Your SlideShare is downloading. ×
  • Like
Embed Repro Test
Upcoming SlideShare
Loading in...5
×

Thanks for flagging this SlideShare!

Oops! An error has occurred.

×

Now you can save presentations on your phone or tablet

Available for both IPhone and Android

Text the download link to your phone

Standard text messaging rates apply
Published

 

Published in Technology
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Be the first to comment
    Be the first to like this
No Downloads

Views

Total Views
154
On SlideShare
0
From Embeds
0
Number of Embeds
1

Actions

Shares
Downloads
11
Comments
0
Likes
0

Embeds 0

No embeds

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
    No notes for slide
  • Above is Illumina created pictureBarcode adapters contain sequences that are optimized to provide equal representation of all barcodes in a pool
  • Usinga different approach i.e. Using an initial targeted PCR to enrich the region in which the mutation is located Treff and colleagues have shown accurate mutation detation and 100% concordance with STR and minisequencing. However, for aneuploidy parallel analysis by real time qPCR was used.... So not clear that there is any advantage in using the sequencer as minisequencing is well established and accurate etc...
  • Pyrosequencing – taking a single strand of the DNA to be sequenced and then synthesizing its complementary strand enzymaticallySequencing by synthesis - massively parallel sequencing of short reads using solid phase sequencing by reversible terminatorsSemiconductor sequencing – millions of wells capture chemical information that is related to a nucleotide.SMRT Technology – Phospholinked nucleotides are introduced to the DNA strand – occurs in real time
  • Nanopore sensing – events that create characteristic disruption in current.

Transcript

  • 1. Next Generation Sequencing
  • 2. Basics of NGS • Fragmentation of DNA into a Library of smaller fragments. • Libraries are then sequenced to be duplicated. • Bioinformatics piece together the small fragments to create a map and reference it to the human genome.
  • 3. Differences between methods PCR Detects aneuploidy Detects gene defects Detects mitotic errors 1-2 month of Preparation Requires affected proband Applicable to any case * Karyomapping using BlueGnome PCR + aCGH SNP Next Gen arrays* Sequencing no yes no yes no yes yes yes yes yes no yes yes yes no no yes no yes yes yes no no yes
  • 4. Next Generation Sequencing (NGS) Fragmentation Each region of the genome sequenced multiple times GTACCATAGGATACGACTTGCAGCGGCA ATATTGCGTATA Millions of short sequences produced CAGCGGCAGATGATTCGGGGATATTG AGGATACGACTTGCAGCGGCAGATGATT TGCGTATAGG Sequences are compared to the known human CAGATGATTCGGGGATATTGCGTA genome ACCATAGGATACGACTTGCAGCGGC TAGAGTACCATAGGATACGACTTGCAACGGCAGATGATTCGGGGATATTGCGTATAGGCTA Known sequence (CFTR gene chromosome 7) Mutations identified and amount of DNA (aneuploidy) revealed
  • 5. Multiplexing Chart Title 900 800 700 600 Cost 500 Number of samples 400 Price 300 200 100 0 1 3 5 7 9 111315171921232527293133353739414345474951535557596163 Number of Samples Sample 1 2 3 4 5 6 7 8 9 10 11 12 54 55 56 57 58 59 60 61 62 63 64 Cost 819.9811 435.7911 307.7278 243.6961 205.2771 179.6644 161.3697 147.6486 136.9766 128.4391 121.4538 115.6328 65.83035 65.57164 65.32216 65.08144 64.84902 64.62448 64.40742 64.19748 63.99432 63.7976 63.60703
  • 6. PGD for aneuploidy and gene defects using NGS: Method • With WGA only <10% is sequenced • Solution: enrich the sequences of interest prior to NGS. An aliquot of the WGA product was used to amplify by PCR the CF ΔF508 mutation site on a cell line • The gene was sequenced with a x30 depth • All cells were found to be euploid and homozygotic for ΔF508. • Conclusion: useful for DIRECT mutation analysis and aneuploid D Wells, KKaur, A Rico, J Grifo, S Anderson, J Sherlock, JC Taylor , S Munne (submitted) Rapid genetic analysis of single cells using a next generation sequencing methodology: application to human embryos reveals aneuploidy and DNA sequence mutations
  • 7. PGD for aneuploidy and gene defects using NGS: Results Cystic fibrosis gene (CFTR) F508 mutation sequenced in a single blastomere D Wells, KKaur, A Rico, J Grifo, S Anderson, J Sherlock, JC Taylor , S Munne (submitted) Rapid genetic analysis of single cells using a next generation sequencing methodology: application to human embryos reveals aneuploidy and DNA sequence mutations
  • 8. • 38 blastocysts from 13 couples with structural chromosomal abnormalities • Whole genome sequence by Illumina HiSeq2000 • Results: 0.07x depth with average 5.5% genome coverage • 26 (68%) blastocysts euploid, 6 (16%) aneuploid, 4 (11%) unbalanced only, 2 (5%) unbalanced and aneuploid • Highly concordant with SNP array results Yin et al (2013) Biol Reprod 88, 69
  • 9. • 21 blastocysts from couples at risk of cystic fibrosis and one of Walker-Warburg syndrome • Whole genome amplification was followed by targeted Taqman amplification of mutation site, sequenced by Ion Torrent and 8 barcoded samples per chip • Real time qPCR used for 24 chromosome aneuploidy testing • 17 (81%) blastocysts euploid, 4 (19%) aneuploid • 100% concordance of mutation status with STR and minisequencing Treff et al (2013) Fertility and Sterility 99, 1377-1384
  • 10. PGD for aneuploidy and gene defects using NGS: Results • A homozygotic cell line for ΔF508 was used • The gene was sequenced with a x30 depth • All cells were found to be euploid and homozygotic for ΔF508. • Conclusion: this method can be use for DIRECT mutation analysis and aneuploid • Other methods such as SNPs can only do haplotype analysis D Wells, KKaur, A Rico, J Grifo, S Anderson, J Sherlock, JC Taylor , S Munne (submitted) Rapid genetic analysis of single cells using a next generation sequencing methodology: application to human embryos reveals aneuploidy and DNA sequence mutations
  • 11. Summary Next Gene Sequencing Current Advantages: - Same resolution for chromosome abnormalities than aCGH - Detection of mitochondrial DNA: potentially useful - Simultaneous detection of aneuploidy and gene defects Future advantages: - Whole gene sequencing
  • 12. Vendors of Next Generation Sequencing Company Models Benchtop Chemistry Roche (454) GS FLX/GS Junior Yes Illumina MiSeq/HiSeq/Ge Yes nome Analyzer Sequencing by synthesis Ion Torrent PGM/Proton/SO LiD 4 Yes Semiconductor sequencing PACBio PACBIO RS II No SMRT technology Pyrosequencing
  • 13. Vendors of Next Generation Sequencing or Equivalent Company Models Benchtop Chemistry Oxford Nanopore Technologies GridION System/MinION No Nanopore Sensing RainDance Technologies ThunderStorm System/RDT 1000 Yes High-Throughput/LowMed Targeted Sequencing Helicos (Bankrupt) N/A N/A N/A Complete Genomics Proprietary Sequencing N/A Proprietary (Long Fragment Reads?)
  • 14. Ion Torrent for Aneuploidy Validation • 10 single cells from cell lines with known aneuploidies • 40 embryo cells (previously diagnosed using aCGH) • • • • Calculated amount of sequence from each chromosome 50/50 (100%) of samples gave a result 48 separate aneuploidies detected 100% diagnostic accuracy (in a blinded experiment)
  • 15. First baby born from NGS First NGS baby: David Levy A collaboration of Reprogenetics-US and Reprogenetics-UK (Dagan Wells) and Main Line Fertility (Dr. Glassner)
  • 16. Helpful tools for NGS • https://genohub.com/next-gen-sequencing-services/