Center for Clinical Genomics and Personalized Medicine, Hungary

  • 286 views
Uploaded on

Center for Clinical Genomics and Personalized Medicine at the University of Debrecen, Hungary

Center for Clinical Genomics and Personalized Medicine at the University of Debrecen, Hungary

  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Be the first to comment
    Be the first to like this
No Downloads

Views

Total Views
286
On Slideshare
0
From Embeds
0
Number of Embeds
0

Actions

Shares
Downloads
0
Comments
0
Likes
0

Embeds 0

No embeds

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
    No notes for slide
  • The „Standard“ System
    - every Affymetrix lab in the world uses the same instruments, with the same protocols
    => standardization of results, easy to compare
    - point out Fluidics Station is integral component: important for reduction of variability. Competitors dont have their own FS.

Transcript

  • 1. Center for Clinical Genomics and Personalized Medicine 2014 Bálint L. Bálint MD, PhD Head of Laboratory
  • 2. Center for Clinical Genomics and Personalized Medicine IVDI Building 3-d floor
  • 3. http://genomics.med.unideb.hu
  • 4. Our Team
  • 5. Our Infrastructure Biobanking Microarays NG-Sequencing Bioinformatics
  • 6. Students coming from Medical Centre service area 1.45 hours
  • 7. Facts about the University of Debrecen  33000 students  Teaching  More in Hungarian and English than 1500 faculty members  15 branches  21 Doctoral Schools  15% of Hungarian RnD is located here
  • 8. Brief overview of the region: Underdeveloped region with large Regional Developmental Funds University City with long history Medical Centre that serves 2 mil people Pharmapolis Cluster: TEVA (Biogal) Richter Gedeon new Pharma Plant for Biological drugs (recombinant proteins and antibodies) Cell Therapy Unit (already performing clinical studies) Stem Cell Research Unit (starts 2010) RCMM twinning with EMBL Several EMBO members locally Personalized Health Care Unit (from 2011) Well organized Medical Centre open to patients from foreign countries SAP and ISO implementation at the Medical Centre level
  • 9. Our vision is to channel the advances in genomics towards medical research for the benefit of the patients in the form of Personalized Medicine
  • 10. Goals:  Leader in the Personalized Medicine in the region  Implementation of novel research tools for the benefit of the patients through clinical research  Take the opportunity of the regional grants and use them to develop tools that can be used on a global scale  Taking care of every spent pence in a very conservative way
  • 11. Activities to implement our Goals:  Activities  in two directions: Clinical Research    Common projects with clinicians Infrastructure for clinical research Regional training  From PCR oligo design through Study design till Data analysis  Global gene expression and functional genomics, Epigenetics 01/22/14 11
  • 12. Activities in the field of Clinical Research:  Genomics  National Genomics Technological Platform  Biomarker discovery and Biobanking  Partners: Pfizer, Astra Zeneca, Richter Gedeon, Biosystems International, Roche Hungary  Biobanking: COPD, Schizophrenia, Lung cancer, Leukemias Tools for Biomarker discovery: UPL based miRNA measurement (Roche Hungary and Astrid Research)   Epigenetics   Partners: Diagenode Belgium and Millipore USA Areas: developing of standards for epigenetic studies and protocols for HTS and clinical research in the field of epigenetics 01/22/14 12
  • 13. Coordinated from the University of Debrecen: 1. Genomic Research for Human Health Consortium (GRHH) 2002-2008- FP6 (www.humangenom.hu) 2. National Genomic Technological Platform (NGTP) 2009-2011National Grant www.genomika.net
  • 14. Core facility:  Implementation of novel technologies require expensive infrastructure  Expensive infrastructure can be best used if shared by several research groups and operated by dedicated staff  Without streets knowledge dissemination core facilities are like dead end
  • 15. Detailed Infrastructure  Laboratories  Biobank depositories  Offices  QPCR Instruments  QPCR assays (hundreds)  Capillary  Deep sequencer (4 chanell ABI) Sequencing System (Illumina HiScan SQ)  Pipetting robots (4)  Microarray  DNA/RNA systems (1) QC instruments (Agilent Bioanalyzer, Nanodrop, Qubit)
  • 16. Relevant output Lifecycles of technologies Additional developments Original innovation Distinctive technology / development phase/ time Both instrument and reagent costs are high Peak technology / penetretion phase/ Instrument price is high, reagent price is decreasing Basic technology / spreading phase/ Both instrument and reagent costs are rapidly decreasing Based on: „Pataki Béla: Technológia menedzsment”
  • 17. Relevant output Lifecycles of technologies Distinctive technology / development phase/ time Both instrument and reagent costs are high Peak technology / penetretion phase/ Instrument price is high, reagent price is decreasing Basic technology / spreading phase/ Both instrument and reagent costs are rapidly decreasing Based on: „Pataki Béla: Technológia menedzsment”
  • 18. L ab RE CO Sequencing and genomics unit Epigenetic unit b D La Rn Se b e La rvic Biobanking unit Protein and cell engeneereing unit b D La Rn
  • 19. Sequencing and genomics unit Instruments: •Capillary sequencer •Affymetrix •Illumina NGS •Server system La b RE CO Wet lab people: Post docs: •Beata Scholtz •Szilárd Póliska Technicians: •Sipos Lilla •Erzsébet Mátyás Bioinformatics support team: Endre Barta (leader) Attila Horvath (system administrator) Laszlo Steiner (biomathematics and bio statistics) Gergely Nagy (bioinformatics)
  • 20. NGS Sequencing Illumina Sequencing System HiScan SQ- Szilárd Póliska
  • 21. Automatic Chromatin IP for maximal reproducibility Diagenode IP-Star Magnetic ChIP
  • 22. Affymetrix Systems
  • 23. GeneChip® 3000 platform • • Hybridisation Oven Delivers precise temperature control during hybridization • Fluidics stations • Washing and staining of hybridized target probe complexes • Scanner • High resolution scanner for fast image acquisition • Autoloader including barcode reader for sample tracking
  • 24. Bioinformatics Endre Barta
  • 25. NGS software installed on ngsdeb Programs used for ChIP-seq, GRO-seq and RNA-seq analysis • HOMER • SAMTOOLS • BOWTIE • ChIPSEEQER • BEDTOOLS • BAMTOOLS • TOPHAT • TRINITYRNASEQ • BWA • MEME • MACS • FASTX-TOOLKIT • PICARD 25 Head Node: 2x6 core, 144GB RAM, 20 Tbyte disk 6x computing nodes: 2x6 core, 48GB RAM 600GB disk 2012.05.16.
  • 26. ChIP-seq analyze script • Aim: To have a simple script that can be used either to analyze local ChIP-seq sequencing data or to do meta-analysis of ChIP-seq experiments stored on the NCBI SRA database • Command line tool • Input: SRA (NCBI reads), fastq (reads), bam (alignments) • • • • • • • Downloads SRA format files NCBI Maps fastq format reads Peak calling by HOMER and MACS Peak annotation by HOMER Known and denovo motif finding by HOMER GO enrichment analysis by HOMER Generates bedgraph and bed files for visualization Barta E Command line analysis of ChIP-seq results. EMBNET JOURNAL 17:(1) pp. 13-17. (2011)
  • 27. UPL based miRNS detection system Czimmerer Zsolt Astrid Research http://genomics.dote.hu:8080/mirnadesigntool/
  • 28. High sensitivity e.g on hsa-mir-181 miRNA gen family Hsa-mir-181a: AACAUUCAACGCUGUCGGUGAGU Hsa-mir-181b: AACAUUCAUUGCUGUCGGUGGGU Hsa-mir-181c: AACAUUCAAC*CUGUCGGUGAGU http://genomics.dote.hu:8080/mirnadesigntool/
  • 29. More info: Balint L. Balint , Head of Laboratory Lbalint@med.unideb.hu http://genomics.med.unideb.hu