Recommended
Recommended
More Related Content
What's hot
What's hot (20)
Viewers also liked
Viewers also liked (8)
Similar to B4FA 2012 Ghana: Plants and Agriculture - Wayne Powell
Similar to B4FA 2012 Ghana: Plants and Agriculture - Wayne Powell (20)
More from b4fa
More from b4fa (20)
Recently uploaded
Recently uploaded (20)
B4FA 2012 Ghana: Plants and Agriculture - Wayne Powell
- 2. IBERS, Aberystwyth Public Good Plant Breeding
- 3. Agriculture the most important event in human history ‘The original biotechnology, fundamental to culture, health, quality environment & biodiversity.’
- 4. Agriculture is at the Center of Many of Society’s Most Important Debates Exciting time for Agriculture & Plant Breeding • Global food security •Enhanced productivity •Increased yield •Sustainable production • Water availability •Drought-tolerant crops • Biofuels •Yield technologies to help meet demand for both food and fuel • Global warming •CO2 footprint •Fertilizer use
- 6. Holistic Research “No matter how excellent the research done in one scientific discipline is, its application in isolation will have little positive effect on crop production. What is needed are venturesome scientists who can work across disciplines to produce appropriate technologies and who have the courage to make their case with political leaders to bring these advances to fruition. ” Norman E. Borlaug
- 8. Doubly Green Revolution • The aim •repeat the success of the Green Revolution •on a global scale to include Africa!! •in many diverse localities • and be •equitable •sustainable •and environmentally friendly
- 9. sunlight plants plant power science Agriculture, Land Use & Society Plants provide sustainable solutions ‘ultimate green & clean technology’
- 10. fossil reserves biorenewables oil...refineries bio...refineries CHEMICALS MATERIALS FUELS yesterday today and tomorrow sunlight plant biomass a solar energy source for manufacturing
- 11. Agriculture critical to the future of our planet and humanity •FOOD, •FEED, •FUEL •CHEMICALS
- 13. Daily calorie intake in developing world Rice 45% Wheat 29% Maize 11% Cassava 3% Sorghum 2% Potato 2% Sweet potato 2% Millet 2% Soybean 2% Bean 1%
- 16. Courtesy Tobert Rocheford and Catherine Bermudez Kandianis Keith Weller Doug Wilson Scott Bauer Keith Weller
- 17. •DuPont Food security index http://foodsecurity.eiu.com •Father Green revolution: Norman Borlaug. •Civilization founded on crops •Importance of diversity
- 18. Charles Darwin Evolution is driven by natural selection
- 19. Darwin’s mentor Great Teachers often feature in the development of Great People!
- 20. Fundamental role of Diversity & Selection Reference: Michael Balter (2007) Seeking Agriculture’s Ancient Roots, Science 316, 1830-1835 ESEB Congress, Uppsala, Sweden, August 2007
- 21. Selective breeding is a powerful tool ESEB Congress, Uppsala, Sweden, August 2007
- 22. “Selection works.” JW Dudley Crop Sci (2007) 47(S3)S20–S31
- 23. Eco-systems based approach to plant breeding
- 24. Grass crop domestication – increasing forage quality (Mean WSC over 5 years data) Cultivar Mean Water Soluble Carbohydrate Content S23 17.1% AberDart 20.6% AberAvon 20.6% AberStar 21.5% AberMagic 23.7%
- 25. High sugar ryegrass (Environmental/ Quality Trait) Economic benefits – live weight gain Environmental benefits – reduced diffuse pollution - reduced GHG emissions
- 26. New traits-new sources genetic diversity Redirection of metabolic hydrogen Methods of methane mitigation: Feed CH4 CO2 Methanogens Protozoa Microbial cells
- 27. Science has provided the key to unlocking the potential of food Sugar keeps sheep happy, and has revolutionised food production, says Steve Jones. Steve Jones is professor of genetics at University College London
- 28. Conversion of high sugar grasses to alcohol based transport fuel Image courtesy of Steve Martin, TMO Renewables Harvest Primary Processing (screw press) Juice Fibre Fermentation Digestion Co-Products Co-Products Ethanol potential: ~ 5000 litres/Ha/yr Ethanol potential: ~ 5000 litres/Ha/yr Alternative uses Alternative uses Single enzyme
- 29. Natural Products Biotransformation & composites Biorefining Centre of Excellence
- 30. Vavilov 1887-1943 •Soviet botanist & geneticist •Discovered and identified centres of origin/cultivated plants •Criticised the non- Mendelian concepts of Lysenko •Arrested in 1940, died of malnutrition in prison in 1943.
- 31. Crop origins and diversification: multiple births Science 316, 1830-1835 ESEB Congress, Uppsala, Sweden, August 2007
- 32. Little overlap between centres of origin & today’s productive agriculture. ESEB Congress, Uppsala, Sweden, August 2007 Nature Vol 418, 700-707
- 33. Why is this important? Nature Vol 418, 700-707
- 34. Drought in Africa between now and 2090 Red, Orange = More prone to drought Blue = Wetter and less prone to drought Hadley Centre, Met Office, UK
- 35. Crop Biodiversity The Seed Vault at Svalbard Global Crop Diversity Trust
- 36. Serendipity Natural Hybridisation Many modern crop species are the result of ancient (or recent) hybridisation events. Cotton Wheat Oilseed Rape Maize
- 37. Wheat a classic allo-hexaploid ESEB Congress, Uppsala, Sweden, August 2007 Science Vol 316, 1862-1866
- 39. Wheat a classic allo-hexaploid ESEB Congress, Uppsala, Sweden, August 2007
- 40. The New Rice for Africa Monty Jones 2004
- 41. • Organisation and importance of Diversity • Selection is a powerful tool but need to understand & know what to select for. • Importance engagement. – Journalists to articulate and sell stories!
- 42. Breeding major technology platform for food, water & energy security Next steps ? Proteomics Genomics Analytical Technology Transgenic Traits Molecular Engineering Winter Nurseries Computer Technology Plot Mechanisation Quantitative Genetics Statistics Pedigree Breeding Hybridisation Open Pollinated Selection GermplasmImprovement (HigherSustainableYields) Time Plant Breeders use any combination of these technologies to develop enhanced products for customers, and continue to explore technologies to enhance this process New Opportunities for Agriculture
- 44. The Life sciences revolution Molecular biology Computer science Mathematics Exciting time Unlocking the genetic potential of the biosphere Sustainable food production Plant Breeding
- 45. May 2000 Life Science Companies SeedCompanies Joint Ventures Cooperatives Other Companies GarstGarstSeed Co.Seed Co. December 1997 20% Equity ExSeedExSeedGenetics LLCGenetics LLC AstraZeneca PLC United Kingdom Mogen International NVMogen International NV The Netherlands Cooperatie CosunCooperatie CosunUA UA The Netherlands InterstateInterstatePayco Payco August 1996 50% Equity August 1996 50% Equity June 1997 $78 M 100% Equity 100%Equity August 1996 100%Equity August 1996 100%Equity Advanta BVAdvanta BV The Netherlands RoyalVanderHaveRoyalVanderHaveThe Netherlands KoipesolKoipesol//AgrosemAgrosem//AgraAgra Spain ItalyFrance ZimmermanZimmerman Hybrids, Inc.Hybrids, Inc. 1998 100%Equity France April 1998 100%Equity November 1998 50% Equity Land O’ Lakes November 1998 50% Equity December 1998 40% Equity August 1998 100%Equity July 1999 100%Equity July 1999 80% Equity U.S. CooperativeU.S. Cooperative System:System:CroplanCroplanGenetics, FFR,Genetics, FFR, GrowMarkGrowMark, etc., etc. Wilson Seeds, Inc.Wilson Seeds, Inc. Sturdy Grow Hybrids, Inc.Sturdy Grow Hybrids, Inc. MaisadourMaisadourSemencesSemencesSASA Novartis AGNovartis AG (SyngentaAG) Switzerland AgritradingAgritradingItaly EridaniaEridaniaBeghinBeghin-Say-Say France July 1999 20% Equity SyngentaSyngenta AGAGDiversa Corp.Diversa Corp. CalgeneCalgene, Inc., Inc. July 1996 100%Equity May 1998 $100 M50% Equity Joint Venture 1982 100%Equity AgriProAgriProSeedSeed WheatWheatDivisionDivision Cargill Hybrid SeedsCargill Hybrid Seeds North AmericaNorth America May 1998 $100 M50% Equity Joint Venture HybriTechHybriTechEurope SAEurope SA France February 1996 90% Equity February 1996 10% Equity PauPauEuralisEuralisFrance CargillCargill, Inc., Inc. RenessenRenessen Cargill’sCargill’sInternationalInternational Seed DivisionSeed Division Corn States Hybrid Service, Inc.Corn States Hybrid Service, Inc. Corn States InternationalCorn States InternationalSarlSarl.. AsgrowSeedAsgrowSeed Company LLCCompany LLC July 1998 $525 M100%Equity July 1998 $1.4 B(est) March 1996 $1.2 B 40% Equity May 1998 $2.5 B 100%Equity Total cost $3.7 Billion November 1996 $240 M100%Equity January 1997 $1.02 B 100% Equity November 1997 $150 M100%Equity April 1996 $30 M 50%Equity November 1996 $50 M 5% Equity May 1997 $242 M45% Equity Total cost $322 Million April 1996 $150 M100%Equity November 1997 JV with FT Sementes June 1998 DeKalb GeneticsDeKalb Genetics CorporationCorporation AgracetusAgracetus, Inc., Inc. Plant BreedingPlant Breeding InternationalInternational Cambridge,Cambridge,LtdLtd.. United Kingdom First Line Seeds,First Line Seeds,LtdLtd.. Canada MonsoyMonsoy Brazil JacobJacobHartzHartz Seed Co., Inc.Seed Co., Inc. 1983 100%Equity Holden’sHolden’s FoundationFoundation SeedsSeeds Monsanto/ Pharmacia Monsanto/ Pharmacia Sementes AgroceresSementes AgroceresSASA Brazil HybriTechHybriTechSeedSeed Int’l., Inc.Int’l., Inc. CustomFarm SeedCustom Farm Seed July 1997 CereonCereon Mendel BiotechMendel Biotech ParadigmGeneticsParadigmGenetics March 1999 16.4% Equity UnitedUnitedAgriseedsAgriseeds, Inc., Inc. Morgan SeedsMorgan Seeds Argentina AdvancedAdvancedAgriTraitsAgriTraits December 1996 $9.4 M18.75% Equity March 1999 83.6% Equity March 1999 $15 M 25% Equity April 1998 $32 M 100%Equity September 1996 $34.6 M 100%Equity February 1996 $72 M 100%Equity September 1998 100%Equity October 1998 $322 M100%Equity MycogenMycogen CorporationCorporation Illinois Foundation Seed, Inc.Illinois Foundation Seed, Inc. Dow Agrosciences Dow Agrosciences VerneuilVerneuil Holding SAHolding SA France HibridosHibridosColoradoColoradoLtdaLtda FTFTBiogeneticsBiogeneticsdedeMilho LtdaMilho Ltda Brazil DinamilhoDinamilhoCarolCarol Productos Agricolas LtdaProductos Agricolas Ltda Brazil Large Scale Biology (BioSource)Large Scale Biology (BioSource) DiversaDiversa) BayerBayerParadigm Incyte LION Exelixis BASFBASF Lynx Lexicon Incyte Exelixis Ag Chem & Seed Industry December 1999 24% Equity 1993 80% Equity December 1999 76% Equity March 1998 50% Equity March 1998 50% Equity 12% Equity BiotechnicaBiotechnica International, Inc./International, Inc./ LG SeedsLG Seeds Akin Seed Co.Akin Seed Co. CallahanCallahan SeedsSeeds October 1993 80% Equity March 1994 100%Equity July 1994 85% Equity June 1994 100%Equity October 1990 100%Equity 99% Equity 1997 55% Equity Aventis CropScienceAventis CropScience AgrEvoAgrEvo Aventis SAAventis SA France ScheringScheringAGAG Germany 1997 25% Equity KWSKWS SaatSaat Mais AngevinMais Angevin France BiogemmaBiogemma France RhoBioRhoBioFrance France PauPau EuralisEuralis France NickersonNickerson SeedsSeeds United Kingdom Great LakesGreat Lakes Hybrids, Inc.Hybrids, Inc. Canada KingKingAgroAgroInc.Inc. Canada GroupeGroupe LimagrainLimagrain France ProagroGroupProagroGroup India Plant Genetic SystemsPlant Genetic Systems International (PGS)International (PGS) February 1999 100%Equity August 1996 75% Equity- $550M Germany Sementes Ribeiral LtdaSementes Ribeiral Ltda.. Sementes Fartura LtdaSementes Fartura Ltda Mitla Pesquisa Agricola LtdaMitla Pesquisa Agricola Ltda Brazil July 1999 100%Equity Plantec BiotechnologiePlantec Biotechnologie Germany 1996 95% Equity 15% Equity Nidera SemillasNidera Semillas Argentina Pending Up to 25% Equity Agritope/Agrinomics Diversa Brazil DoisDois MarcosMarcos March 1999 100%Equity Protein TechnologiesProtein Technologies InternationalInternational December 1997 $1.5 B100%Equity OptimumQualityOptimumQuality Grains, LLCGrains, LLC HybrinovaHybrinovaSASA April 1998 100%Equity August 1997 50% Equity E.I. DuPont deE.I. DuPont de Nemours & Co.Nemours & Co. Pioneer Hi-Bred International, Inc. Pioneer Hi-BredPioneer Hi-Bred International, Inc.International, Inc. October 1999 100%Equity August 1997 50% Equity Lynx OGS AffymetrixCuraGen Maxygen
- 46. ATGGATCTATCCCTGGCTCCGACAACAACAACAAGTTCCGACCAAGAACAAGACAGAGACCAAGAATTAACCTCCAACATGGAGCAAGCAGCAGCTCCGGTCCCAGCGGAAACAACAACAACCTTCCGATGATG ATGATTCCACCTCCGGAGAAAGAACACATGTTCGACAAAGTGGTAACACCAAGCGACGTCGGAAAACTCAACAGACTCGTGATCCCTAAACAACACGCTGAGAGTATTTCCCTCTAGACTCCTCAAACAACCAAA ACGGCACGCTTTTGAACTTCCAAGACAGAAACGGCAAGATGTGGAGATTCCGTTACTCGTATTGGAACTCTAGCCAGAGCTACGTTATGACCAAAGGATGGAGCCGTTTCGTCAAAGAGAAAAAGCTCGATGCA GGAGACATTGTCTCTTTCCAACGAGGCATCGGAGATGAGTCAGAAAGATCCAAACTTTACATAGATTGGAGGCATAGACCCGACATGAGCCTCGTTCAAGCACATCAGTTTGGTAATTTTGGTTTCAATTTCAATT TCCCGACCACTTCTCAATATTCCAACAGATTTCATCCATTGCCAGAATATAACTCCGTCCCGATTCACCGGGGCTTAAACATCGGAAATCACCAACGTTCCTATTATAACACCCAGCGTCAAGAGTTCGTAGGGTA TGGTTATGGGAATTTAGCTGGAAGGTGTTACTACACGGGATCACCGTTGGATCATAGGAACATTGTTGGATCAGAGCCGTTGGTTATAGACTCAGTCCCTGTGGTTCCCGGGAGATTAACTCCGGTGATGTTAC CGCCGCTTCCTCCGCCTCCTTCTACGGCGGGAAAGAGACTAAGGCTCTTTGGGGTGAATATGGAATGTGGCAATGACTATAATCAACAAGAAGAGTCATGGTTGGTGCCACGTGGCGAAATTGGTGCATCTTCT TCTTCTTCTTCAGCTCTACGACTAAATTTATCGACTGATCATGATGATGATAATGATGATGGTGATGATGGCGATGATGATCAATTTGCTAAGAAAGGGAAGTCTTCACTTTCTCTCAATTTCAATCCATGA DNA – a common language across living organisms in the biosphere genome programmes link understanding of biology to agriculture implications for: - forestry - aquaculture - livestock - arable Contemporary Science
- 47. Democratisation genomics Roche 454: Metagenomics, amplicon sequencing, BAC sequencing Illumina: HiScanSQ for genomes, transcriptomes or GBS / MiSeq for amplicons, small genomes, focused GBS and pilot experiments Ion Torrent: PGM for metagenomics, small genomes, BACS / Proton (due Sep ‘12!) for genomes, transcriptomes
- 48. Genes provide the foundation of new products for farmers biomass utility? improved agronomy? tolerance to cold? yield? tolerance to drought? flowering time? Genes Protein Trait Product
- 49. Marker- Aided Selection • Locating and tagging the genes for drought tolerance
- 50. Importance Genetics Market Identification by Trait, Crop, species Transgenic Plant Development Cell Culture Molecular Biology Genetics Variety Development Yield Trials Product Testing Products Genetic diversity Analytical Screens Biochemistry Germplasm Development Traditional & Molecular Breeding Genetics Molecular Genetics • 24 ABI 377 Automated sequencers • 20,000 Lane per week capacity Gene Discovery Plant Biology Genomics
- 51. Genetic software & Hardware
- 52. ALL THREE ARE CRITICAL IN DELIVERING YIELD TODAY – AND TOMORROW BREEDING Strategically breed plants to create new, more robust seeds that perform better – and longer – in the field. AGRONOMICS Use precision ag, planting density, plant health protection, and conservation tillage to make acres more productive. BIOTECHNOLOGY Supplement breeding advancements by adding special beneficial genes to the plant. “The Three Pillars of Yield”
- 53. Wamalwa Farm, Siritanyi FFS, Kanduyi. Maize-groundnut intercrop providing 5330 kg maize and 1203 kg groundnut per ha. These results indicate that MBILI can produce significant food surpluses. Rasike Farm, Chililila WG. MBILI maize-soyabean intercrop providing 1215 kg maize and 545 kg soyabean per ha when conventional intercrops failed. These results indicate that MBILI is a means toward greater food security.
- 54. Feeding future populations means doubling the productivity of neglected but nutritious crops such as yams and green bananas
- 56. Genomics and the People Century Genomics-based research will make a difference but only if there is integration across social & natural sciences.
- 57. Iowa maize yield 61-90; 90-08 1960 1970 1980 1990 2000 2010 0 3 6 9 12 b=95 kg/ha/yr R2 =0.51*** b=206 kg/ha/yr R2 =0.61*** Year Maizeyield(t/ha) GMOs
- 58. US maize yields still rising – why? -1.0 -0.5 0.0 0.5 1.0 1.5 2.0 1986 1988 1990 1992 1994 1996 1998 2000 2002 2004 2006 Source: Defra & USDA t/ha
- 59. 59 Scarcity The green revolution Set aside, CAP changesSubsidy and Surplus Security Set Aside Biofuels Food Prices Food Security
- 60. 60 Energy Climate Change Water (the new oil) Food Security Diet and Health < 1000 1000 - 2000 > 2000 Estimated global water scarcity in 2050 (from Wallace, 2000) per capita annual renewable freshwater resource (m3/person/year).
- 61. sunlight plants plant biodiversity science Agriculture, Land Use & Society Plants provide sustainable solutions ‘ultimate green & clean technology’
- 62. Sydney Brenner “Which type of science to fund is simple: all science is problem driven and should be judged by the importance of the problem and the quality of the solutions provided.” A Life in Science
- 63. In Era of Gene-Based Breeding, Amount of Data Explodes, Accelerating Ability to Realize Step-Change Improvements Reference genomes for each crop Genomes targeted for specific traits (disease) Genome for every yield plot GENOMES/YEAR
- 64. Public good plant breeding requiresPublic good plant breeding requires introduction of new sources diversityintroduction of new sources diversity DiversityDiversity BreedingBreeding MethodologyMethodology Traits &Traits & ProductsProducts OatsOats Forage grassesForage grasses Turf grassTurf grass LegumesLegumes MiscanthusMiscanthus New Opportunities but also complexityNew Opportunities but also complexity
- 65. Performance under farmers’ conditions and farmers’ acceptance Participatory maize breeding in Africa • Prioritize most important stresses under farmers’ conditions • Manage trials on experiment station and evaluate large numbers of cultivars, • Select the best, and … • Involve farmers – Mother trials in center of farming community grown under best-bet input conditions – Farmer-representative input conditions – Farmer-managed baby trials • Partnership with extension, NGOs, rural schools, and farmer associations The Mother / Baby trial design Collaborative, on-farm evaluation of maize cultivars
- 66. IMPROVED GERMPLASM GENES GenomicsGenetic Resources Genetic Engineering Marker-assisted Selection Conventional Selection Genebank accessions Segregating populations Forward/reverse genetic systems Structural Functional Plant Breeding Options
- 68. Ghana’s Success Story • MDG 1 achieved • Malnourished - 5.8m in 1993 to 2.7 m in 2003. • Declines in % underweight children and mortality • Strong agricultural growth since 80s • 25% increase due to area expansion • Maize yield up by 36%, cassava by 50% • New maize, yam, rice and cassava varieties • A pest resistant cassava. • Strong growth in smallholder cocoa & pineapples • Market liberalisation • New rural infrastructure Sources: Development Outreach, October, 08;Coulombe & Wodon, World Bank; Irish Hunger Report
- 69. All this is threatened by Climate Change • Higher temperatures • Greater & more intense rainfall • Greater droughts • River bank erosion • Rising sea levels • More intense cyclones • Salt water incursions
- 70. biology is the science of thebiology is the science of the natural world & critical to thenatural world & critical to the future of agriculture.future of agriculture. ‘all life depends on sunlight and a green leaf’
- 71. The biosphere – nature’s solutions
- 72. Separate Niches Source: Naylor R. and Battisti D. 2008 (pers comm) Source: Global Biodiversity Trust
- 74. Maize has more molecular diversity than humans and apes combined Silent Diversity (Zhao PNAS 2000; Tenallion et al, PNAS 2001) 1.34% 0.09% 1.42%
- 75. Selective Breeding is a Powerful Tool Picture courtesy of Roslin Institute
- 76. Projected losses of food caused by the adverse effects of climate change (2080)