Polymorphisme parasitaire et accès graves en zone périurbaine
Upcoming SlideShare
Loading in...5
×
 

Polymorphisme parasitaire et accès graves en zone périurbaine

on

  • 359 views

Polymorphisme parasitaire et accès graves en zone périurbaine - Conférence de la 5e édition du Cours international « Atelier Paludisme » - Ronan JAMBOU - Institut Pasteur de Dakar - ...

Polymorphisme parasitaire et accès graves en zone périurbaine - Conférence de la 5e édition du Cours international « Atelier Paludisme » - Ronan JAMBOU - Institut Pasteur de Dakar - rjambou@pasteur.sn

Statistics

Views

Total Views
359
Views on SlideShare
359
Embed Views
0

Actions

Likes
0
Downloads
0
Comments
0

0 Embeds 0

No embeds

Accessibility

Categories

Upload Details

Uploaded via as Adobe PDF

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

Polymorphisme parasitaire et accès graves en zone périurbaine Polymorphisme parasitaire et accès graves en zone périurbaine Presentation Transcript

  • High polymorphism of parasites isolates isassociated with Cerebral Malaria in Dakar.Bob NS, Diop BM, Marrama L, MT Ekala, Tall A, Ka B, HovettePh, Seck SY, O Mercereau-Puijalon, Jambou R1 Institut Pasteur de Dakar,2 Clinique des maladies infectieuses CHN Fann,3 Institut Pasteur Paris,4 Hôpital Principal de Dakar
  • Severe MalariaNewbornfeverdehydratationconvulsionMetabolic disorders= impaired consciousnessChildSevere anemia +++High parasiteamia +++Cerebral attackAdultRespiratory distresscerebral malarialow parasiteamia= delay in treatment
  • mechanic hypothesis View slide
  • Van der heyde 2006Activation des endothéliums = expression d’ICAMAdhesion RBCAdhesion leukocytesDisruption tigh junction = leakagehemorrhageApoptose ECAdhesion plateletsBlockage capillaries13223243mechanic + immune44InflammationLocal /general View slide
  • Do isolates differMILD / CEREBRAL malariaWhich mechanismthe most important ?RATIONALElow transmissionLow immunityDrug resistanceTravelHighly virulent strains ?treatment retardationMalaria in Urban area
  • 15°14°13°16°NDakar17°W 16° 15° 14° 13° 12°SENEGALArea of StudySeasonal transmission3 M inhabitantsAn arabiensis
  • Prevalence of malaria in consultations00,050,10,150,20,250,3septembre octobre novembre decembre0-1 y1- 4 y5-14 y15- 49 y> 50 y00,10,20,30,40,50,6septembre octobre novembre decembre00,050,10,150,20,250,30,350,4septembre octobre novembre decembrepart of class of age in the malaria casesprevalence of severe malaria.0200400600800100012001400M F M F M F M F M F0-1 an 1- 4ans 5-14 ans 15- 49 ans 50ans &+consultations by age
  • MALARIA AT CHN FANNNumber of cases / 20040 100 200 300 400 500 600CHOLERAHIVmalariaTetanosinfectionsMeningitidesTuberculosisOthersIn emergency unit, malaria = only 10% of the patients
  • Number of severe malaria : 170Geographic origin of the patients : Dakar 92%(urban population in Africa : 2030 = 50%)Seasonality of the casesSevere Malaria at CHN Fann , 2004MALARIA AT CHN FANN – 2004 -Rainy season0510152025303540NombredeJ F M A M J J A S O N DMois
  • Age : 15-34 ans = 64% of patientsSex-ratio = 1,46 (male +++)Delay before hospitalization > 48 hours for 68% patientsEvolution- Duration of hospitalization : mean 5 days [0 to 40 d]- Total Mortality : 26,8%MALARIA AT CHN FANN
  • HospitalsHospitals(1) Clinical enrolment : cerebral disorder + fever(1) Clinical enrolment : cerebral disorder + fever(2) Classification as(2) Classification as-- cerebral malaria (cerebral malaria (ICT + thick smear (+) / meningitides (ICT + thick smear (+) / meningitides (--) / Glasgow) / Glasgow))-- Mild malariaMild malaria-- othersothersDispensariesDispensaries(1) mild malaria : ICT and thick smear (+) / fever / symptoms of(1) mild malaria : ICT and thick smear (+) / fever / symptoms ofmalaria / no symptoms of CMmalaria / no symptoms of CM(2) matched for age / gender / area in town, with CM(2) matched for age / gender / area in town, with CMENROLMENT
  • TAGCATGTTTGGTATAGGGGTTAAATCAGGACAACATTAGGGAACATCATAAGGATAGCATGTTTGGTATAGG161Chr6TAA109GAGTAATA TGAACATGTAATGGCAACACCATTCAACATGGGTTAAATGAGGTACAGAGTAATA TGAACATGT112Chr6TAA87ATCATGCATTTCAGTCTGAGGTCTGCTTGTTCCTTCTTTCTTTCATCGATACTACGAATCATGCATTTCAGTCTGAGG168Chr12PFPK2TTATGTTGGTACCGTGTATGTTAATCGTAGGGATAAGATCTCAACGGAAATTATTTATGTTGGTACCGTGTA98Chr12PFGG377TATTAATAATACTCAAAGCGAATAAACAAAGTATTGCTGTACATATGAATCACCAATATTAATAATACTCAAAGC70Chr11ARA2ATGATGTGCAGATGACGAGTGCATTCAATAATTCTATTCTAAATAGATCCAAAGATGATGTGCAGATGACGA87Chr102490CTTTAGTAGTAGTAATAATACTAGAAACAGGAATGATACGACAAAAGGGTGGTGATTCTCTTTAGTAGTAGTAATAATAC183Chr5TAA42GTAATATTTAAAAAGAGAAGTTTGTAATATTTAAAAAGAGAAGATGTGTAAGGAGATAGTATAGTAATATTTAAAAAGAGAAG112Chr77A11TGACTCTTTGATTATATACCCAAAAGAAGTAATATATGTGCCCCAAAAGAAGTAATATATGTGCTGACTCTTTGATTATATACC133Chr9BM27Primers 2Primers 1SizeChromosomeNameMicrosatellites and primers used in this study
  • DHFR1850 bpSequencing of Pfdhfr and exon 2 Pfcrtdhfr tsPfCRTExon 2PCR amplificationSequencing250 bp
  • Hôpital Principal de DakarHôpital Principal de Dakar59 patients : 20 CM / 3959 patients : 20 CM / 39 mildmild malariamalaria2727 womenwomen / 32/ 32 menmenage : 2 to 67age : 2 to 67 yearsyearsCHNCHN FannFann15 patients : 12 CM / 315 patients : 12 CM / 3 mildmild5 W et 10 M5 W et 10 Mage 16 to 42age 16 to 42 yearsyearsCentre de SantCentre de Santéé GuediawayeGuediawaye104 patients : 2 CM / 102104 patients : 2 CM / 102 mildmild malariamalaria66 W et 38 M66 W et 38 Mage 3 to 65age 3 to 65 yearsyearsPATIENTS
  • CLINICAL DATA57,8%31,7%35,3%patients consulting before 4 daysafter beguining of the symptoms18,4 %38,5 %27,5 %patients treated beforeconsultation1043612762656Parasitemia (paras. / µL)10,612,29,7Hemoglobin (mean g/L)14 %12,5%14,7%Patients with temperature> 40°C (%)0.81.51Sex ratio13.7 (11)15.5 (13)14.5 (10.3)Mean age (SD)1024234N°patientsMild Mal.dispensaryMild MalHospitalCerebralmalaria
  • MUTATIONS in DHFR and PfCRT+++triple+++++two+-+oneNRImutantSCNwild1085951codonMM n= 28CM n= 16MM n= 102CM n= 37DHFR CRT exon 20%5%10%15%20%25%30%35%40%45%Wild 1 mutat. 2 mutat. 3 mutat.0%10%20%30%40%50%60%70%80%90%CVIET CVIET/CVMNK CVMNKCMMM
  • Multiple Infections0102030405060708090100CerebralMalariaMild Mal(hosp)Mild Mal.(dispens)00,511,522,5Percent of multi-infectionn°population/ patients
  • Multiple Infections (by microsatellite)05101520253035404550TAA42PFPK2m2490ARA2TAA87BM27TAA109PFG3777A11Cerebral MalariaMild Mal (hosp)Mild Mal. (dispens)TAA109, PFG377, 7A11, ARA2 = highlypolymorphic in hospitalized patients
  • Number of alleles to describe50% of the patientsAverage = 2 for CM / 1 for MMTotal number of alleles/µSatAverage = 8 for CM and MM= same024681012141618TAA42PFPK2m2490ARA2TAA87BM27TAA109PFG3777A11Cerebral MalariaMild Mal (hosp)Mild Mal. (dispens)00,511,522,533,5TAA42 PFPK2 m2490 ARA2 TAA87 BM27 TAA109PFG377 7A110123456TAA42PFPK2m2490ARA2TAA87BM27TAA109PFG3777A11Number of alleles ot describe75% of the patientsAverage = 3 for CM / 2 for MMAll µSat = more polymorphicin hospitalized patients
  • TAA4200,10,20,30,40,50,60,70,80,91 2 3 4 5 6 7 8 9 10 11 12MMCM249000,10,20,30,40,50,61 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16ARA200,050,10,150,20,250,31 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16PFPK200,050,10,150,20,250,30,350,40,450,51 2 3 4 5 6 7 8 9 10 11numéro dallèleTAA8700,10,20,30,40,50,61 2 3 4 5 6 7 8 9 10 11BM2700,10,20,30,40,50,61 2 3 4 5 6 7 8 9 10TAA10900,050,10,150,20,250,30,350,40,451 2 3 4 5 6 7 8 9 10 11 12 13FrequencyPFG37700,050,10,150,20,250,30,350,40,451 2 3 4 5 6 7 8 9 107A1100,050,10,150,20,250,30,350,40,451 2 3 4 5 6 7 8 9 10 11 12N°of Alleles?
  • No impact ofNo impact of bednetsbednets on the diversity of the parasiteson the diversity of the parasitesNo impact of treatment before consultationNo impact of treatment before consultationNo correlation between parasiteamia or age andNo correlation between parasiteamia or age andpolymorphismpolymorphismFever more than 40Fever more than 40°° associated with multiple infectionsassociated with multiple infectionsIsolates with medium parasiteamiaIsolates with medium parasiteamia [100 et 1000[100 et 1000 tropho./tropho./µµll]]associated with more polymorphic isolates and with CMassociated with more polymorphic isolates and with CMClinical features and polymorphismNo linkage between a specific allele of µSta and :- location in the town,- type of infection, anemia, high parasiteamia..etc- DHFR and CRT genotypes
  • Cerebral malaria associated with- multiple infections (higher inoculation rate ?)- lower parasiteamia ( treatment ? sequestration ?)- higher allelic diversityNo change in alleles repartition for the different types ofinfection = no evidence of specific isolates associatedwith a specific featureCONCLUSIONSo why such a polymorphismIn low transmission areaHigher diversity = more pathology ??
  • No malaria during wintersuburban area :-good quality surface water =An arabiensis- high density of population- low immunity- daily transfer of workers- Input of parasites from the ruralarea at the beginning of the rainyseason = end of vacationsTransmissionSelection of strainsTreatmentOrigin of the polymorphism
  • Many thanks for the medical staffsCentre de Santé de Guediawaye,Service de Maladie infectieuses CHN de FannService de Maladie infectieuses Hopital principal de DakarPrograms : RAI –FSP MAE , ParisRESMAL-Chip, EUAcademie des Sciences, Prix Louis DGenopole Institut Pasteur