejemplar vivo. Este molusco es un “fósil viviente” que lleva sin evolucionar 150 millones de años. Se considera próximo en la evolución a los extinguidos ammonites
    • Pruebas de la evolución 4.3.- Pruebas paleontológicas El libro de la historia de la Tierra está escrita en las rocas. Los fósiles son las palabras de ese libro. En el próximo tema veremos los detalles del proceso de fosilización y los grupos de fósiles más importantes. 4
    • Pruebas de la evolución 4.4.- Pruebas embriológicas Observa detenidamente el desarrollo embrionario de estas especies: Al principio todos estos embriones son muy parecidos entre sí 4
    • Pruebas de la evolución 4.4.- Pruebas embriológicas Estas semejanzas son una prueba de que existe un parentesco entre las especies. Cuanto más alto sea el parecido entre embriones, mayor será el grado de parentesco entre dos especies. Durante el desarrollo embrionario es como si se reprodujese la historia evolutiva de los antepasados. Nuestro embrión, al principio, es muy parecido al de un pez. Nuestros antepasados remotos fueron peces. 4
    • Pruebas de la evolución 4.5.- Pruebas bioquímicas Por último, las pruebas más recientes y las que mayores posibilidades presentan, consisten en comparar ciertas moléculas que aparecen en todos los seres vivos de tal manera que esas moléculas son tanto más parecidas cuanto menores diferencias evolutivas hay entre sus poseedores, y al revés; esto se ha hecho sobre todo con proteínas (por ejemplo proteínas de la sangre) y con ADN. 4
    • Mecanismos evolutivos Los seres vivos somos lo que somos gracias a la información genética que poseemos almacenada en nuestras células; esta información ha sido más o menos modelada por el ambiente en el que vivimos. Pero lo único que transmitiremos a nuestros hijos serán nuestros genes, no caracteres adquiridos como una piel morena o unos músculos fuertes. La evolución se entiende como el cambio producido a lo largo del tiempo en el material genético de las poblaciones. La eficacia biológica o capacidad para dejar descendencia es inseparable del concepto de selección natural. La mayor eficacia biológica deja una mayor representación del genotipo sobre los demás en generaciones sucesivas. 5
    • Mecanismos evolutivos En un principio, los seres vivos de la misma especie y de la misma población debieron tener idéntica información genética, los mismos genes y los mismos alelos. Todos los individuos estarían en principio igual de adaptados a su medio, salvo diferencias ambientales individuales (por ejemplo, el que se alimente más estará más fuerte); la cuestión es, ¿por qué con el tiempo surgen individuos diferentes dentro de las poblaciones?. La respuesta a estas cuestiones está en las MUTACIONES GENÉTICAS , que hacen que un gen cambie lo suficiente para seguir siendo el mismo gen, pero dé lugar a un carácter algo diferente, convirtiéndose entonces en lo que llamamos un ALELO . 5
    • Cualquier ser vivirá mejor o peor en el lugar en que le ha tocado vivir según los caracteres que haya desarrollado, así por ejemplo, si tiene una gruesa cubierta de pelo aguantará bien el frío, si tiene agilidad para subir a los árboles escapará de los predadores y si sabe nadar no se ahogará cuando tenga que cruzar un río; esta capacidad de vivir mejor o peor es lo que llamamos ADAPTACIÓN AL MEDIO : el que está mejor adaptado vive mejor, se alimenta bien, escapa de los predadores, vive más tiempo y todo esto hará que tenga más crías, y, por lo tanto, deje más descendientes a la siguiente generación que llevarán sus genes, es la SUPERVIVENCIA DEL MÁS APTO . LOS SERES MEJOR ADAPTADOS A SU MEDIO DEJAN MÁS DESCENDIENTES A LA SIGUIENTE GENERACIÓN En sentido negativo, los individuos que están peor adaptados viven menos, y dejarán menos descendientes, por lo que al cabo de varias generaciones sus genes tenderán a desaparecer, quedando sólo los genes que suponen una mejor adaptación, es decir, la naturaleza selecciona los mejores genes para un ambiente determinado, es lo que llamamos la SELECCIÓN NATURAL Mecanismos evolutivos 5
    • Mecanismos evolutivos Como ya hemos visto, la principal fuerza evolutiva son las mutaciones genéticas, que son las responsables de la mayoría de la variabilidad genética de las poblaciones, aunque no son la única fuerza evolutiva que actúa, ya que existen otras que son también muy importantes: la reproducción sexual , que es la responsable de la mezcla de genes y alelos en los individuos el número de individuos de la población, ya que si la población es muy pequeña los cambios genéticos se dan más deprisa (deriva genética) los movimientos de individuos, las migraciones , que alteran el conjunto de genes y alelos de la población y, por supuesto, la selección natural , que escogerá aquellas combinaciones genéticas más favorables para ese medio, haciendo que esos individuos mejor adaptados produzcan más individuos y su EFICACIA BIOLÓGICA sea mayor. 5
    • Mecanismos evolutivos La mariposa Biston betularia de Inglaterra puede ser clara u oscura. En condiciones normales, la proporción de individuos que llevan el gen responsable del color claro es muy alta. Sin embargo, en zonas donde azotaba la contaminación y los árboles oscurecían con el hollín, predominan los individuos con fenotipo oscuro. Mariposas descansado, posadas sobre troncos de abedul Tronco ennegrecido por el hollín 5
    • Microevolución y macroevolución Son dos niveles diferentes del proceso evolutivo Se trata de pequeñas modificaciones en las poblaciones que pueden llegar a originar nuevas especies próximas, parecidas entre ellas, pero distintas. Ejemplo: pinzones de las Islas Galápagos. El término Macroevolución se refiere a las relaciones entre todos de seres vivos, con la aparición y desaparición de grandes grupos. Los fósiles son fundamentales para encajar todo este gran rompecabezas. 6 Microevolución Macroevolución
    • Microevolución y macroevolución Las 13 especies actuales de pinzones de las Galápagos se originaron a partir de un antepasado que llegó desde el continente. Se produjo una radiación adaptativa. Se trata de un ejemplo de microevolución. 6
    • Microevolución y macroevolución Macroevolución: árbol evolutivo o filogenético de los seres vivos. 6
    • Quirópteros Primates Lagomorfos Roedores Carnívoros Pinnípedos Desdentados Sirenios Perisodáctilos Artiodáctilos Proboscídeos Cetáceos Insectívoros Árbol evolutivo de los mamíferos placentarios
    • Formación de nuevas especies Aquí ves 6 especies de felinos que se originaron a partir de un ancestro común. Pero… ¿Qué es exactamente una ESPECIE ? 1 2 3 4 5 6 7
    • Los individuos pertenecen a una misma especie cuando pueden reproducirse entre sí y tener descendencia fértil. Las cuatro especies de buitres ibéricos Macho adulto Hembra adulta Joven Cachorro Recién nacido Subadulto Foca monje ( Monachus monachus )
    • ¿Son de la misma especie estas dos aves?: No. ¿Por qué? A simple vista vemos que hay diferencias entre estos dos individuos: la forma del pico, los colores del plumaje, etc. Dos seres como estos (macho y hembra) NO PUEDEN REPRODUCIRSE ENTRE SÍ
    • ¿Cuántos individuos hay aquí? ¿Y cuántas especies ves? …… 19 ……… 8
    • ¿Cómo se nombran las especies? Carlos Linneo estableció en el siglo XVIII el sistema de NOMENCLATURA BINOMIAL para nombrar científicamente las especies.
    • Nombre vulgar Nombre científico Gorrión Passer domesticus ¿Cómo se nombran las especies? Cada especie tiene un nombre científico, universal y único en todos los países.
    • Nombre vulgar: bisonte A veces llamado en América “búfalo” Nombre vulgar: búfalo Nombre científico Nombre científico Bison bonasus Syncerus caffer ¿Cómo se nombran las especies? Los nombres científicos evitan confusiones
    • ¿Cómo se nombran las especies? Collie Pastor alemán Galgo Pastor belga Pointer Bulterrier Fox terrier Rottweiler Beagle Basset Yorkshire Bulldog Son RAZAS de una misma especie: Canis familiaris
    • Canis familiaris Canis lupus Canis lupus Vulpes vulpes Antepasado común (lobo) (zorro) (lobo) (perro) El perro comenzó a acompañar al ser humano desde la Prehistoria. Estudios de ADN confirman que proviene del lobo y no del zorro. Todavía se pueden reproducir entre sí ¿Lo sabías? Ya no se pueden reproducir entre sí
    • A veces existe un DIMORFISMO SEXUAL , es decir, que el macho y la hembra muestras diferentes colores, tamaño y forma del cuerpo o de algunos órganos…
    • Estos monos, aunque no lo parezca, pertenecen a la misma especie (la variabilidad intraespecífica es muy alta) Otras veces ocurre lo contrario: animales o plantas que parecen iguales a simple vista, en realidad pertenecen a diferentes especies, como ocurre por ejemplo con las cebras…
    • Se hace necesario estudiar a fondo las poblaciones de animales para conocer si se trata de una especie o de varias. Por ejemplo, después de siglos pensando que en África sólo había una especie de cebra, se sabe desde hace pocos años que en realidad hay tres: Su parecido es tan grande porque están muy emparentadas. Eso significa que el ancestro común de las tres especies está relativamente próximo en el tiempo. Equus quagga Equus grevyi Equus zebra
    • Esto no es un capricho de los biólogos. Son especies diferentes porque no se reproducen entre sí dando unos hijos fértiles En algunos zoológicos se han podido reproducir especies diferentes de cebras. Pero los hijos resultantes, aunque viven con normalidad, son ESTÉRILES Equus quagga Equus grevyi Equus zebra
    • Desde muy antiguo se sabe que también pueden reproducirse dos especies diferentes: caballo y asno. La mula es un híbrido que resulta del cruce entre burro y yegua o entre caballo y burra. Las mulas no se pueden reproducir porque son ESTÉRILES Animales del género Equus Mula (es un híbrido asno-caballo) Cuando se originan las especies dejan de reproducirse unas con otras. Adoptan colores, formas y comportamientos que les impiden cruzarse con especies diferentes Équidos
    • Una especie puede definirse como el conjunto de individuos que constituyen una población con características estructurales y funcionales semejantes, y que son capaces de aparearse entre sí y generar una descendencia fértil . El cortejo en las palomas Apareamiento en el ciervo volante
    • Formación de nuevas especies 7.1.- ¿Cuál es la causa de la biodiversidad?
      • La adaptación al medio genera una serie de cambios pequeños y graduales en una población que, a lo largo de miles de años, pueden llegar a constituir una especie nueva.
      • La formación de especies nuevas a partir de otra preexistente, o especiación , fenómeno que es principal responsable de la diversidad de los organismos vivientes.
      Équido actual Ancestro de los équidos 7
    • Formación de nuevas especies 7.2.- ¿Cómo se forma una nueva especie? El okapi es un jiráfido de cuello corto que vive en las selvas africanas Las dos especies: jirafa y okapi, no se pueden reproducir entre sí. Al principio las poblaciones de una misma especie quedan separadas por una barrera física (un mar, una cadena montañosa, un desierto…). Al cabo de varias generaciones, se hace imposible del todo la reproducción entre las especies diferentes que se han formado Además de intervenir la adaptación al medio por selección natural, debe producirse además el AISLAMIENTO de una población que, al evolucionar y diferenciarse gradualmente del resto de la especie original, llega a original una especie nueva. 7
    • Tengo ganas de aprender más sobre la evolución Fin Clic aquí para actividades interactivas: http://iessuel.org/ccnn/interactiv/evolu01.htm Clic aquí para ver vídeos sobre la Evolución